Re: [ccp4bb] Room temperature change from 25ºC to 20ºC

[Jurgen Bosch]

Hi Mark,

Well, you don't have to look far. Spain (kind of where you are), France, 
Germany they will start cooling as well to reach that temperature for most of 
the year.
I don’t think it will be feasible considering going green is what Europe wants 
to achieve.

Jürgen 

> On Apr 1, 2024, at 10:29 AM, Mark  wrote:
> 
> Room temperature change from 25ºC to 20ºC
> 
> As a member of the inter-society standards commission St-Incent I have been 
> asked to take the bearings of the structural biology community regarding a 
> proposal to lower the universally understood room temperature from 25ºC (77º 
> Fahrenheit) to 20ºC (68º Fahrenheit). Obvious advantages would be less 
> heating necessary for experiments at this standard temperature. Given that 
> laboratories nowadays are not commonly heated to this high temperature 
> anyway, it does appear to make sense.
> 
> Members of tropical and subtropical countries have already expressed 
> opposition to the proposal, because they have to reach room temperature by 
> cooling rather than heating, so for them the proposal would mean more CO2 
> emissions, not less.
> 
> Please express opinions to this list today, so that I have time to collate 
> them before the local deadline of 28 December.
> 
> 
> Mark J van Raaij
> Dpto de Estructura de Macromoleculas, lab 20B
> Centro Nacional de Biotecnologia - CSIC
> calle Darwin 3
> E-28049 Madrid, Spain
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Glide fails to generate accurate docking pose

[Jurgen Bosch]

You could
a) change the force field used
b) increase the docking resolution
c) switch to a different program e.g. FRED from OpenEye
d) examine if you limited the amount of generated confirmers for your
ligand. If you have two or three rotatable bonds you can easily generate
>1000. And it seems your molecule might have more than that
e) maybe you can model the ionic strength of the crystallization conditions
(not sure schroedinger has a function for that)
f) reach out to the folks at Schroedinger to help you.

Some thoughts,
Jürgen
__
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University

https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

On Jan 3, 2024, at 18:23, Thripthi Shenoy  wrote:


Greetings to all.

I am trying to dock a co crystallized ligand using GLIDE. The co
crystallized ligand is a big molecule with multiple rotatable bonds. GLIDE
is unable to regenerate the ligand pose. I tried limiting the rotatable
bonds, but in vain. I would be grateful to receive any advice or suggestion
as to how I can proceed.

Thanking you in advance,
Regards,
Thripthi S.

--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] What could these crystals be?

[Jurgen Bosch]

You could also run them on a gel if you don’t want to shot with canons on small 
birds.

Jürgen


> On Nov 8, 2023, at 11:33 AM, M T  wrote:
> 
> Dear Careina,
> 
> If you have easy access to mass spectrometry, you can try to fish/rince your 
> « pumpkin seeds » and send them to mass to try to identify what is inside to 
> see if it needs optimization or not.
> 
> Best.
> 
>> Le 8 nov. 2023 à 16:03, 02531c126adf-dmarc-requ...@jiscmail.ac.uk a 
>> écrit :
>> 
>> 
>> Hi all
>> We have been trying with no success to crystalize a protein. Recently we got 
>> these strange shape "crystals". They are hard and flat but they do not 
>> diffract at all. Any ideas as to what could cause this?
>> Careina
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>> 
>> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] What could these crystals be?

[Jurgen Bosch]

Have you tried crushing these up and seeding?

Jürgen

___
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University
Cleveland, OH 44106
https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC



> On Nov 8, 2023, at 10:00 AM, careinaedgo...@yahoo.com 
> <02531c126adf-dmarc-requ...@jiscmail.ac.uk> wrote:
> 
> 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Dry shipper in limbo

[Jurgen Bosch]

The AirTag is a good idea, I shall implement that. I’ve had samples stuck
from Canada to US, also in Memphis. It was just protein on dry ice but
needless to say when it arrived it was very dry but no ice.
Hopefully you will be lucky and retrieve your samples within the next 14
days.

Jürgen

__
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University

https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

On Jul 28, 2023, at 07:50, Jon Cooper <
488a26d62010-dmarc-requ...@jiscmail.ac.uk> wrote:

Hello, I don't do anything MAC but maybe shipping dewars would be a good
situation for an Apple Airtag, which I read about recently, or equivalent,
if there are any?

Best wishes, Jon Cooper. jon.b.coo...@protonmail.com

Sent from Proton Mail mobile



 Original Message 
On 28 Jul 2023, 08:56, Savvas Savvides <
9d24f7f13e09-dmarc-requ...@jiscmail.ac.uk> wrote:


Dear Kevin,

A similar incident from just two weeks ago, in Europe in our case, was
resolved by travelling to the regional FedEx package
collection/distribution center to recover the dry-shipper in person. This
involved gaining access to the FedEx center and talking to the right people.

I would absolutely not wait this out because your shipment is probably
somewhere in the corner of a distribution center used as a seat by
employees taking a break. I can attest to the fact that they do have such
corners where “problematic" shipments are piled up!

Despite what you were told on the phone or could deduce from any online
tracking systems (in our case the dry-shipper was not even trackable),
there is still a (very good) chance that your shipment might still be at a
regional collection/distribution center.

The key is to get to any information about where this place might be, talk
to the local people, and find out what the actual route of the shipment
might have been after getting picked up from your lab. The routes often
involve intermediate collection/distribution sites.

To their credit, and in contrast to the general FedEx customer service, the
people at the regional FedEx distribution center (including the shift
manager) were very empathic and helpful, and used means that go above and
beyond SOPs to help. This included sharing photos of the shipment via
WhatsApp with drivers/employees of the three previous shifts etc… Despite
the volumes of work they handle, drivers and other courier employees
actually do remember unusually looking shipments, such as a shipping-case
containing a dry-shipper!

Best of luck and wishes,
Savvas




On 28 Jul 2023, at 08:15, Savvas Savvides  wrote:



Best wishes,
Savvas

Begin forwarded message:

*From:* "Dr. Kevin M Jude" 
*Date:* 28 July 2023 at 05:16:39 CEST
*To:* CCP4BB@jiscmail.ac.uk
*Subject:* *[ccp4bb] Dry shipper in limbo*
*Reply-To:* "Dr. Kevin M Jude" 


My first adventure in international crystallography is off to an
inauspicious start. On Monday, I sent a dry shipper “overnight” from
California to Saskatchewan, but it has been stuck in the Memphis FedEx
facility for a few days. I’ve gotten several conflicting explanations of
the status from FedEx on the phone, but the most likely seems that it has
“pre-cleared” customs and yet has not yet made it to Calgary. It’s not
clear whether anyone actually knows where the shipping case is, since I was
asked to give a physical description of it. Is there anything else I can do
from a few thousand miles away, or do I just have to wait this out?

-- 
Kevin Jude, PhD
Structural Biology Research Specialist, Garcia Lab
Howard Hughes Medical Institute
Stanford University School of Medicine
Beckman B177, 279 Campus Drive, Stanford CA 94305
Phone: (650) 723-6431

--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Structure prediction - waiting to happen

[Jurgen Bosch]

I was afraid of this happening at some point and decided to start a new career 
~ten years ago and use structures only as a tool and never put them into the 
centerpiece of a grant.

My fall back option is either a cocktail bar or starting a restaurant. The 
Triple M’s always work Mojito, Martini, Manhattan 

Jürgen 
> On Apr 1, 2023, at 11:29 AM, Dale Tronrud  wrote:
> 
> Hi,
> 
>   Just ask ChatGPT to write it for you!
> 
> Dale Tronrud
> 
> 
> 
> On 4/1/2023 5:06 AM, Subramanian, Ramaswamy wrote:
>> Dear All,
>> I am unsure if all other groups will get it - but I am sure this group will 
>> understand the frustration.
>> My NIH grant did not get funded.  A few genuine comments - they make 
>> excellent sense.  We will fix that.
>> One major comment is, “Structures can be predicted by alpfafold and other 
>> software accurately, so the effort put on the grant to get structures by 
>> X-ray crystallography/cryo-EM is not justified.”
>> The problem is when a company with billions of $$s develops a method and 
>> blasts it everywhere - the message is so pervasive…
>> *Question: I*s there a canned consensus paragraph that one can add with 
>> references to grants with structural biology (especially if the review group 
>> is not a structural biology group) to say why the most modern structure 
>> prediction programs are not a substitute for structural work?
>> Thanks.
>> Rams
>> subra...@purdue.edu
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1 
>> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
> https://www.jiscmail.ac.uk/policyandsecurity/



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Alexey Vagin

[Jurgen Bosch]

Sorry to hear, he helped me a very long time ago during my PhD time when I
was running into troubles with some of his programs.

The York CCzp4 weekends were fun indeed, finishing off some wines tgat Paul
Adam’s had stored away.
Jürgen

__
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University

https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

On Mar 26, 2023, at 14:40, James Foadi <
09daa8ec3774-dmarc-requ...@jiscmail.ac.uk> wrote:

 I am very sad to hear this! Alexey was one of my favourites when I was in
York, and I have had many lovely conversations with him. You are right,
Eugene, his contributions have helped and will keep helping many
crystallographers and methods developers.

May his soul rest in peace!

James


Sent from Yahoo Mail for iPhone 

On Sunday, March 26, 2023, 7:29 pm, Eugene Krissinel - STFC UKRI <
6fcecdb9c847-dmarc-requ...@jiscmail.ac.uk> wrote:

Dear All,

It is with a great sadness that I share with you that Alexey Vagin passed
away this Saturday in the Radcliffe Hospital in Oxford after suffering from
a heart attack with subsequent complications. He was 78 years old.

Alexey made many developments in methods and software for macromolecular
crystallography, to which he devoted his whole life. He is known for his
BLANC Suite for structure solution done at the Moscow Institute of
Crystallography in the 1980s, as well as for his contributions to Refmac
and Monomer Library. Many thousands of researchers have benefited from his
work on Molrep and Balbes software for Molecular Replacement. After his
retirement in 2010, Alexey developed and actively maintained the MorDA
software for MR, which became a monument to his efforts.

Alexey's work will continue to serve generations of researchers through his
contributions to CCP4, where we will take the best care of his
distinguished legacy.

With sympathy to everyone who knew Alexey personally and for whom this is
very sad news,

Eugene


--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1


--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] To Trim or Not to To Trim

[Jurgen Bosch]

I’m sure James H. Is preparing a philosophical dissertation on the "State of 
the atoms to B or not to B that is not only a refinement question” that he will 
share momentarily with the board.

Jürgen 

> On Mar 10, 2023, at 12:06 PM, DEBANU DAS  
> wrote:
> 
> Yes, zero occupancy would reflect that. But not the coordinates in any proper 
> way. 
> Debanu
> 
> On Fri, Mar 10, 2023 at 8:58 AM Jurgen Bosch  <mailto:jxb...@case.edu>> wrote:
>> Going back to RIP phasing methods :-)
>> So Harry in your particular case occupancy of zero would actually reflect 
>> reality for those “combusted” atoms.
>> 
>> Jürgen 
>> 
>> > On Mar 10, 2023, at 11:56 AM, Harry Powell 
>> > <193323b1e616-dmarc-requ...@jiscmail.ac.uk 
>> > <mailto:193323b1e616-dmarc-requ...@jiscmail.ac.uk>> wrote:
>> > 
>> > Hi folks
>> > 
>> > One other thing that I haven’t noticed anyone mentioning yet (sorry to 
>> > those who have mentioned it!!) is that you may not see your sidechain 
>> > atoms in density because they are not there at all, in spite of what you 
>> > may have had in the original protein, or even if the atoms were really 
>> > there in the crystal _before_ exposure to the beam.
>> > 
>> > The coordinates are supposed to be what you actually find, not what you 
>> > hope is there.
>> > 
>> > Just my two ha’porth
>> > 
>> > Harry
>> > 
>> > 
>> > 
>> > To unsubscribe from the CCP4BB list, click the following link:
>> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>> > 
>> > This message was issued to members of www.jiscmail.ac.uk/CCP4BB 
>> > <http://www.jiscmail.ac.uk/CCP4BB>, a mailing list hosted by 
>> > www.jiscmail.ac.uk <http://www.jiscmail.ac.uk/>, terms & conditions are 
>> > available at https://www.jiscmail.ac.uk/policyandsecurity/
>> 
>> 
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>> 
>> This message was issued to members of www.jiscmail.ac.uk/CCP4BB 
>> <http://www.jiscmail.ac.uk/CCP4BB>, a mailing list hosted by 
>> www.jiscmail.ac.uk <http://www.jiscmail.ac.uk/>, terms & conditions are 
>> available at https://www.jiscmail.ac.uk/policyandsecurity/




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] To Trim or Not to To Trim

[Jurgen Bosch]

Going back to RIP phasing methods :-)
So Harry in your particular case occupancy of zero would actually reflect 
reality for those “combusted” atoms.

Jürgen 

> On Mar 10, 2023, at 11:56 AM, Harry Powell 
> <193323b1e616-dmarc-requ...@jiscmail.ac.uk> wrote:
> 
> Hi folks
> 
> One other thing that I haven’t noticed anyone mentioning yet (sorry to those 
> who have mentioned it!!) is that you may not see your sidechain atoms in 
> density because they are not there at all, in spite of what you may have had 
> in the original protein, or even if the atoms were really there in the 
> crystal _before_ exposure to the beam.
> 
> The coordinates are supposed to be what you actually find, not what you hope 
> is there.
> 
> Just my two ha’porth
> 
> Harry
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
> https://www.jiscmail.ac.uk/policyandsecurity/



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] To Trim or Not to To Trim

[Jurgen Bosch]

I’d say no trimming to side chains for the following reason: There are 
non-structural biologists using PDB files and if atoms are missing they don’t 
know what to do. A better approach is where no side chain density allows 
support of placement, pick the most common rotamer and set the occupancy to 
zero for those atoms lacking density support. More work for you but more 
accurate in my opinion.

Jürgen


___
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University
Cleveland, OH 44106
https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC



> On Mar 9, 2023, at 9:45 PM, Bernhard Lechtenberg 
> <968307750321-dmarc-requ...@jiscmail.ac.uk> wrote:
> 
> Hi Rhys,
>  
> I am also all for leaving side chains and letting the B-factors deal with the 
> weak/absent density.
>  
> I don’t think there is a consensus, but I kind of remember that somebody did 
> a poll a few years ago and if I remember correctly the main approaches were 
> the one described above, or trimming the side-chains.
>  
> Bernhard
>  
> Bernhard C. Lechtenberg PhD
> NHMRC Emerging Leadership Fellow
> Laboratory Head
> Ubiquitin Signalling Division​​
> E lechtenber...@wehi.edu.au 
> T +61 3 9345 2217
>  
>  
> From: CCP4 bulletin board  on behalf of Rhys Grinter 
> <22087c81e8c6-dmarc-requ...@jiscmail.ac.uk>
> Date: Friday, 10 March 2023 at 12:26 pm
> To: CCP4BB@JISCMAIL.AC.UK 
> Subject: [ccp4bb] To Trim or Not to To Trim
> 
> Hi All,
>  
> I'm trying to crowdsource an opinion on how people deal with modelling side 
> chains with poorly resolved electron or cryoEM density.
>  
> My preference is to model the sidechain and allow the B-factors to go high in 
> refinement to represent that the side chain is flexible. However, I'm aware 
> that some people truncate sidechains if density is not present to justify 
> modelling. I've also seen models where the sidechain is modelled but with 
> zero occupancy if density isn't present. 
>  
> Is there a consensus and justifying arguments for why one approach is better?
>  
> Cheers,
>  
> Rhys
>  
>  
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Coot 1

[Jurgen Bosch]

Yay!!

I can now blend it with blender.

Jürgen

__
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University

https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

On Apr 1, 2022, at 18:46, Paul Emsley  wrote:



That, for the record, is more or less what Ralf said 18 years ago.
On 01/04/2022 23:38, Pavel Afonine wrote:

It's April 1st today, isn't it? -;)


On Fri, Apr 1, 2022 at 3:15 AM Paul Emsley 
wrote:

> Coot 1
>
> 18 years after the release of Coot 0 it's time that I actually released
> Coot 1.
>
>
--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] am I doing this right?

[Jurgen Bosch]

The EM and Cryo-EM world might have something to say about that perhaps.

Isn’t RIP phasing coming from what you are describing as well?

Just curious,

Jürgen

__
Jürgen Bosch, PhD, MBA
Center for Global Health & Diseases
Case Western Reserve University

https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

On Oct 17, 2021, at 13:24, James Holton  wrote:

Thank you Gergely.  That is interesting!

I don't mind at all making this Bayesian, as long as it works!

Something I'm not quite sure about: does the prior distribution HAVE to
be a gamma distribution? Not that that really narrows things down since
there are an infinite number of them, but is that really the "i have no
idea" prior? Or just a convenient closed-form choice? I've only just
recently heard of conjugate priors.

Much appreciate any thoughts you may have on this,

-James


On 10/16/2021 3:48 PM, Gergely Katona wrote:

Dear James,


If I understand correctly you are looking for a single rate parameter to
describe the pixels in a block. It would also be possible to estimate the
rates for individual pixels or estimate the thickness of the sample from
the counts if you have a good model, that is where Bayesian methods really
shine. I tested the simplest first Bayesian network with 10 and 100 zero
count pixels, respectively:


https://colab.research.google.com/drive/1TGJx2YT9I-qyOT1D9_HCC7G7as1KXg2e?usp=sharing



The two posterior distributions are markedly different even if they start
from the same prior distribution, which I find more intuitive than the
frequentist treatment of uncertainty. You can test different parameters for
the gamma prior or change to another prior distribution. It is possible to
reduce the posterior distributions to their mean or posterior maximum, if
needed. If you are looking for an alternative to the Bayesian perspective
then this will not help, unfortunately.


Best wishes,


Gergely


-Original Message-

From: CCP4 bulletin board  On Behalf Of James Holton

Sent: den 16 oktober 2021 21:01

To: CCP4BB@JISCMAIL.AC.UK

Subject: Re: [ccp4bb] am I doing this right?


Thank you everyone for your thoughtful and thought-provoking responses!


But, I am starting to think I was not as clear as I could have been about
my question.  I am actually concerning myself with background, not
necessarily Bragg peaks.  With Bragg photons you want the sum, but for
background you want the average.


What I'm getting at is: how does one properly weight a zero-photon
observation when it comes time to combine it with others?  Hopefully they
are not all zero.  If they are, check your shutter.


So, ignoring Bragg photons for the moment (let us suppose it is a
systematic absence) what I am asking is: what is the variance, or, better
yet,what is the WEIGHT one should assign to the observation of zero photons
in a patch of 10x10 pixels?


In the absence of any prior knowledge this is a difficult question, but a
question we kind of need to answer if we want to properly measure data from
weak images.  So, what do we do?


Well, with the "I have no idea" uniform prior, it would seem that
expectation (Epix) and variance (Vpix) would be k+1 = 1 for each pixel, and
therefore the sum of Epix and Vpix over the 100 independent pixels is:


Epatch=Vpatch=100 photons


I know that seems weird to assume 100 photons should have hit when we
actually saw none, but consider what that zero-photon count, all by itself,
is really telling you:

a) Epix > 20 ? No way. That is "right out". Given we know its Poisson
distributed, and that background is flat, it is VERY unlikely you have E
that big when you saw zero. Cross all those E values off your list.

b) Epix=0 ? Well, that CAN be true, but other things are possible and all
of them are E>0. So, most likely E is not 0, but at least a little bit
higher.

c) Epix=1e-6 ?  Yeah, sure, why not?

d) Epix= -1e-6 ?  No. Don't be silly.

e) If I had to guess? Meh. 1 photon per pixel?  That would be k+1


I suppose my objection to E=V=0 is because V=0 implies infinite confidence
in the value of E, and that we don't have. Yes, it is true that we are
quite confident in the fact that we did not see any photons this time, but
the remember that E and V are the mean and variance that you would see if
you did a million experiments under the same conditions. We are trying to
guess those from what we've got. Just because you've seen zero a hundred
times doesn't mean the 101st experiment won't give you a count.  If it
does, then maybe Epatch=0.01 and Epix=0.0001?  But what do you do before
you see your first photon?

All you can really do is bracket it.


But what if you come up with a better prior than "I have no idea" ?

Well, we do have other pixels on the detector, and presuming the background
is flat, or at least smooth, maybe the average counts/pixel is a 

Re: [ccp4bb] Analysis of NMR ensembles

[Jurgen Bosch]

I vaguely recall that using MUSTANG you will get the distance between residues 
reflected in the b-value column and then you can color by B-value.

https://lcb.infotech.monash.edu/mustang/mustang_psfb-final.pdf 
<https://lcb.infotech.monash.edu/mustang/mustang_psfb-final.pdf>

Jürgen 

> On May 26, 2021, at 11:28 AM, Harry Powell - CCP4BB 
>  wrote:
> 
> Hi Jurgen
> 
> NMR structures don’t appear to have B_factors, or at least not meaningful 
> ones (e.g. in 2kv5 they’re all 0.00…). 
> 
> thanks for the response, though
> 
> Harry
> 
>> On 26 May 2021, at 16:21, Jurgen Bosch  wrote:
>> 
>> How about color by B-factor and look for the cold areas and hot areas?
>> Jürgen 
>> 
>>> On May 26, 2021, at 11:04 AM, Harry Powell - CCP4BB 
>>> <193323b1e616-dmarc-requ...@jiscmail.ac.uk> wrote:
>>> 
>>> Hi
>>> 
>>> Given that there are plenty of people on this BB who are structural 
>>> biologists rather than “just” crystallographers, I thought someone here 
>>> might be able to help.
>>> 
>>> If I have a structure in the PDB (e.g. 2kv5) that is an ensemble of 
>>> structures that fit the NOEs, is there a tool available that will give me 
>>> some idea about the bits of the structure that do not vary much (“rigid”) 
>>> and the bits that are all over the place (“flexible”)?
>>> 
>>> Would superpose or gesamt be a good tool for this? Ideally I’d like 
>>> something that could add a figure to the B columns in a PDB file so I could 
>>> see something in QTMG (or PyMol if forced…) or do other useful things with 
>>> the information.
>>> 
>>> Harry
>>> 
>>> 
>>> To unsubscribe from the CCP4BB list, click the following link:
>>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>>> 
>>> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
>>> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
>>> https://www.jiscmail.ac.uk/policyandsecurity/
>> 
>> 
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>> 
>> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
>> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
>> https://www.jiscmail.ac.uk/policyandsecurity/
> 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Analysis of NMR ensembles

[Jurgen Bosch]

How about color by B-factor and look for the cold areas and hot areas?
Jürgen 

> On May 26, 2021, at 11:04 AM, Harry Powell - CCP4BB 
> <193323b1e616-dmarc-requ...@jiscmail.ac.uk> wrote:
> 
> Hi
> 
> Given that there are plenty of people on this BB who are structural 
> biologists rather than “just” crystallographers, I thought someone here might 
> be able to help.
> 
> If I have a structure in the PDB (e.g. 2kv5) that is an ensemble of 
> structures that fit the NOEs, is there a tool available that will give me 
> some idea about the bits of the structure that do not vary much (“rigid”) and 
> the bits that are all over the place (“flexible”)?
> 
> Would superpose or gesamt be a good tool for this? Ideally I’d like something 
> that could add a figure to the B columns in a PDB file so I could see 
> something in QTMG (or PyMol if forced…) or do other useful things with the 
> information.
> 
> Harry
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> 
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
> https://www.jiscmail.ac.uk/policyandsecurity/



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] 3D Printer Model of the Coronavirus

[Jurgen Bosch]

Very, it spreads virtually.

P.S. three printers are running soon

__
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd , BRB 835
Cleveland, OH 44106 
Phone: 216.368.7565
Fax: 216.368.4223

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

On Jan 29, 2021, at 12:07, Jacob Keller  wrote:


Is it infectious?

JPK

On Fri, Jan 29, 2021 at 2:14 AM Dale Tronrud  wrote:

>
> Sometimes when explaining something, or even in private
> contemplation, it is nice to have a physical object as a point of focus.
>   We, at the Corovavirus Structure Task Force, have created the design
> files that allow you to 3D print a model of the Coronavirus.  Our goal
> was to create a visual aid which accurately reflects the structure of
> the virus while still being easy to print and assemble.  I've attached
> photos of three models painted with differing color schemes.
>
> The model is comprised of two halves for the body (separated to
> allow printing w/o support) and 100 spikes which can be printed in
> batches of 25. The assembled model has a 15 cm diameter which results
> from a magnification of 1 million fold.  (1 mm:1 nm).
>
> You can read a description of the building process at
>
> https://insidecorona.net/3d-print-corona/
>
> and download the files at
>
> https://www.thingiverse.com/thing:4543692/files
>
> Give it a try.  We'd love to hear your stories of the build and how
> you've used the models!
>
> Dale Tronrud
> Coronavius Structure Task Force
> https://insidecorona.net
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a
> mailing list hosted by www.jiscmail.ac.uk, terms & conditions are
> available at https://www.jiscmail.ac.uk/policyandsecurity/
>


-- 

+

Jacob Pearson Keller

Assistant Professor

Department of Pharmacology and Molecular Therapeutics

Uniformed Services University

4301 Jones Bridge Road

Bethesda MD 20814

jacob.kel...@usuhs.edu; jacobpkel...@gmail.com

Cell: (301)592-7004

+

--

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Apple Mac M1 chip machines and compatibility with structural biology software?

[Jurgen Bosch]

Only issue is that the MacBook Air has a 13” display but I didn’t want to wait 
for a 16” MacBook Pro with Apple Silicon. I’m waiting for the adapter to hook 
up my Cinema Display from 2010 (?) and I hope that it will also work for the 
Zalman for 3D visualization.

Another issue is I run out of steam before the battery runs out of steam.

The M1 MacBook Air is impressive, it smokes my Late October 2019 MacBook Pro 15”

I have yet to discover a problem with what I use on a regular basis.

Jürgen 

> On Jan 23, 2021, at 7:41 PM, Amit Singh  wrote:
> 
> Dear Prof Jon,
> 
> I haven't faced any problems while installing and using a couple of them like 
> CCP4 (including coot), pymol and Xquartz. 
> 
> On Sat, 23 Jan, 2021, 4:27 pm Jon Sayers,  > wrote:
> Dear All,
> Slightly off-topic. The new Apple  M1 chip machines have been out for a 
> while. Is anyone using them for the typical range of software structural 
> biology/docking software? Any obvious issues or no-goes?
> 
> CCP4, Pymol, Autodoc, Xquartz, iBabel, etc
> 
> BW 
> Jon
> Prof. Jon R Sayers  FRSB
> Florey Institute,
> Dept. of Infection, Immunity and Cardiovascular Disease
> University of Sheffield Medical School
> Beech Hill Rd
> Sheffield S10 2RX
> United Kingdom, 
> 
> Tel +44 114 215 9552
> Email  j.r.say...@shef.ac.uk 
> http://www.sheffield.ac.uk/iicd/profiles/sayers 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

ov>>:
>> 
>> It looks to me that in this norovirus test the phone is acting as nothing 
>> more than a camara attached to a conventional microscope.  Light source is 
>> 3rd party, and the microscope body is 3D printed.  3D printing is cool and 
>> all, but it does not scale well.  Antibodies are also expensive to make.  
>> You will go through a lot of rabbits to make the 1 kg needed for a billion 
>> tests.  This isn't quite the price point I had in mind.
>> 
>> I agree that agglomeration of fluorescent beads is very sensitive.  However, 
>> my experience with beads and other small objects is that they love to stick 
>> together for all kinds of reasons. And once they do it is hard to get them 
>> to separate.  Assaying for virus particles in otherwise pure water is one 
>> thing, it is quite another when there is other stuff around. 
>> 
>> Personally, I've tried several different phone-based microscopes and the 
>> hardest thing about them is aligning the camera.  I'm a beamline scientist, 
>> so aligning things is second nature, but your average person might have a 
>> hard time. The most annoying part is if you bump it you have to start over.  
>> Image quality is also never all that great, I expect because the optics of a 
>> smartphone camera are wide-angle, and you are fighting against that.  
>> Eventually I bought a self-contained wifi microscope for $50, and that works 
>> MUCH better.  In fact, I'd say its competitive with the $5k microscope we 
>> use to look at crystals. However, $50 is a lot in the third world. I've 
>> heard that drugs that cost more than $1/pill are essentially unobtainable in 
>> many countries.
>> 
>> I'm still thinking that using the camera as nothing more than a big 
>> photodiode is the right way to go. By positioning the sample right in front 
>> of the camera lens you will get maximum light-collection efficiency. In 
>> fact, one might be able to get excellent time resolution out of the 
>> rolling-shutter mode.  That is, unlike the CCD or PAD detectors we are used 
>> to these CMOS sensors read out one row of pixels while the others are still 
>> exposing.  This means that the whole image is acutally one big time series 
>> with individual pixels only a few nanoseconds apart.  It should be possible 
>> to differentiate the light from a long-lived fluorophore from background. 
>> However, I don't think anyone has tried that yet.
>> 
>> -James Holton
>> MAD Scientist
>> 
>> 
>> On 4/4/2020 5:48 PM, Jurgen Bosch wrote:
>>> Here’s another link I found that should make this project feasible:
>>> 
>>> https://physicsworld.com/a/smartphone-based-device-detects-norovirus/ 
>>> <https://physicsworld.com/a/smartphone-based-device-detects-norovirus/>
>>> 
>>> Jürgen 
>>> 
>>>> On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart >>> <mailto:patr...@douglas.co.uk>> wrote:
>>>> 
>>>> Jurgen, that was interesting.  (Strange how your hair came and went during 
>>>> the talk, leaving you bald sometimes - but of course that didn't matter !  
>>>> ;)
>>>> 
>>>> Did you know that coronavirus was first isolated at 33C and that this 
>>>> temperature may be required for isolation?  
>>>> https://www.bmj.com/content/3/5568/767 
>>>> <https://www.bmj.com/content/3/5568/767>  
>>>> https://www.sciencedirect.com/science/article/pii/S019665531730901X 
>>>> <https://www.sciencedirect.com/science/article/pii/S019665531730901X>
>>>> 
>>>> We don't know why the virus stays in the throat in many people, but at 
>>>> other times it goes to the lungs.  ACE2 is predicted to be highly 
>>>> expressed in the mouth and nose as well as the lungs. 
>>>> https://www.researchsquare.com/article/rs-16992/v1 
>>>> <https://www.researchsquare.com/article/rs-16992/v1>
>>>> 
>>>> A recent Nature paper noted that "sequence-distinct virus populations were 
>>>> consistently detected in throat and lung samples from the same patient, 
>>>> proving independent replication" 
>>>> https://www.nature.com/articles/s41586-020-2196-x 
>>>> <https://www.nature.com/articles/s41586-020-2196-x> 
>>>> 
>>>> It would be very interesting to know whether the lung samples were less 
>>>> temperature-sensitive than the throat 
>>>> ones, and whether this could explain the observed divergent tropism -

Re: [ccp4bb] Tiny rocks on my CX100 shipping dewar

[Jurgen Bosch]

That looks like gravel from the driveway where the dewar was tossed around
Jürgen 

> On Dec 4, 2020, at 11:04 AM, Tanner, John J.  wrote:
> 
> When we opened our CX100 shipping dewar returned from APS via FedEx this 
> week, we observed what appears to be tiny rocks on the rim below the foam 
> neck core:
> 
> https://www.dropbox.com/s/ky09a1vbm9t0mrl/CX100withrocks.png?dl=0 
> 
> 
> Has anyone seen this before? Is this perhaps the absorbent material from the 
> inside of the dewar? 
> 
> Thanks,
> 
> Jack
> 
> John J. Tanner
> Professor of Biochemistry and Chemistry
> Associate Chair of Biochemistry
> Department of Biochemistry
> University of Missouri
> 117 Schweitzer Hall
> 503 S College Avenue
> Columbia, MO 65211
> Phone: 573-884-1280
> Email: tanne...@missouri.edu 
> https://cafnrfaculty.missouri.edu/tannerlab/
> Lab: Schlundt Annex rooms 3,6,9, 203B, 203C
> Office: Schlundt Annex 203A
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

[ccp4bb] Announcing our COVID19 Dashboard

[Jurgen Bosch]

Hi all,

We developed a different type of dashboard to make complex data more easily 
available also for non-researchers. We have launched the website currently 
focusing on the United States only, but plan on expanding our visualization and 
predictions worldwide in a future update to the site.

Here’s the link to the website: https://covid19predict.com 


and here’s a link to our MedRxiv pre-print: 
https://www.medrxiv.org/content/10.1101/2020.09.09.20191593v1 


Everything on the site is clickable and interactive. We would love to hear your 
feedback on the form linked on our site.

Feel free to share,

Jürgen 

___
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd, BRB 835
Cleveland, OH 44106
Phone: 216.368.7565
Fax: 216.368.4223
https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] COOT download site

[Jurgen Bosch]

Looks as if Clemens will be jumping straight into the future now with the new 
link. Were you on Coot 0.069?

Jürgen 

> On Jun 4, 2020, at 10:54 AM, Paul Emsley  wrote:
> 
> On 04/06/2020 15:41, Clemens Grimm wrote:
>> Dear All,
>> 
>> accessing the COOT download pages at
>> 
>> http://www.ysbl.york.ac.uk/~emsley/software/binaries/nightlies/pre-release/ 
>> 
>> gives me an
>> 
>> "The requested URL /~emsley/software/binaries/nightlies/pre-release/ was not 
>> found on this server."
>> 
>> error since a few days.
>> 
>> Is the site down or has it moved?
>> 
> 
> Good grief! I haven't thought about that web site for 10 years. I had no idea 
> that it was alive (not that I could do anything about it if it was).
> 
> Google finds my Coot pages using "Emsley Coot" - well, it does for me :-)
> 
> 
> https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ 
> 
> 
> 
> Paul.
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> 
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing 
> list hosted by www.jiscmail.ac.uk, terms & conditions are available at 
> https://www.jiscmail.ac.uk/policyandsecurity/




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] visual mask editor - why

[Jurgen Bosch]

Give this a shot: https://www.eyesopen.com/afitt 


At least in Vida from the same suite of programs, you can select such a blob as 
you describe and export it in a useful way.
Jürgen 
___
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd, BRB 835
Cleveland, OH 44106
Phone: 216.368.7565
Fax: 216.368.4223
https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

> On May 28, 2020, at 2:17 PM, Bernhard Rupp  wrote:
> 
> Maybe I should explain an example: Say coot detects an unmodelled blob (maybe 
> a ligand). Now, I would like to do
> a number of things without biasing towards a model. Like comparing these map 
> regions, excluding
> intrusion of a solvent mask, etc.
>  
> Now could coot for example just generate a mask around what it already knows 
> are blobs?  
> Possible useful items could be a solvent mask not including that regions, or 
> a density map
> that includes only features with a certain boundary around that blob.
>  
> I pilfered some kludges together from different sources, but let’s just say 
> inelegant would be a compliment.
>  
> Best, BR
> 
> Brief question: Does something like a visual density mask editor exist?
> Thx, BR
> --
> Bernhard Rupp
> http://www.hofkristallamt.org/ 
> b...@hofkristallamt.org 
> +1 925 209 7429
> +43 676 571 0536
> --
> Many plausible ideas vanish 
> at the presence of thought
> --
>  
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] visual mask editor?

[Jurgen Bosch]

Sehr geehrter Herr Hofkristallamt,

Depending on your learning style, you might want to look into blender.
https://www.blender.org/download/ 
Together with eMPV you can do some magic from scratch. 

You could also use any other CAD program end export the file one of the Uppsala 
Software Suite programs can read and convert them into masks.

Jürgen 


___
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd, BRB 835
Cleveland, OH 44106
Phone: 216.368.7565
Fax: 216.368.4223
https://www.linkedin.com/in/jubosch/

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

> On May 28, 2020, at 1:57 PM, Bernhard Rupp  wrote:
> 
> Yes, there are some ways to do it, more or less cumbersome.
> But after being already reprimanded for using old ccp4 stuff I was looking 
> for a 21st century solution…sort of matrix-style…put you shades on, wave your 
> hands, and done.
>  
> Cheers, BR
> From: CCP4 bulletin board  On Behalf Of Soisson, 
> Stephen M
> Sent: Thursday, May 28, 2020 09:57
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] visual mask editor?
>  
> You used to be able to do this in O (dating myself)
>  
> From: CCP4 bulletin board  > On Behalf Of Bernhard Rupp
> Sent: Thursday, May 28, 2020 12:39 PM
> To: CCP4BB@JISCMAIL.AC.UK 
> Subject: [ccp4bb] visual mask editor?
>  
> EXTERNAL EMAIL – Use caution with any links or file attachments.
> Brief question: Does something like a visual density mask editor exist?
> Thx, BR
> --
> Bernhard Rupp
> http://www.hofkristallamt.org/ 
> b...@hofkristallamt.org 
> +1 925 209 7429
> +43 676 571 0536
> --
> Many plausible ideas vanish 
> at the presence of thought
> --
>  
>  
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
> Notice:  This e-mail message, together with any attachments, contains
> information of Merck & Co., Inc. (2000 Galloping Hill Road, Kenilworth, 
> New Jersey, USA 07033), and/or its affiliates Direct contact information
> for affiliates is available at 
> http://www.merck.com/contact/contacts.html 
> ) that may be confidential,
> proprietary copyrighted and/or legally privileged. It is intended solely
> for the use of the individual or entity named on this message. If you are
> not the intended recipient, and have received this message in error,
> please notify us immediately by reply e-mail and then delete it from 
> your system.
>  
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] disinfecting keyboards

[Jurgen Bosch]

Must have been wearing a traditional Scottish outfit :-)

Jürgen 

> On May 6, 2020, at 11:19 AM, Tristan Croll  wrote:
> 
> You got off lucky. An old friend of mine learned this lesson when on a 
> particularly sunny day he spent an hour out on a New Zealand glacier in 
> shorts with no underwear...
> 
> On 2020-05-06 16:17, James Holton wrote:
>> I feel I should correct you on one thing Tim: UV _can_ go around
>> corners because it scatters.  I learned this the hard way as a younger
>> man after a fine day of skiing.  I had put sunscreen everywhere except
>> the bottom of my nose.
>> You are right, however, that the intensity after scattering is quite a
>> bit less than tha main illumination.  This is true for all kinds of
>> light.
>> -James Holton
>> MAD Scientist
>> On 5/5/2020 11:59 PM, Tim Gruene wrote:
>>> Hi James,
>>> for us, the suggestions of cling film / plastic wrap or just swapping
>>> keyboards and mice per person is the simplest - thanks to everyone for
>>> the many suggestions. Especially the latter, since only two people will
>>> operate the instruments.
>>> UV light does not go around corners. It might be useful for fume hoods,
>>> but for most places, door handles and other curved surfaces are
>>> probably much more the infecting parts, while they escape the UV light.
>>> And vira are transported in water droplets, which are larger than 1um.
>>> Best,
>>> Tim
>>>  On Tue, 5 May 2020 17:19:56 -0700
>>> James Holton  wrote:
 All joking aside, there has been a furor of attention on UV-based
 disinfection of late.  Some of it is not entirely crazy.  I.E.
 Columbia University’s Center for Radiological Research has put
 forward the idea of illuminating occupied public areas with
 ultra-narrow-band UV-C (222 nm).
 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5552051/
 Mind you, UV-C normally covers 100 - 280 nm, and the PPE requirements
 for that (at LBNL at least) are extensive: polycarbonate safety
 glasses and face shield with a mark U6 (UV protection), long-sleeved
 clothing, and gloves.  Basically: do not expose skin!
 The idea behind using monochromatic 222 nm radiation is that it is at
 the edge of a very steep increase in the absorption of water,
 protein, and other biologicals.  Penetration depths are hard to
 estimate because of the steep slope, but they are on the order of 1
 micron.  So, smaller than a typical mamalian cell, but bigger than a
 bacterium or virus.  The paper above did not have any human subjects,
 nor did it discuss how to deal with all the ozone, but the results
 are intruiging. Needs further study.
 Personally, I think this would probably fog your corneas and perhaps
 burn the thin skin on lips and other exposed mucosa. Hair I'd expect
 to embrittle and fall apart eventually. Yes, hair is 40 microns thick
 and the penetration depth is 1 micron, but photon's don't "stop" at
 the penetration depth.  36% of them go deeper. Plastic in keyboards
 too would probably bleach and flake with prolonged exposure.  Ever
 seen a keyboard left out in the sun for a few weeks?  I'd worry a bit
 about this micro-damage creating crevices where bugs could hide.
 I encourage you to bring this up with your Health and Safety people,
 but make sure they are sitting down first.
 -James Holton
 MAD Scientist
 On 4/29/2020 12:41 PM, Andrea Thorn wrote:
> Hi Tim!
> 100% alcohol is less effective than 80%, and in order to completely
> be sure, the keyboard needs not only to be wiped. One can buy
> keyboards that can be disinfected because they are waterproof, such
> as the Cherry JK-1068DE-2 for about 50 €.
> We clean the keyboards in our lab occasionally anyway, and have
> used 70% alcohol on them without problem. Disinfectant wipes, a
> detergent cleaner (such as Viss Glass & Flächen) and cotton swabs
> also offer some help. We wipe our mobile phones with a disinfectant
> wipe after washing our hands when arriving home/at work.
> I would also be really interested in what could be done with a UV
> light, if someone knows?
> If the computer is used by one person during the shift, individual
> keyboards for each person could be a solution. If people sit down,
> the desk surface, which may be touched, should likely also be wiped
> at the beginning and end of the shift I would say.
> Stay save and best wishes,
> Andrea.
> Am 29/04/2020 um 21:04 schrieb Diana Tomchick:
>> ​100% ethanol or isopropanol work really well on the microscopes,
>> I soak a Kimwipe and then clean the eyepieces and the knobs for
>> changing magnification and focus, as well as the door handles,
>> bench tops, etc.
>> Diana
>> **
>> Diana R. Tomchick
>> Professor
>> Departments of Biophysics and Biochemistry
>> UT Southwestern Medical 

Re: [ccp4bb] disinfecting keyboards

[Jurgen Bosch]

You really just need two keyboards per computer, every user change, just add 
the used keyboards into the hutch, the rest should take care of itself then.

You are at the source to successfully blast these little viruses

Jürgen 
> On Apr 29, 2020, at 3:30 PM, James Holton  wrote:
> 
> Keyboards are cheap.  Why not everyone get their own?
> 
> Then we can all stop fighting about whether the  key should be shaped 
> like an "L" or not.
> 
> -James Holton
> MAD Scientist
> 
> On 4/29/2020 11:53 AM, Tim Gruene wrote:
>> Dear all,
>> 
>> can you make suggestions for how to disinfect computer keyboards, and
>> instrument panels?
>> 
>> Our facility is going to reboot next week, with shifts so that people
>> don't meet. The main interface will be the computer keyboards, as well
>> as the door of our X-ray diffractometer and the mounting of the
>> crystals.
>> 
>> The keyboard labels may not like alcohols (and the efficiency of
>> injecting disinfecting through the USB cable is also under discussion,
>> so I heard).
>> 
>> One way would be to use individual keyboards, and wearing gloves for
>> replugging, and to use gloves for mounting crystals.
>> 
>> But maybe there are other ways that won't require gloves?
>> 
>> Best regards,
>> Tim
>> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] disinfecting keyboards

[Jurgen Bosch]

Somehow this reminds me of the scene of Scotty talking into the mouse when he 
is instructed to use the keyboard to interact with the computer.

How is voice recognition these days on Linux?

This email was not typed but spoken by Siri on my laptop.

Jürgen 


> On Apr 29, 2020, at 2:59 PM, Sravya Mounika Kantamneni 
>  wrote:
> 
> How about using keyboard guards and dissecting them as usual?
> 
> Regards,
> Sravya
> 
>> On Apr 29, 2020, at 8:53 PM, Tim Gruene  wrote:
>> 
>> Dear all,
>> 
>> can you make suggestions for how to disinfect computer keyboards, and
>> instrument panels?
>> 
>> Our facility is going to reboot next week, with shifts so that people
>> don't meet. The main interface will be the computer keyboards, as well
>> as the door of our X-ray diffractometer and the mounting of the
>> crystals.
>> 
>> The keyboard labels may not like alcohols (and the efficiency of
>> injecting disinfecting through the USB cable is also under discussion,
>> so I heard).
>> 
>> One way would be to use individual keyboards, and wearing gloves for
>> replugging, and to use gloves for mounting crystals.
>> 
>> But maybe there are other ways that won't require gloves?
>> 
>> Best regards,
>> Tim
>> 
>> -- 
>> --
>> Tim Gruene
>> Head of the Centre for X-ray Structure Analysis
>> Faculty of Chemistry
>> University of Vienna
>> 
>> Phone: +43-1-4277-70202
>> 
>> GPG Key ID = A46BEE1A
>> 
>> 
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] [EXTERNAL] Re: [ccp4bb] on-topic: your opinions requested!

[Jurgen Bosch]

You could also crawl through patents of sausage making. If they published now 
it is likely they have patented it since it sounds as if it an incredible 
important method for adding flavors to sausages.

Jürgen 

> On Apr 7, 2020, at 12:23 PM, Artem Evdokimov  
> wrote:
> 
> Sadly, I agree: it is pretty clear that the authors did not want coordinates 
> revealed. Therefore asking them for information is not likely to lead to 
> getting anything. To be completely fair, it's likely not even the authors 
> themselves, but their corporate policy that's responsible.
> 
> In cases like this, I normally choose not to publish, but maybe their bosses 
> insisted. Anyway, many options to find excuses, but it looks like Artem has 
> to go solve this structure himself.
> 
> Thank you all very much, many good responses :)
> 
> Arte,
> 
> - Cosmic Cats approve of this message
> 
> 
> On Tue, Apr 7, 2020 at 12:06 PM Schreuder, Herman /DE 
> mailto:herman.schreu...@sanofi.com>> wrote:
> Dear Frank,
> 
>  
> 
> here I disagree. I think it is bad practice to complain to the editors or 
> start naming and shaming before asking the authors first. Only if they do not 
> want to cooperate, it would be time to bring the flame-throwers in position.
> 
>  
> 
> However, I think the situation is more subtle and that that is the reason 
> Artem wrote his email: He wants the data, but does not want to reveal his 
> identity to his competitors, who apparently made a significant effort not to 
> reveal any useful details.
> 
>  
> 
> Here I would let me guide by the (perceived) commercial interest: if it is 
> not gigantic, then I would contact the authors to prevent a wasteful 
> duplication of research efforts.
> 
> If there is a significant commercial interest, it would probably be better 
> not to contact them and go the hard way of solving the structure yourself. A 
> thing to consider is also what would happen if the authors still would 
> refuse: they know the identity of the competitor and you still do not have 
> the data.
> 
>  
> 
> An alternative may be to ask an academic friend who also works on sausage 
> esterases to inquire with the authors…
> 
>  
> 
> Good luck with your decision!
> 
> Herman
> 
>  
> 
> Von: CCP4 bulletin board  > Im Auftrag von Frank von Delft
> Gesendet: Dienstag, 7. April 2020 17:19
> An: CCP4BB@JISCMAIL.AC.UK 
> Betreff: [EXTERNAL] Re: [ccp4bb] on-topic: your opinions requested!
> 
>  
> 
> EXTERNAL : Real sender is owner-ccp...@jiscmail.ac.uk 
> 
>  
> 
> Write to the editor - that's their job.  
> 
> Though they may also see it as their job to ignore emails like yours because 
> that's far easier than dealing with them.
> 
> Alternatively, go the Rupp Route:  Name and Shame! ;)
> 
> 
> On 07/04/2020 16:08, Artem Evdokimov wrote:
> 
> Dear CCP4ers,
> 
>  
> 
> I would like to solicit your thoughts on the following (this is a real 
> situation, but salient details are changed):
> 
>  
> 
> Imagine that you're an industrial scientist in a small company, working on 
> the Bavarian Sausage (Weisswurst) Esterase project. The overall structure is 
> previously unknown, with no good homologs in the PDB, trying to model is "OK 
> not great" so the structure is really needed...
> 
>  
> 
> Then, you find an article from a large commercial competitor, that somehow 
> managed to solve the Stadtwurst (Saxony Sausage) Esterase structure (which is 
> a very close homolog to the one you need!).
> 
>  
> 
> Sounds good - but as you read the paper you realize that the authors managed 
> to find a journal that allowed them to publish their work without disclosing 
> neither the coordinates of the model, nor even the crystallization conditions 
> of the protein - all that's available is a tantalizing still picture of the 
> active site in surface mode, with a ball-and-stick ligand positioned such 
> that it is impossible to say what it interacts with. 
> 
>  
> 
> So you sit and ponder - whether to write to the Editor, or maybe to contact 
> the authors directly (but then they would know that you're working on this, 
> which is not necessarily great since you're competing), or to just buck up 
> and do the structure on your own (which feels a bit wasteful). Then, you 
> realize that your friends at CCP4 have a lot of wisdom to offer, so you sit 
> down and pen an email...
> 
>  
> 
> Any thoughts?
> 
>  
> 
> Artem
> 
>  
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
>  
> 
>  
> 
> To unsubscribe from the CCP4BB list, click the 

Re: [ccp4bb] [EXTERNAL] Re: [ccp4bb] on-topic: your opinions requested!

[Jurgen Bosch]

Honestly, as a Zugreister to Bavaria and now living in a Sausage Diaspora (by 
Bavarian standards), I would take any sausage available.

Educational Sausages might be the way to go. You could ask a Sausage Modeler 
who previously participated in a Sausage-CASP competition to reach out to the 
authors so he/she can compare his Sausage model with the true and only Sausage.

May the Sausage be with you V <- Spock greeting

Jürgen 

> On Apr 7, 2020, at 12:05 PM, Schreuder, Herman /DE 
>  wrote:
> 
> Dear Frank,
>  
> here I disagree. I think it is bad practice to complain to the editors or 
> start naming and shaming before asking the authors first. Only if they do not 
> want to cooperate, it would be time to bring the flame-throwers in position.
>  
> However, I think the situation is more subtle and that that is the reason 
> Artem wrote his email: He wants the data, but does not want to reveal his 
> identity to his competitors, who apparently made a significant effort not to 
> reveal any useful details. 
>  
> Here I would let me guide by the (perceived) commercial interest: if it is 
> not gigantic, then I would contact the authors to prevent a wasteful 
> duplication of research efforts.
> If there is a significant commercial interest, it would probably be better 
> not to contact them and go the hard way of solving the structure yourself. A 
> thing to consider is also what would happen if the authors still would 
> refuse: they know the identity of the competitor and you still do not have 
> the data.
>  
> An alternative may be to ask an academic friend who also works on sausage 
> esterases to inquire with the authors…
>  
> Good luck with your decision!
> Herman
>  
> Von: CCP4 bulletin board  > Im Auftrag vonFrank von Delft
> Gesendet: Dienstag, 7. April 2020 17:19
> An: CCP4BB@JISCMAIL.AC.UK 
> Betreff: [EXTERNAL] Re: [ccp4bb] on-topic: your opinions requested!
>  
> EXTERNAL : Real sender is owner-ccp...@jiscmail.ac.uk 
> 
>  
> 
> Write to the editor - that's their job.  
> 
> Though they may also see it as their job to ignore emails like yours because 
> that's far easier than dealing with them.
> 
> Alternatively, go the Rupp Route:  Name and Shame! ;)
> 
> 
> On 07/04/2020 16:08, Artem Evdokimov wrote:
> Dear CCP4ers, 
>  
> I would like to solicit your thoughts on the following (this is a real 
> situation, but salient details are changed):
>  
> Imagine that you're an industrial scientist in a small company, working on 
> the Bavarian Sausage (Weisswurst) Esterase project. The overall structure is 
> previously unknown, with no good homologs in the PDB, trying to model is "OK 
> not great" so the structure is really needed...
>  
> Then, you find an article from a large commercial competitor, that somehow 
> managed to solve the Stadtwurst (Saxony Sausage) Esterase structure (which is 
> a very close homolog to the one you need!).
>  
> Sounds good - but as you read the paper you realize that the authors managed 
> to find a journal that allowed them to publish their work without disclosing 
> neither the coordinates of the model, nor even the crystallization conditions 
> of the protein - all that's available is a tantalizing still picture of the 
> active site in surface mode, with a ball-and-stick ligand positioned such 
> that it is impossible to say what it interacts with. 
>  
> So you sit and ponder - whether to write to the Editor, or maybe to contact 
> the authors directly (but then they would know that you're working on this, 
> which is not necessarily great since you're competing), or to just buck up 
> and do the structure on your own (which feels a bit wasteful). Then, you 
> realize that your friends at CCP4 have a lot of wisdom to offer, so you sit 
> down and pen an email...
>  
> Any thoughts?
>  
> Artem
>  
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
>  
>  
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

Here’s another link I found that should make this project feasible:

https://physicsworld.com/a/smartphone-based-device-detects-norovirus/ 
<https://physicsworld.com/a/smartphone-based-device-detects-norovirus/>

Jürgen 

> On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart  
> wrote:
> 
> Jurgen, that was interesting.  (Strange how your hair came and went during 
> the talk, leaving you bald sometimes - but of course that didn't matter !  ;)
> 
> Did you know that coronavirus was first isolated at 33C and that this 
> temperature may be required for isolation?  
> https://www.bmj.com/content/3/5568/767 
> <https://www.bmj.com/content/3/5568/767>  
> https://www.sciencedirect.com/science/article/pii/S019665531730901X 
> <https://www.sciencedirect.com/science/article/pii/S019665531730901X>
> 
> We don't know why the virus stays in the throat in many people, but at other 
> times it goes to the lungs.  ACE2 is predicted to be highly expressed in the 
> mouth and nose as well as the lungs. 
> https://www.researchsquare.com/article/rs-16992/v1 
> <https://www.researchsquare.com/article/rs-16992/v1>
> 
> A recent Nature paper noted that "sequence-distinct virus populations were 
> consistently detected in throat and lung samples from the same patient, 
> proving independent replication" 
> https://www.nature.com/articles/s41586-020-2196-x 
> <https://www.nature.com/articles/s41586-020-2196-x> 
> 
> It would be very interesting to know whether the lung samples were less 
> temperature-sensitive than the throat ones, and whether this could explain 
> the observed divergent tropism - (which you also noted). 
> https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/ 
> <https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/>
> 
> Thx and stay warm (see my blog)
> 
> Patrick
> 
> 
> 
> On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch  <mailto:jxb...@case.edu>> wrote:
> I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m 
> not claiming to be an expert, but there is useful information in the 
> presentation. I skipped the intro and zoomed directly to the start of my 
> presentation.
> 
> https://www.youtube.com/watch?v=B00tJnbktVo=youtu.be=204 
> <https://www.youtube.com/watch?v=B00tJnbktVo=youtu.be=204>
> 
> I can make the slides available if anybody wants them.
> 
> Jürgen 
> 
>> On Apr 2, 2020, at 11:27 AM, James Holton > <mailto:jmhol...@lbl.gov>> wrote:
>> 
>> Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd 
>> still like to know that. 
>> 
>> It is most certainly true that the primer design must be done right: 
>> checking for self-annealing, low genomic variability, cross-reactivity to 
>> potential contaminants etc.  Fortunately, we have tools for this that can be 
>> used at home.
>> 
>> I agree the CRISPR-based tests are very exciting, as are many of the other 
>> new tests being rolled out.  Assay times of 15 minutes, 5 minutes, and now 2 
>> minutes have been claimed.  The problem I see is they all rely on 
>> specialized equipment, skilled technicians and expensive reagents.  Ramping 
>> up production to the billion-test scale may not be feasible.  Even if it 
>> were, all the PPE needed to extract those samples safely would be 
>> prohibitive, as would be the sample-tracking logistics.  
>> 
>> For reasons such as this, I am curious to see if an at-home do-it-yourself 
>> test is possible.  It may serve no purpose other than to satisfy indiviual 
>> curiosity, but I think it would go a long way to defusing the fear that 
>> comes from not knowing.  This would not just be for sputum, but possibly 
>> doorknobs, packages, and, yes, mobile phones.
>> 
>> And for those wondering about those nasal swabs:  I've done a little 
>> research on them and I think the reason for going full "Total Recall" and 
>> sticking it way up inside your head is not because the virus is more 
>> concentrated there (we don't even know what the concentration is), but 
>> rather because potential contaminants are minimized.  Think about it: PCR is 
>> a very sensitive technique, and you want to make sure the sample came from 
>> the intended patient, not the other patient who walked through the door just 
>> before you did after sneezing in their hand and touching the doorknob.  If 
>> you touched that same doorknob and then  "scratched" your nose, then a 
>> swab of your nostrils might pick up a virus or two.  That would be a false 
>> positive.  
>> 
>> I expect there are many aspects of current t

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

 you for the suggestions so far!  Very interesting and helpful!
> 
> -James Holton
> MAD Scientist
> 
> 
> On 3/31/2020 11:46 PM, Sahil Batra wrote:
>> Dear Prof. Holton,
>> 
>> An innovative idea; however all of the 30 kb genome may not be useful for 
>> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
>> 
>> A similar fluorescent detection approach for SARS Cov2 -- using the 
>> indiscriminate collateral activity of Cas12 nuclease -- has been reported 
>> here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf 
>> <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf>
>> Although not tested on samples from patients.
>> 
>> Regards,
>> Sahil Batra
>> PhD candidate, IIT Kanpur
>> 
>> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch > <mailto:jxb...@case.edu>> wrote:
>> One problem I see is the sputum, there’s a reason why swabs are made to get 
>> sufficient viral material. 
>> 
>> Since stool samples test PCR positive that might be an easier approach to 
>> get sufficient viral material. As a side note, these are not infectious 
>> anymore, or at least one has not been able to infect tissue cultures from 
>> stool samples.
>> 
>> It’s worth a thought, I’ll need to read those papers you referenced. 
>> 
>> I believe I read a suitable preprint for viral load, will search for it 
>> tomorrow.
>> 
>> Jürgen 
>> 
>> 
>> 
>> 
>> __
>> Jürgen Bosch, Ph.D.
>> Division of Pediatric Pulmonology and Allergy/Immunology
>> Case Western Reserve University
>> 2109 Adelbert Rd <>, BRB 835
>> Cleveland, OH 44106 <>
>> Phone: 216.368.7565 
>> Fax: 216.368.4223 
>> CEO & Co-Founder at InterRayBio, LLC
>> 
>> Johns Hopkins University
>> Bloomberg School of Public Health
>> Department of Biochemistry & Molecular Biology
>> 
>>> On Apr 1, 2020, at 00:50, James Holton >> <mailto:jmhol...@lbl.gov>> wrote:
>>> 
>>> In order to do global survelinace of this new virus I figure we're going 
>>> to need billions of tests.  The biggest barriers I believe are 
>>> logistical.  Shipping back and forth to a central labs isn't going to 
>>> cut it, and neither are test kits that cost $800 each.
>>> 
>>> I think I may have a plausible way forward to a low-cost and easily 
>>> mass-produced test for the SARS-CoV-2 virus using mostly items people 
>>> already have, such as smartphones. The most expensive reagent required 
>>> will be labeled oligos, but those scale very well.
>>> 
>>> The key observation is that smartphones can detect as few as 1e6 
>>> particles/mL if they do long exposures (180s).  This was using 
>>> bioluminescence. Reported here:
>>> https://www.nature.com/articles/srep40203.pdf 
>>> <https://www.nature.com/articles/srep40203.pdf>
>>> 
>>> The other side of that coin is the expected titer of the virus in 
>>> sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four 
>>> other respiratory viruses, including one coronavirus, it ranges from 1e6 
>>> to 1e8 particles/mL :
>>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ 
>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/>
>>> 
>>> This is encouraging!  The challenge will be to detect viral genomes in 
>>> "the field" without sophisticated lab equipment like a PCR machine, 
>>> lasers, 3D printers, etc.  The concentration will be 1e-15 M, a 
>>> challenge, but then again we can detect single molecules using 
>>> fluorescence. The questions are:
>>> 1) can we get the background low enough so that the dark current of the 
>>> camera dominates
>>> 2) can we make the signal high enough to overcome the dark current.
>>> 
>>> 1) will depend on the availability of mass-produced filter technology.  
>>> However, the best filter may simply be time.  Provided the fluorophore 
>>> lifetime is long enough and the camera synchronization tight enough one 
>>> could simply measure the "afterglow" after the camera flash has turned 
>>> off.  An interesting candidate is europium. Most fluorophores decay in 
>>> nanoseconds, but lanthanides can be microseconds to milliseconds.  In 
>>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. 
>>> Those decay over minutes to hours.  What I'm not sur

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m not 
claiming to be an expert, but there is useful information in the presentation. 
I skipped the intro and zoomed directly to the start of my presentation.

https://www.youtube.com/watch?v=B00tJnbktVo=youtu.be=204 
<https://www.youtube.com/watch?v=B00tJnbktVo=youtu.be=204>

I can make the slides available if anybody wants them.

Jürgen 

> On Apr 2, 2020, at 11:27 AM, James Holton  wrote:
> 
> Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd 
> still like to know that. 
> 
> It is most certainly true that the primer design must be done right: checking 
> for self-annealing, low genomic variability, cross-reactivity to potential 
> contaminants etc.  Fortunately, we have tools for this that can be used at 
> home.
> 
> I agree the CRISPR-based tests are very exciting, as are many of the other 
> new tests being rolled out.  Assay times of 15 minutes, 5 minutes, and 
> now 2 minutes have been claimed.  The problem I see is they all rely on 
> specialized equipment, skilled technicians and expensive reagents.  Ramping 
> up production to the billion-test scale may not be feasible.  Even if it 
> were, all the PPE needed to extract those samples safely would be 
> prohibitive, as would be the sample-tracking logistics.  
> 
> For reasons such as this, I am curious to see if an at-home do-it-yourself 
> test is possible.  It may serve no purpose other than to satisfy indiviual 
> curiosity, but I think it would go a long way to defusing the fear that comes 
> from not knowing.  This would not just be for sputum, but possibly doorknobs, 
> packages, and, yes, mobile phones.
> 
> And for those wondering about those nasal swabs:  I've done a little research 
> on them and I think the reason for going full "Total Recall" and sticking it 
> way up inside your head is not because the virus is more concentrated 
> there (we don't even know what the concentration is), but rather because 
> potential contaminants are minimized.  Think about it: PCR is a very 
> sensitive technique, and you want to make sure the sample came from the 
> intended patient, not the other patient who walked through the door just 
> before you did after sneezing in their hand and touching the doorknob.  If 
> you touched that same doorknob and then  "scratched" your nose, then a 
> swab of your nostrils might pick up a virus or two.  That would be a false 
> positive.  
> 
> I expect there are many aspects of current test that don't have to be the way 
> they are, but nonetheless are "required" because they were inherited from 
> previous tests.  I expect we all have learned the hard way that in biological 
> science when you are handed a protocol you follow that protocol to the 
> letter.  How many times have you had to teach a student that?  It is not a 
> bad policy, but eventually there comes a time for "assay development".  This 
> is when you start asking "why do we do it that way, again?" 
> 
>  For example, swabs with calcium alginate are not allowed becuase they can 
> "kill the virus".  If all we want is genomic RNA, then why do we care?  
> Possibly because the traditional method of identifying most pathogens is to 
> culture them.  The CDC protocol also recommends against cotton swabs with 
> wood handles.  Why?  Perhaps because they contain DNA, and for PCR you always 
> worry about contamination.  Is there any chance the probes will anneal to 
> something in the cotton or pine genomes?  I doubt it, but I also doubt that 
> anyone has checked.
> 
> Thank you for the suggestions so far!  Very interesting and helpful!
> 
> -James Holton
> MAD Scientist
> 
> 
> On 3/31/2020 11:46 PM, Sahil Batra wrote:
>> Dear Prof. Holton,
>> 
>> An innovative idea; however all of the 30 kb genome may not be useful for 
>> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
>> 
>> A similar fluorescent detection approach for SARS Cov2 -- using the 
>> indiscriminate collateral activity of Cas12 nuclease -- has been reported 
>> here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf 
>> <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf>
>> Although not tested on samples from patients.
>> 
>> Regards,
>> Sahil Batra
>> PhD candidate, IIT Kanpur
>> 
>> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch > <mailto:jxb...@case.edu>> wrote:
>> One problem I see is the sputum, there’s a reason why swabs are made to get 
>> sufficient viral material. 
>> 
>> Since stool samples test PCR positive that mig

Re: [ccp4bb] COVID-19 protease inhibitors - 2nd call for designs - Thurs midnight

[Jurgen Bosch]

#theBB is too slow :-), Honestly, we probably should have an official CCP4BB 
Twitter account monitored by a few administrators to post relevant things more 
publicly - just a thought.

Thanks for the update and good to know it’s moving forward fast.
I had to renew my license for a software I use for shape complementarity 
searches, so I have not been able yet to contribute, but I reached out to my 
MedChem friends and made them aware of it. Even if they can’t synthesize stuff 
right now because we are mostly shut down, they can use their brains to make 
suggestions.

Jürgen  

> On Apr 1, 2020, at 10:15 AM, Frank von Delft  
> wrote:
> 
> All - last week's call for compound designs to the CoV-2 main protease 
> (https://covid.postera.ai/covid )
> elicited an astonishing response...  (I confess I was quite taken aback.)
> 
> I just realised I should let this BB know the second call for designs is now 
> open.  Deadline is tomorrow 23:59 PST (April 2nd).  (Apologies for those that 
> weren't following on twitter.)
> 
> Two things:  
> we're asking for designs especially focusing on covalent inhibitors (read 
> more here 
> )
> the most convincing designs will be fast-tracked by spending more money to 
> cut several weeks off the testing (read more here 
> )
> Happy designing!  
> 
> Frank
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

One problem I see is the sputum, there’s a reason why swabs are made to get
sufficient viral material.

Since stool samples test PCR positive that might be an easier approach to
get sufficient viral material. As a side note, these are not infectious
anymore, or at least one has not been able to infect tissue cultures from
stool samples.

It’s worth a thought, I’ll need to read those papers you referenced.

I believe I read a suitable preprint for viral load, will search for it
tomorrow.

Jürgen




__
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd , BRB 835
Cleveland, OH 44106 
Phone: 216.368.7565
Fax: 216.368.4223

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

On Apr 1, 2020, at 00:50, James Holton  wrote:

In order to do global survelinace of this new virus I figure we're going
to need billions of tests.  The biggest barriers I believe are
logistical.  Shipping back and forth to a central labs isn't going to
cut it, and neither are test kits that cost $800 each.

I think I may have a plausible way forward to a low-cost and easily
mass-produced test for the SARS-CoV-2 virus using mostly items people
already have, such as smartphones. The most expensive reagent required
will be labeled oligos, but those scale very well.

The key observation is that smartphones can detect as few as 1e6
particles/mL if they do long exposures (180s).  This was using
bioluminescence. Reported here:
https://www.nature.com/articles/srep40203.pdf

The other side of that coin is the expected titer of the virus in
sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four
other respiratory viruses, including one coronavirus, it ranges from 1e6
to 1e8 particles/mL :
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/

This is encouraging!  The challenge will be to detect viral genomes in
"the field" without sophisticated lab equipment like a PCR machine,
lasers, 3D printers, etc.  The concentration will be 1e-15 M, a
challenge, but then again we can detect single molecules using
fluorescence. The questions are:
1) can we get the background low enough so that the dark current of the
camera dominates
2) can we make the signal high enough to overcome the dark current.

1) will depend on the availability of mass-produced filter technology.
However, the best filter may simply be time.  Provided the fluorophore
lifetime is long enough and the camera synchronization tight enough one
could simply measure the "afterglow" after the camera flash has turned
off.  An interesting candidate is europium. Most fluorophores decay in
nanoseconds, but lanthanides can be microseconds to milliseconds.  In
fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
Those decay over minutes to hours.  What I'm not sure about is using
them for FRET. I would appreciate input on experience with this.

2) I believe signal could be enhanced by using very luminous tags (such
as quantum dots), and/or by using multiple tags per genome. This virus
has the largest RNA genome known to date at 30 kbases. That means there
is room for up to 2000 15-mer tags, each with its own label. The set-up
cost for doing ~2000 oligo synthesis reactions will be high, but it can
be done at scale.  You only need ~2 fmol of each oligo, 10 umol
synthesis is about $1k, so I estimate about $1 per test using 1000
different oligos. This price point will be important if we want to make
billions of tests to be used all over the world.  In some countries $1
is a lot.

The detection strategy I am focusing on is FRET.  That is, oligos would
be made in pairs, recognizing abutting sections of the viral genome.
Like this:
5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
which would anneal to one of the current CDC test primer sites:
3' taaagcgactaggtaatagtctgttca 5'
The result in this case would be maximum FRET efficiency only when both
oligos are bound.  From what I can tell, the ATTO465 dye is one that is
most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
ATTO550 should give maximum contrast between the green and red channels
of the iPhone camera. That way you would discriminate presence/absence
by color.  Red=virus, Green=clear. That is just an example. Other tags
might work better.  Maybe quantum dots.

Additional aparatus would be required, of course, and at least a few
reagents to crack open the capsids (DTT and guanidine).  These could be
shipped dry in foil packs.  The end user would simply tear it open and
spit into it.  If the intersted party is performing the test on
themselves, then there is no biohazard.  Heating to 70C (cup of coffee?)
should kill the virus, and these reagents will make it even more dead.
I'm not sure how much purification would be required.  The assay volume
in the Nature 

Re: [ccp4bb] Vote for cryoEM

[Jurgen Bosch]

I personally tweet, and I know a lot of well established scientists that tweet 
too.

Don't pretend Twitter is only junk, there are a lot of serious scientist 
tweeting good and valuable information. True there are enough stupid people 
tweeting BS.

Jürgen

P.S. Follow me on Twitter @Bosch_Lab

> On Mar 31, 2020, at 2:01 PM, Gloria Borgstahl  wrote:
> 
> I personally don't tweet.
> 
> 
> On Tue, Mar 31, 2020 at 12:21 PM Sweet, Robert 
> <27e0eb9d20ec-dmarc-requ...@jiscmail.ac.uk 
> > wrote:
> Real Men (and possibly Women too) Don't Tweet.
> 
> Bob
> 
> 
> From: CCP4 bulletin board  > on behalf of James Holton  >
> Sent: Tuesday, March 31, 2020 12:18 PM
> To: CCP4BB@JISCMAIL.AC.UK 
> Subject: Re: [ccp4bb] Vote for cryoEM
> 
> Allessandro,
> 
> The link you provide directs to a website hosted at someting called 
> "twitter.com ".  My spam filter flagged it as junk.
> 
> -James Holton
> MAD Scientist
> 
> On 3/31/2020 8:41 AM, Alessandro Vannini wrote:
> We are head to head with mass-spectrometry in the #JBCMethodsMadness 
> CHAMPIONSHIP. This can’t happen!
> 
> Get out and VOTE! 15 min to go!
> 
> https://twitter.com/jbiolchem/status/1244655631316987905?s=20 
>   
> >
> 
> [cid:part2.4691618D.6AA0935A@lbl.gov 
> ]
> 
> Sent from my iPhone
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
>   
> >
> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
>   
> >
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Xray-dataset usable despite low completeness ?

[Jurgen Bosch]

Think of completeness with an analogy to turkey.
Say you happen to find a one-legged turkey (incomplete by conventional 
standard) you could still stuff it and put it in the oven and enjoy 93% of the 
turkey. The 7% missing, who cares? Other than I like both legs of the turkey :-)

Happy Thanksgiving everyone

Jürgen 

P.S. back to my wine & ducks to be roasted. @BR, mit Rotkraut & Kartoffelknödel

> On Nov 28, 2019, at 4:38 PM, Bernhard Rupp  wrote:
> 
> Sorry for being late on this thread - 
> 
> but the completeness myth is one of these conventional wisdoms I am seriously 
> questioning and completeness
> as a global statistic is almost uninformative, short of telling you 'fewer 
> than all recordable reflections up to the reported 
> (likely isotropic) resolution limit given whatever (likely isotropic) cutoff 
> was applied'. Sounds not very clear to me. 
> 
> Kay mentioned already that any information is better than no information, 
> with the caveat that you cannot expect
> map quality (being an upper limit for model quality - not going into 
> precision vs accuracy issue here) corresponding to 
> the highest resolution reported, which is in reality frequently anisotropic 
> (but not reported or reflected adequately 
> in the PDB reports). 
> We posted some remarks to this effect recently, pointing out that highly 
> incomplete and anisotropic data can still 
> yield limited but useful information as long as your claim remains 
> correspondingly modest. Section 3.4 in
> http://journals.iucr.org/d/issues/2019/12/00/di5032/index.html
> 
> Having said that, while random incompleteness is not problematic, systematic 
> reciprocal space incompleteness leads
> to corresponding systematic real space effects on the map, the simplest being 
> anisotropic data reflecting anisotropic
> reciprocal map resolution. This is different for example when wedges are 
> missing or absence of serial extinctions makes
> space group determination more challenging (although we are almost in the age 
> where 'record 360 deg of data and 
> try every SG' works). James Holton has video examples for incompleteness 
> effects and some images are also in my book.
> https://bl831.als.lbl.gov/~jamesh/movies/
> 
> Cheers & Happy Thanksgiving, BR
> 
> PS: A systemic rant regarding data quality representation can be found here
> https://www.cell.com/structure/fulltext/S0969-2126(18)30138-2
> 
> --
> Bernhard Rupp
> http://www.hofkristallamt.org/
> b...@hofkristallamt.org
> --
> All models are wrong
> but some are useful.
> --
> 
> -Original Message-
> From: CCP4 bulletin board  On Behalf Of Kay Diederichs
> Sent: Monday, November 25, 2019 08:07
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] Xray-dataset usable despite low completeness ?
> 
> Dear Matthias,
> 
> Of course, high completeness is better than low completeness.
> But as long as your low resolution is pretty much complete, there is no such 
> thing as "too low completeness" at high resolution. Each reflection adds 
> information to the map, and serves as a restraint in refinement.
> 
> best,
> Kay 
> 
> 
> On Mon, 25 Nov 2019 14:11:52 +0100, Matthias Oebbeke 
>  wrote:
> 
>> Dear ccp4 Bulletin Board,
>> 
>> I collected a dataset at a synchrotron beamline and got the statistics
>> (CORRECT.LP) after processing (using xds) shown in the attached 
>> pdf-file.
>> 
>> Do you think this dataset is usable, due to its low completeness? As 
>> you can see in the attached file the completeness is just 50% in the 
>> highest resolution shell, whereas the I over Sigma is above 2 and also 
>> the CC 1/2 (80%) and the R factors (36.8%) have reasonable values.
>> Furthermore the overall statistic are good regarding R factor, CC 1/2 
>> and I over Sigma. The only problem seems to be the completeness. If I 
>> would set the cut-off at a lower resolution to get good completeness, I 
>> would throw away nearly half of my reflections.
>> 
>> I'm happy to here your opinion. In Addition to that: The space group is 
>> orthorhombic and the dataset was collected over 120° using fine slicing 
>> (0.1°).
>> 
>> 
>> Best regards,
>> 
>> Matthias Oebbeke
>> 
>> 
>> -- 
>> Matthias Oebbeke, M.Sc.
>> Research Group of Professor Dr. G. Klebe
>> Institute of Pharmaceutical Chemistry
>> Philipps-University Marburg
>> Marbacher Weg 6, 35032 Marburg, Germany
>> Phone: +49-6421-28-21392
>> Mail: oebbe...@staff.uni-marburg.de
>> www.agklebe.de
>> 
>> 
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> 

Re: [ccp4bb] 5th Banff Meeting on Structural Dynamics, 18/19th Febr. - 22nd February 2017

[Jurgen Bosch]

Just because we have modern technology doesn't mean we have socially made 
progress or for that matter made mental progress regarding women in science, 
which in my opinion is a huge mistake . Despite many efforts, many fields are 
still very male dominated.

Eddie, I like you stirring up the pot. You were already nominated recently on 
this board for president :-)

Jürgen

On Nov 25, 2016, at 12:35, Gerd Rosenbaum 
> wrote:

Very good point, Eddie.

The exclusion of females starts already with the Program Committee.

Gerd Rosenbaum

On 25.11.2016 10:48, Edward Snell wrote:

​This looks like a very interesting scientific meeting but I would just like to 
point out an observation based on the current invited speakers and program 
committee - there are also  scientists who are women in this field.


Gentleman, a little bit of effort would go a long way.


Apologies for my observation but I think this is important.




From: CCP4 bulletin board  
on behalf of Kleine, Irmtraud 

Sent: Friday, November 25, 2016 10:52 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] 5th Banff Meeting on Structural Dynamics, 18/19th Febr. - 
22nd February 2017

Dear all,

This is to remind you of the 5th Banff Meeting on Structural Dynamics 
https://banff2017.desy.de/  which will take place 18/19th February – 22nd 
February 2017.
Please register now for and benefit from early-bird registration fee.

Best regards,


Irmtraud Kleine
Assistant to Professor Chapman
Deutsches Elektronen-Synchrotron DESY
Ein Forschungszentrum der Helmholtz-Gemeinschaft
Center for Free-Electron Laser Science (FS-CFEL-1)
Notkestr. 85
22607 Hamburg
Germany

Phone:  +49 40 8998 5798
Fax:+49 40 8994 5798
E-mail:   irmtraud.kle...@desy.de

Re: [ccp4bb] Thanks to informal query respondents

[Jurgen Bosch]

Your Figure 1 suggest a secret message - or at least I view it that way.

The early steps “basic research” seems to be funded by Euros, while the in 
silico part is funded in Dollars.

Or was that unintentional ?

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Jun 10, 2015, at 5:50 AM, Bernhard Rupp 
hofkristall...@gmail.commailto:hofkristall...@gmail.com wrote:

Hi Fellows,

thanks again to all who took the time to respond (often very
extensively) to my queries regarding funding experience and resource
distribution. The summary is available now ahead of print:

http://www.ncbi.nlm.nih.gov/pubmed/26051321

Let’s hope it has some positive effect.

Best, BR

k.-k. Hofkristallamt
Vista, CA 92084
001 (925) 209-7429
b...@ruppweb.orgmailto:b...@ruppweb.org
b...@hofkristallamt.orgmailto:b...@hofkristallamt.org
http://www.ruppweb.org/
---

Re: [ccp4bb] Off-topic: Request for DNA

[Jurgen Bosch]

Synthesize your gene:

[advertisement on]
https://www.idtdna.com
[/advertisment off]

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 26, 2015, at 2:54 PM, Mohamed Noor 
mohamed.n...@staffmail.ul.iemailto:mohamed.n...@staffmail.ul.ie wrote:

Dear all

I am looking for a small amount of Aquifex aeolicus DNA or cell pellet for PCR. 
Unfortunately neither ATCC nor DSMZ holds this bacterium.

Thanks.

Re: [ccp4bb] Gadolinium complexes- phosphate buffer

[Jurgen Bosch]

Also you can treat your SeMET as heavy atom derivative with your native dataset.
J?rgen

..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On May 18, 2015, at 13:37, Mark J van Raaij 
mjvanra...@cnb.csic.esmailto:mjvanra...@cnb.csic.es wrote:

Hi Isa,

don't discard SeMet too rapidly if there are few Mets, modern beamlines, 
high-redundancy data collection techniques, and processing and phasing programs 
can extract and use small anomalous signal to get structures even if there are 
less SeMets than generally accepted by the rule of thumb. Especially if you 
can rotate around more than one axis or merge data from different crystals. And 
even if the signal is not good enough and you then need additional phasing, the 
SeMet anomalous maps may be useful in tracing.
If you have Cys, try Hg compounds, my favourite is methylmercury chloride. As 
it binds covalently, even if it precipitates in your drop, you may just get 
just enough soluble to react. We usually add a few grains of the mercury 
compound to the reservoir, mix, cover and let equilibrate with the drop for a 
few hours or overnight, then add a ul of the reservoir to the drop and fish 
crystals after different incubation times.

Greetings,

Mark

Mark J van Raaij
Dpto de Estructura de Macromoleculas
Centro Nacional de Biotecnologia - CSIC
c/Darwin 3
E-28049 Madrid, Spain
tel. (+34) 91 585 4616
http://www.cnb.csic.es/~mjvanraaij








On 18 May 2015, at 11:42, isabelle Lucet wrote:

Hi All,

We recently obtained a native data set to 2.8A. With no molecular replacement 
available we are now moving to heavy atom (not enough methionine coverage for 
seleno-met). Unfortunately  crystals grow is in 1.4 Na/K H phosphate pH 8 and 
we do not have much room for improvement.
Any literature you could point to or experience with for example gadolinium 
complexes, co-crystallization, soaking in phosphate buffer? Are we better off 
just focusing on class B metals?

Thanks for your advise.
Kind Regards,
Isa



__
The information in this email is confidential and intended solely for the 
addressee.
You must not disclose, forward, print or use it without the permission of the 
sender.
__

Re: [ccp4bb] on space group

[Jurgen Bosch]

Shameless self-promotion aka advertisement:

http://lupo.jhsph.edu/boschlab/Xray_Workshop.html

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 13, 2015, at 4:46 AM, Harry Powell 
ha...@mrc-lmb.cam.ac.ukmailto:ha...@mrc-lmb.cam.ac.uk wrote:

Hi

A great way to learn about crystallographic things (including how to run the 
programs and how to interpret the output) is to attend one of the short courses 
that are held around the world on a regular basis, and talk to the experts that 
develop the programs - CCP4 has one (I understand, though I might be wrong 
because it hasn't been announced yet) due to take place in Nanjing in 
September. I don't know how local to Nanjing Smith might be, but it would be 
worth considering.


Dear All,

Alhough there are on-line explainations on the space group, I found it was 
difficult to fully understand. Here we take P 1 21 1 as an exmaple, will you 
please explain to me with easy language what each number indicates？Or do we 
have a on-line server which can demonstrate the meaning of each number? How can 
we get out crystal arrangement with repeating the unit cell in the format of 
space group?

Smith


Harry
--
Dr Harry Powell, MRC Laboratory of Molecular Biology, Francis Crick Avenue, 
Cambridge Biomedical Campus, Cambridge, CB2 0QH

Chairman of International Union of Crystallography Commission on 
Crystallographic Computing
Chairman of European Crystallographic Association SIG9 (Crystallographic 
Computing)

Re: [ccp4bb] [RANT] Reject Papers describing non-open source software

[Jurgen Bosch]

Can you get a license ?
I know of several software that have components from other developers from 
which one needs to obtain a separate license.
Was the discountinued software superseded by something more superior ?

Can you send me an off list reply including the software name ?

J?rgen

..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On May 12, 2015, at 12:51, James Stroud 
xtald...@gmail.commailto:xtald...@gmail.com wrote:

I hereby call on the broadest community of academics and researchers, including 
scientists, historians, economists, sociologists, psychologists, and whoever 
else has ever published a paper or read from the literature thereof, to reject 
any and all papers that describe new software that itself is not released under 
an open source model.

I further declare that this post is designed to ruffle feathers and incite 
incendiary conversation, to provoke all-caps and evoke multiple exclamation 
marks with interposed 1s where anger prevents one from properly holding the 
shift key.

My rationale for this post: I have just spent a week installing software for 
structural biology (not crystallography) only to find that some of the key 
utilities needed were described in a recent publication but were not OSS. The 
authors have decided to stop supporting the software but have not retracted 
their paper, which is completely irrelevant without the availability of the 
software package they describe.

Let's hammer this one out and come to the rational conclusion that non-OSS 
software should not be awarded publications.

James

Re: [ccp4bb] CYS mod

[Jurgen Bosch]

BME around ?
Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 12, 2015, at 3:30 PM, David Schuller 
schul...@cornell.edumailto:schul...@cornell.edu wrote:

What are the most likely modifications of a CYS residue? I am attaching images 
of a couple of residues in my current structure. Blue is 2Fo-Fc, Green is Fo-Fc 
positive difference, purple is model-phased anomalous differences at 3 sigma, 
data from 1.70 A source.

I am guessing about 3 non-H atoms, probably one of them with anomalous 
scattering.
Not all CYS in the structure are thus modified, only these two, but they show 
up consistently in 4 noncrystallographic copies.

TIA,

--
===
All Things Serve the Beam
===
  David J. Schuller
  modern man in a post-modern world
  MacCHESS, Cornell University
  schul...@cornell.edumailto:schul...@cornell.edu

cysB.jpgcysA.jpg

Re: [ccp4bb] XDS INP

[Jurgen Bosch]

Edit your XDS.INP file to look like this:

!JOB= XYCORR INIT COLSPOT IDXREF
JOB=DEFPIX INTEGRATE CORRECT

Then rerun ads and be happy thereafter.

and RTFM !

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 11, 2015, at 9:19 AM, Harry Powell 
ha...@mrc-lmb.cam.ac.ukmailto:ha...@mrc-lmb.cam.ac.uk wrote:

Hi Lu

Mosflm indexes your image using all defaults without any problems ;-)

XDS shouldn't have any difficulties with indexing this.

I suspect your crystal only diffracts to ~3.0 - 3.5 Å so you could do a better 
experiment by moving the detector back to ~ 900mm...

BUT - PLEASE don't attach your original images to messages to the BB  - anyone 
on a slow data link will be considerably indisposed by having an 8Mb attachment 
that they (most probably) really don't want to have.


On 11 May 2015, at 12:56, luzuok wrote:

Dear Karine and Jürgen,

The   XDS terminated in IDXREF with error message:

!! ERROR !!! INSUFFICIENT PERCENTAGE ( 50%) OF INDEXED REFLECTIONS

In the COLSPOT, I can see
NUMBER OF DIFFRACTION SPOTS LOCATED 53669
IGNORED BECAUSE OF SPOT MAXIMUM OUT OF CENTER 174
IGNORED BECAUSE OF SPOT CLOSE TO UNTRUSTED REGION 450
WEAK SPOTS OMITTED 11753
NUMBER OF DIFFRACTION SPOTS ACCEPTED 41292

It seems that the accepted spots are enough. But I don't know why there are so 
many spots which cannot be indexed.

Best wishes!

LU






--
卢作焜
南开大学新生物站A202

在 2015-05-11 16:49:53，Karine Sparta 
karine.spa...@helmholtz-berlin.demailto:karine.spa...@helmholtz-berlin.de 
写道：
Dear Lu,

I'm sorry to read that you couldn't process your data with XDSAPP.
I've been busy last week updating our webpage, the latest version of XDSAPP is 
now available for download since friday (an official announcement will be made 
tomorrow).
Maybe it will help with your data set, if not, I would be interested in the 
reason for the failure (IDXREF.LP), I may learn something from it to improve 
the next version.

Best regards,
Karine Sparta


On 05/10/15 10:30, luzuok wrote:
Dear all,
Thank you for all your excellent suggestions! The XDS package now works 
smoothly in xdsapp in my Linux.
Unfortunately, due to the data quality or maybe my ability, the process was 
failed.

Best wishes!

Lu Zuokun




--
卢作焜
南开大学新生物站A202


At 2015-05-08 03:39:07, Clemens Vonrhein 
vonrh...@globalphasing.commailto:vonrh...@globalphasing.com wrote:
Dear Lu,

apart from the other excellent advice you got: autoPROC is another
pipeline that uses XDS under the hood (among other tools) and tries to
take most of the pain out of getting started with XDS. For free (to
academics) licences/download please see

  http://www.globalphasing.com/autoproc/

Cheers

Clemens

On Thu, May 07, 2015 at 04:33:38PM +0800, luzuok wrote:
 Dear all,
 I'm a XDS beginner and the first problem I encounter was the INP file. 
 The detector type is MX300. Is the detector supported by XDS? How to 
 modified the INP file?
 The sitefile of HKL2000 was attached.
 Can anyone provide some tutorial to use XDS?

 Best wishes!

 Lu zuokun







 --
 卢作焜
 南开大学新生物站A202

 [-- octet-filter file type: ASCII text --]

 HKLSuite0.95SITE
 {alig,1} {180}
 {beamline_name} {BL17B}
 {cass,rotx} {-0.119}
 {cass,roty} {-0.167}
 {crossx} {0.044}
 {crossxy} {0.009}
 {crossy} {0.001}
 {detec} {CCD unsupported-m300}
 {extension} {*.mccd}
 {last_saved,chix} {3.24}
 {last_saved,chiy} {1.65}
 {last_saved,date} {17:11:17 Apr 19, 2015}
 {last_saved,user} {17bdata1}
 {polar} {0.99}
 {rotation_axis} {Phi}
 {synchrotron_name} {SSRF}
 {xbeam} {149.336}
 {y_scale} {1}
 {ybeam} {145.711}


--

***
* Clemens Vonrhein, Ph.D. vonrhein AT GlobalPhasing DOT com
*
*  Global Phasing Ltd.
*  Sheraton House, Castle Park
*  Cambridge CB3 0AX, UK
*--
* BUSTER Development Group  
(http://www.globalphasing.comhttp://www.globalphasing.com/)
***






--
Dr. Karine Sparta
Soft Matter and Functional Materials
Macromolecular Crystallography (BESSY-MX)
Elektronenspeicherring BESSY II
Albert-Einstein-Str. 15, D-12489 Berlin, Germany

Fon: +49 30 8062 14869
http://de.linkedin.com/pub/karine-sparta/2a/48/1b3/en



Helmholtz-Zentrum Berlin für Materialien und Energie GmbH

Mitglied der Hermann von Helmholtz-Gemeinschaft Deutscher Forschungszentren e.V.

Aufsichtsrat: Vorsitzender Prof. Dr. Dr. h.c. mult. Joachim Treusch, stv. 
Vorsitzende Dr. Beatrix Vierkorn-Rudolph
Geschäftsführung: Prof. Dr. Anke Rita Kaysser-Pyzalla, Thomas Frederking

Sitz Berlin, AG 

Re: [ccp4bb] XDS INP

[Jurgen Bosch]

The process failed.
You mean it didn’t process the data past the indexing routine?
That just means you need to actually change some values and type in a couple of 
commands into XDS.INP - not everything can be designed to be point  click.

Look at IDXREF.LP and check out what the suggested space group is, then change 
that in XDS.INP and provide the correct cell dimensions. Change the JOB card to 
start with DEFPIX and remove the previous sub routines.

Look at the manual of XDS on Kabsch’s website.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 10, 2015, at 4:30 AM, luzuok luzuo...@126.commailto:luzuo...@126.com 
wrote:

Dear all,
Thank you for all your excellent suggestions! The XDS package now works 
smoothly in xdsapp in my Linux.
Unfortunately, due to the data quality or maybe my ability, the process was 
failed.

Best wishes!

Lu Zuokun




--
卢作焜
南开大学新生物站A202


At 2015-05-08 03:39:07, Clemens Vonrhein 
vonrh...@globalphasing.commailto:vonrh...@globalphasing.com wrote:
Dear Lu,

apart from the other excellent advice you got: autoPROC is another
pipeline that uses XDS under the hood (among other tools) and tries to
take most of the pain out of getting started with XDS. For free (to
academics) licences/download please see

  http://www.globalphasing.com/autoproc/

Cheers

Clemens

On Thu, May 07, 2015 at 04:33:38PM +0800, luzuok wrote:
 Dear all,
 I'm a XDS beginner and the first problem I encounter was the INP file. 
 The detector type is MX300. Is the detector supported by XDS? How to 
 modified the INP file?
 The sitefile of HKL2000 was attached.
 Can anyone provide some tutorial to use XDS?

 Best wishes!

 Lu zuokun







 --
 卢作焜
 南开大学新生物站A202

 [-- octet-filter file type: ASCII text --]

 HKLSuite0.95SITE
 {alig,1} {180}
 {beamline_name} {BL17B}
 {cass,rotx} {-0.119}
 {cass,roty} {-0.167}
 {crossx} {0.044}
 {crossxy} {0.009}
 {crossy} {0.001}
 {detec} {CCD unsupported-m300}
 {extension} {*.mccd}
 {last_saved,chix} {3.24}
 {last_saved,chiy} {1.65}
 {last_saved,date} {17:11:17 Apr 19, 2015}
 {last_saved,user} {17bdata1}
 {polar} {0.99}
 {rotation_axis} {Phi}
 {synchrotron_name} {SSRF}
 {xbeam} {149.336}
 {y_scale} {1}
 {ybeam} {145.711}


--

***
* Clemens Vonrhein, Ph.D. vonrhein AT GlobalPhasing DOT com
*
*  Global Phasing Ltd.
*  Sheraton House, Castle Park
*  Cambridge CB3 0AX, UK
*--
* BUSTER Development Group  (http://www.globalphasing.com)
***

Re: [ccp4bb] APBS

[Jurgen Bosch]

Why not ?

Look at the partner protein is there a similar charge reversal present?
The function is preserved (interaction of both proteins) in different species 
but the charges have swapped over time in evolution while the backbone scaffold 
(fold) of the protein was maintained.

Just as an example P.falciparum aldolase versus human aldolase share only 50% 
identical residues per subunit but the fold of the subunits is within 0.8 Å 
r.m.s.d . If you only consider the conservation of the active site then 45/46 
residues are identical.


..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On May 10, 2015, at 6:37 AM, Andre Godoy 
andre_go...@yahoo.com.brmailto:andre_go...@yahoo.com.br wrote:

Dear users.
I'm comparing surface charge of a structure with its homologous (85% seq ID), 
and noted that APBS suggest completely opposite charge distribution (exactly 
what I expected, since despite its similarity molecules have opposite 
biochemical profile)

But since molecules are quite similar, I'm not convinced that charge 
distribution can be that different.
Considering that AA is basically the same, what other factors can be 
influencing APBS charge calculations? (Ex: rotamers position, crystal packing, 
crystallization conditions, etc)

best,


Andre Godoy
IFSC - University of Sao Paulo - Brazil

Re: [ccp4bb] Thin plate crystals

[Jurgen Bosch]

Along those lines suggested by David I would say these crystals are way too big.
Try freezing some when they are smaller. It would also be worth trying to 
freeze in meshes to support the fragile plate instead of conventional loops.
J?rgen

..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 24, 2015, at 03:52, Hargreaves, David 
david.hargrea...@astrazeneca.commailto:david.hargrea...@astrazeneca.com 
wrote:

The crystals don't look that bad in my opinion. Maybe the cryo step is sub 
optimal? Try using large loops (reduces surface tension forces during 
transfer). Butane 2,3 diol is a good cryo to try. Maybe shoot them at room temp 
(in situ) to get an idea of how they diffract before you manipulate them.
Good luck!

From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Prerana G.
Sent: 24 April 2015 04:01
To: CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Thin plate crystals

Dear all,
I am working on a protein (40kDa) which forms very thin plate shaped crystals 
which diffracts at very low resolution. Protein concentration that i have used 
for crystallisation is approx. 8mg/ml. I have attached the picture of the 
protein crystal.

How can I improve upon the shape of the crystal?


AstraZeneca UK Limited is a company incorporated in England and Wales with 
registered number: 03674842 and a registered office at 2 Kingdom Street, 
London, W2 6BD.

Confidentiality Notice: This message is private and may contain confidential, 
proprietary and legally privileged information. If you have received this 
message in error, please notify us and remove it from your system and note that 
you must not copy, distribute or take any action in reliance on it. Any 
unauthorised use or disclosure of the contents of this message is not permitted 
and may be unlawful.

Disclaimer: Email messages may be subject to delays, interception, non-delivery 
and unauthorised alterations. Therefore, information expressed in this message 
is not given or endorsed by AstraZeneca UK Limited unless otherwise notified by 
an authorised representative independent of this message. No contractual 
relationship is created by this message by any person unless specifically 
indicated by agreement in writing other than email.

Monitoring: AstraZeneca UK Limited may monitor email traffic data and content 
for the purposes of the prevention and detection of crime, ensuring the 
security of our computer systems and checking compliance with our Code of 
Conduct and policies.

Re: [ccp4bb] advice on anomoulous data collection strategy---low resolution, radiation damage, high mosaicity

[Jurgen Bosch]

Just to clarify, I think what Kay meant with strategy is that you don't just 
shoot at the crystal and collect. You should figure out what is the optimum 
start and end point of your data collection. Best to be cautious and not 
immediately go for highest resolution and not fry your crystal. A 4 A complete 
anomalous data set is better than a partial 3.2A one.
J?rgen


..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 17, 2015, at 06:37, Kay Diederichs 
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de wrote:

Hi,
I'd say using a Pilatus detector in fine-slicing mode and lowdose/high 
multiplicity will give you better chances to solve the structure. The right 
strategy makes a difference ...
Best,
Kay

Re: [ccp4bb] advice on anomoulous data collection strategy---low resolution, radiation damage, high mosaicity

[Jurgen Bosch]

I would disagree.
My philosophy is: assume this is your only diffracting crystal, maximize the 
outcome by investing some thoughts into it before being sorry. Therefore, run 
strategy and optimize for anomalous pairs being collected as close in time as 
possible.
If you have the luxury of having multiple crystals you know diffract, then it;s 
a different story.

Regarding the 1degree option, I think that dates back to the dinosaurs of 
crystallography, when only non-decimal numbers were an option to be entered in 
the CLI, yes there was no GUI before :-) Also the goniometers are much more 
accurate these days. More seriously, I think this had something to do perhaps 
with the cost of storage, remember 50 MB was a lot of space 20 years ago. Your 
average Pilatus data set today comes at 3-5 GB, considering a 6TB drive costs 
about 250$ today that’s nothing. Or reading the files from a DAT4 drive took 
ages, so you really didn’t want to collect fine sliced data.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Apr 17, 2015, at 9:25 AM, Kay Diederichs 
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de wrote:

Hi Jürgen,

sorry - that's what I get when mailing while boarding ... No, I'd just collect 
360 degrees, and if the crystal is still ok, another 360, ... This way one
- obtains high completeness and multiplicity
- can discard frames with too much radiation damage
- does not have to worry about the starting point of data collection.
To make the most of the second 360°, you should change some parameter: 
wavelength, rotation axis (requires a BL with kappa or Prigo), or at least 
distance (by few percent).

When I read that 1° frames are collected, I just wonder why? Because it used to 
be done like that in the good old times?

HTH,

Kay

On Fri, 17 Apr 2015 11:55:42 +, Jurgen Bosch 
jbos...@jhu.edumailto:jbos...@jhu.edu wrote:

Just to clarify, I think what Kay meant with strategy is that you don't just 
shoot at the crystal and collect. You should figure out what is the optimum 
start and end point of your data collection. Best to be cautious and not 
immediately go for highest resolution and not fry your crystal. A 4 A complete 
anomalous data set is better than a partial 3.2A one.
J?rgen


..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 17, 2015, at 06:37, Kay Diederichs 
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de wrote:

Hi,
I'd say using a Pilatus detector in fine-slicing mode and lowdose/high 
multiplicity will give you better chances to solve the structure. The right 
strategy makes a difference ...
Best,
Kay

Re: [ccp4bb] advice on anomoulous data collection strategy---low resolution, radiation damage, high mosaicity

[Jurgen Bosch]

I’m sure James Holton has an option for that :-)

By the way, zero photon data sets exist and have been published before (some of 
them had to be retracted though).

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Apr 17, 2015, at 11:00 AM, Keller, Jacob 
kell...@janelia.hhmi.orgmailto:kell...@janelia.hhmi.org wrote:

Finally, there is simply no downside in collecting more degrees with 
proportionally lower dose on the Pilatus. Merging the data recovers the _same_ 
signal. It has only advantages - so many that I won't write them up here with 1 
finger on my tablet.

...Up to the point at which one can no longer index/refine the frames reliably.

And it would be interesting to try to figure out what that point is, or how to 
push it to even fewer photons.

JPK







With a CCD it's a different story.

Best,

Kay

Am 17. April 2015 15:49:21 MESZ, schrieb Jurgen Bosch 
jbos...@jhu.edumailto:jbos...@jhu.edu:
I would disagree.
My philosophy is: assume this is your only diffracting crystal,
maximize the outcome by investing some thoughts into it before being
sorry. Therefore, run strategy and optimize for anomalous pairs being
collected as close in time as possible.
If you have the luxury of having multiple crystals you know diffract,
then it;s a different story.

Regarding the 1degree option, I think that dates back to the dinosaurs
of crystallography, when only non-decimal numbers were an option to be
entered in the CLI, yes there was no GUI before :-) Also the
goniometers are much more accurate these days. More seriously, I think
this had something to do perhaps with the cost of storage, remember 50
MB was a lot of space 20 years ago. Your average Pilatus data set today
comes at 3-5 GB, considering a 6TB drive costs about 250$ today that’s
nothing. Or reading the files from a DAT4 drive took ages, so you
really didn’t want to collect fine sliced data.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology Johns Hopkins Malaria
Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Apr 17, 2015, at 9:25 AM, Kay Diederichs
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de
wrote:

Hi Jürgen,

sorry - that's what I get when mailing while boarding ... No, I'd just
collect 360 degrees, and if the crystal is still ok, another 360, ...
This way one
- obtains high completeness and multiplicity
- can discard frames with too much radiation damage
- does not have to worry about the starting point of data collection.
To make the most of the second 360°, you should change some parameter:
wavelength, rotation axis (requires a BL with kappa or Prigo), or at
least distance (by few percent).

When I read that 1° frames are collected, I just wonder why? Because it
used to be done like that in the good old times?

HTH,

Kay

On Fri, 17 Apr 2015 11:55:42 +, Jurgen Bosch
jbos...@jhu.edumailto:jbos...@jhu.edu wrote:

Just to clarify, I think what Kay meant with strategy is that you
don't just shoot at the crystal and collect. You should figure out what
is the optimum start and end point of your data collection. Best to be
cautious and not immediately go for highest resolution and not fry your
crystal. A 4 A complete anomalous data set is better than a partial
3.2A one.
J?rgen


..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology Johns Hopkins Malaria
Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708 Baltimore, MD
21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 17, 2015, at 06:37, Kay Diederichs
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de
wrote:

Hi,
I'd say using a Pilatus detector in fine-slicing mode and lowdose/high
multiplicity will give you better chances to solve the structure. The
right strategy makes a difference ...
Best,
Kay

--
Diese Nachricht wurde von meinem Android-Mobiltelefon mit K-9 Mail gesendet.

Re: [ccp4bb] XDS Processing with Translated Detector and Radiation Sensitive Crystals

[Jurgen Bosch]

Hi Christopher,

you should also limit the resolution to say 6 A on the first pass to get your 
correct cell parameters. Your low I/sigI suggests that the indexing did not 
pick up the correct orientation of the crystal. You should also see this in 
your INTEGRATE.LP file if you look at the spot profiles. In your case they 
should look pretty flat instead of a nice three dimensional peak.

Here’s an example how it should look like:
 0  0  0 -1 -1  0  0  3  2  0  0  0  0 0  0  0 -1 -1  0  1  3  3  0  0  0  
0 0  0  0 -1 -1  0  1  3  2  0  0  0  0
 0  0  0  0  0  0  1  5  4  0 -2  0  0 0  0  0  0  0  0  2  5  4  0 -1  
0  0 0  0  0  0 -1  0  2  4  3  0 -1  0  0
 0  0  0  0  0  0  3  9  7  1 -2 -3  0 0  0  0  0 -1  0  4  9  6  0 -2 
-2  0 0  0  0 -1 -1  0  3  7  5  0 -1 -2  0
 0  0  0  0  0  0  7 18 12  2 -2 -4  0 0  0  0  0  0  1  7 16  9  1 -2 
-3  0 0  0  0  0  0  1  6 12  6  0 -2 -2  0
 0  0  0  0  0  2 16 35 20  3 -2 -4 -4 0  0  0  0  0  2 15 29 14  2 -2 
-3 -2 0  0  0  0  0  2 12 19  8  0 -1 -2 -2
 0  0  0  0  0  6 39 65 28  5 -1 -4 -5 0  0  0  0  1  5 32 50 19  2 -1 
-3 -4 0  0  0 -1  0  4 22 28  9  1 -1 -2 -3
 0 -1 -1  0  1 11 75100 34  5 -2 -4 -4 0  0  0  0  1 10 58 72 22  3 -1 
-3 -3 0  0  0  0  0  6 30 33 10  1 -1 -2 -2
 0 -1 -1 -1  1 15 88100 30  3 -2 -4 -4 0  0 -1 -1  1 12 68 76 21  2 -2 
-3 -4 0  0 -1  0  0  5 27 32  9  0 -1 -2 -3
 0 -1 -1 -1  0 13 67 66 16  0 -3 -4 -5-1 -1 -1 -1  0 10 51 53 14  0 -2 
-4 -4 0  0 -1 -1  0  4 19 22  6  0 -1 -2 -3
 0 -1 -1 -1  0  8 38 34  6 -2 -4 -5  0 0 -1 -1  0  0  7 29 28  6 -1 -3 
-4  0 0  0  0 -1  0  3 13 13  2 -1 -1 -2  0
 0 -1 -1 -1  0  3 17 14  1 -3 -4 -5  0 0 -1 -1  0  0  3 14 11  1 -2 -3 
-4  0 0 -1  0  0  0  2  8  7  0 -1 -1 -2  0
 0  0 -2 -1 -1  1  6  5 -1 -3 -4  0  0 0  0 -1 -1  0  2  6  4 -1 -2 -2  
0  0 0  0 -1  0  0  2  4  3 -1 -2 -1  0  0
 0  0  0 -2 -1  0  3  2 -2 -3  0  0  0 0  0  0 -3 -1  0  3  2 -2 -2  0  
0  0 0  0  0 -2  0  1  3  1 -1 -1  0  0  0
yours might look like this perhaps:
 0  0  0  0  1  0  0  0  1  0  0  0  0 0  0  0  0  0  0  0  1  2  0  0  
0  0 0  0  0  0  0 -1 -1  1  2  1  0  0  0
 0  0  0  0  0  0  0  1  1  1  0  0  0 0  0  0 -1  0  0  0  2  2  1  0  
0  0 0  0  0 -1 -1  0  0  3  3  1  0  0  0
 0  0  0  0  0  0  0  1  1  1  1  0  0 0  0  0 -1  0  0  1  3  2  1  0 
-1  0 0 -1 -1 -1 -1  0  1  4  4  2  0 -1  0
 0  0  0  0  0  0  1  1  1  1  0  0  0 0  0 -1 -1  0  0  1  2  2  1  0 
-1  0 0 -1 -1 -1  0  0  1  5  5  2  0 -1  0
 0  0  0  0  0  1  1  1  1  1  0  0  0 0  0  0  0  0  0  1  2  1  1  0  
0 -1 0  0  0 -1 -1  0  2  5  5  2  0 -1 -1
 0  0  0  0  0  1  1  1  1  0  0  0  0 0  0  0  0  0  1  1  1  1  1  0  
0  0-1  1  0  0  0  1  2  4  4  2  0 -1 -1
-1  0  0  0  0  1  2  1  0  0  0  0  0 0  0  0  0  0  1  2  2  1  1  0  
0 -1 0  0  0  0  0  1  2  3  3  2  0 -1 -2
 0  0  0  0  1  1  1  1  1  0  0  0  0 0  0  0  0  1  1  1  1  1  1  0  
0  0 0  0  0  0  0  1  2  2  2  1 -1 -1 -1
 0  0  0  1  0  1  1  1  1  1  1  0  0 0  0  0  1  1  1  1  1  1  0  0  
0  0 1  0  0  0  0  1  2  1  1  0 -1 -1 -1
 0  0  1  0  0  0  1  1  1  0  0  0  0 0  0  1  0  0  1  1  1  1  0 -1  
0  0 0  0  0  1  0  1  1  1  1  0  0 -1  0
 0  0  0  0  0  0  1  0  0  0  0  0  0 0  0  1  0  0  0  0  0  0  0  0  
0  0 0  1  1  1  1  1  1  1  1  0  0  0  0
 0  0  1  0  0  1  1  1  0  0  0  0  0 0  0  1  1  1  1  1  1  0  0  0  
0  0 0  0  1  1  1  1  1  1  1  0  0  0  0
 0  0  0  0  1  0  1  0  0  0  0  0  0 0  0  0  0  1  0  0  0  0  0  0  
0  0 0  0  0  1  1  1  0  1  1  0  0  0  0


It usually also helps to not refine everything at the same time. You can fix 
the distance for example.

Here’s another trick, index over the whole dataset, then edit the SPOT.XDS file 
to only include say the strongest 5000 or 1 spots.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Apr 16, 2015, at 4:37 PM, Christopher Barnes 
co...@pitt.edumailto:co...@pitt.edu wrote:

Hi all,

I am having trouble processing synchrotron data with XDS for a large unit cell 
protein complex (Spacegroup P2, Cell 225 x 256 x 430). My crystals diffract to 
3.1 Angstrom, but at this resolution we had significant spatial overlaps. To 
alleviate this we translated the detector 40 mm in both the x and y directions 
to achieve higher resolution at a distance of 850mm (on a Pilatus 6M detector), 
as well as used fine slicing (0.1 degree) for data 

Re: [ccp4bb] on NCS restraint

[Jurgen Bosch]

yes.
Have two sets of NCS operators one that describe the four subunits and one 
describing the two subunits. If during the refinement of your structure you 
should find out that the subunits are not identical to each other you can relax 
the NCS weights.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Apr 16, 2015, at 9:02 PM, Smith Lee 
0459ef8548d5-dmarc-requ...@jiscmail.ac.ukmailto:0459ef8548d5-dmarc-requ...@jiscmail.ac.uk
 wrote:


Dear All,

If a protein contains 6 subunits, 4 subunits from the same sequence (subunit A, 
B, C, D all from the same sequence), each of the 2 other subunits from 2 
diffrent sequences (subunit E from the second sequence, subunit F from the 
third sequence), in this situation should I use NCS restraint or not?

If my protein contains 2 subunits, both of the 2 subunits composed of the 
eaxctly same sequence, however supposing the 2 subunits have a little diffrent 
conformation, in this situation should we use NCS retraint or not?

Smith

Re: [ccp4bb] Best (Suitable) Mac Laptop configuration for protein Xtallography

[Jurgen Bosch]

You two should absolutely invest in the 1TB SSD option as well, I have 
essentially the machine you describe, but it is now already 14 months old. So 
the newer models will be maybe 30% more powerful in overall performance.
The geek bench score of my Macpro 2010 (48GB RAM, dual hexa core) corresponds 
to my current laptop.
J?rgen

..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 2, 2015, at 09:33, Mark van Raaij 
mjvanra...@cnb.csic.esmailto:mjvanra...@cnb.csic.es wrote:


Hi Ivan,
Being in the same boat, I have investigated a bit. It seems to be a straight 
trade-off between more processing power, more RAM and less partability Macbook, 
Macbook Air, 13 Macbook Pro, 15 Macbook Pro.
For running Rosetta I think you will be thankful for the faster processors and 
extra RAM of the Pro...and only the 15 has quadcore. You can put 16 Gb RAM in 
the 13 Pro but it has only dual-core.
The 15 is quite a bit bigger to lug around...nevertheless I'll probably go for 
that one.
I don't know if there are any updates to the Macbook forthcoming, but I have to 
wait a bit anyway for financial reasons.

Mark J van Raaij
CNB-CSIC
www.cnb.csic.es/~mjvanraaijhttp://www.cnb.csic.es/~mjvanraaij

On 2 Apr 2015 15:03, xaravich ivan 
xaravich.i...@gmail.commailto:xaravich.i...@gmail.com wrote:
Hello everyone,
I am planing to buy a new Mac laptop (price no bar) which will let me run all 
xtallographic (CCP4 and Phenix) and reasonable Rosetta Molecular Modelling 
(1000 to 1 decoys) softwares smoothly.

What in your opinion is the best configuration. (RAM, memory, number and speed  
of processors, graphics card etc.) Also I am buying a Mac display separately so 
that I have a big screen for easy visualization of models, COOT etc.

I know that powerful Mac desktops can make life much easier but here I am 
specifically interested in Mac laptops only.

As always thanks in advance and I will post all the suggestions anonymously for 
others with same query.

ivan

Re: [ccp4bb] Manuscript PRL

[Jurgen Bosch]

This one surely will be cited quite a bit, well done Herr Hofkristallrat
J?rgen

..
J?rgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Apr 1, 2015, at 01:17, Bernhard Rupp (Hofkristallrat a.D.) 
hofkristall...@gmail.commailto:hofkristall...@gmail.com wrote:

HI Fellows,

just in time for some easy Easter reading, the first page regarding some
new ideas about nucleation

Link to full content is in the PDF document.

Best regards, BR
-
Bernhard Rupp
001 (925) 209-7429
+43 (676) 571-0536
b...@ruppweb.orgmailto:b...@ruppweb.org
hofkristall...@gmail.commailto:hofkristall...@gmail.com
http://www.ruppweb.org/
---
The road to scientific serfdom is paved with Nature papers
---


Rupp_2015_Phys_Rev_Letters_114(13)_Tunneling_p1.pdf

Re: [ccp4bb] how to recover my data

[Jurgen Bosch]

Dear Smith,

Wouldn’t it be easier to reprocess your data and do a MR with your rescued PDB 
file and start from there ? Instead of trying to mess around with the 
non-readable mtz file ?

You should have those raw images somewhere, perhaps even at the beam line if 
you have not made your own copies.

Sorry for your disaster,

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Mar 5, 2015, at 12:36 AM, Smith Lee 
0459ef8548d5-dmarc-requ...@jiscmail.ac.ukmailto:0459ef8548d5-dmarc-requ...@jiscmail.ac.uk
 wrote:


Dear All,

Recently my computer hardware has been broken and all the data has been 
recovered to movable hardware by technician. However I find the recovered PDB 
file and the MTZcould not be openned by Coot. Then I open the revovered PDB 
file by WordPad, and from WordPad I copied it to notepad and save it as pdb 
file. I find the Coot can open the notepad saved pdb file, thus my pdb files 
can be succesfully recovered from the hardware.

But will you please tell me how to have Coot open my mtz file? After data 
recovery by the technicial, the data size of the mtz file did not decrease, 
thus I think there is a way to have it recovered.

I have not noticed there were similar or identical posts as mine for recovery 
data before in the CCP4 mail list.

Thus I am looking forward to getting a reply from you on how to recover my mtz 
file.

Smith

Re: [ccp4bb] Protein-Ligand Crystallization

[Jurgen Bosch]

Hi Monica,

A different option is they both bind but destabilize your protein (as you 
suggested). This will likely not help much if you are trying to co-crystallize 
them. But there are couple of examples out there in the literature that show 
the contrary, despite destabilizing Tm they got structures with bound ligands - 
I think it was the Beryllium Clan out in Seattle that had such an example but I 
might be misremembering this.

There’s a clear dose-dependency in both ligands, so I would give it a shot 
(assuming you have enough protein  ligands).
You could run some ITC or SPR experiments to verify this if you happen to have 
access to such an instrument.
Now if you have an enzymatic assay, that can be tricky if you are looking for 
inhibition. Yes your ligands may inhibit, great but perhaps your protein is 
simply destabilized and unfolds etc. and fails to fulfill its normal function - 
here it would be handy to run some CD spectra to actually se if there is a 
dose-dependent unfolding of the protein. This will also help you decide how 
likely it might be to co-crystallize the ligand.

Do you have native crystals ? Soak your ligands in and observe if they 
crack/dissolve.

Good luck,

Jürgen


..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Feb 5, 2015, at 9:33 PM, John Newitt 
newit...@gmail.commailto:newit...@gmail.com wrote:

Hi Monica,

Your Tm results don't suggest any binding of your ligand to the protein. Your 
ligand concentrations are quite high so I am not convinced of even weak 
binding. The destabilization that you are seeing at the highest concentration 
may be due to ligand precipitation causing protein denaturation/unfolding.

If available, I would search for other ligands for co-crystallization. 
Alternatively, confirm the ligand binding by some other technique before 
investing a lot of time and protein in crystallization screening.

John

Sent from my iPad

On Feb 5, 2015, at 8:43 AM, Monica Mittal 
monica.mitta...@gmail.commailto:monica.mitta...@gmail.com wrote:

Hi all,
I am working to crystallize a protein-ligand complex. I did a preliminary 
melting curve analysis for the protein in the absence and presence of 2 ligands 
(dissolved in protein buffer). I kept the other controls as buffer an a known 
standard to confirm instrument performance. All expts done in triplicates.
Now the results are like : Tm of protein alone is 56 deg, Tm in the presence of 
Lig1 conc. of 0.05mM, 0.1mM, 1.0mM and 10.0mM is 56.2, 56.1, 56.0 and 53.5 
respectively !! Tm in the presence of Lig 2 conc. of 0.05mM, 0.1mM, 1.0mM, 
4.0mM and 10.0mM is 56.2, 56.1, 54.9, 52.3 and 50.6 respectively !!
Although the effective delta Tm for both is different at higher concentration, 
but both are kind of making protein less stable. So i was wondering, will it be 
difficult to co-crystallize them !! Any suggestions in this regard are highly 
appreciated !!

Thanks
Monica

Re: [ccp4bb] How to apply NCS restraint to a ligand in refmac?

[Jurgen Bosch]

Hi Ethan,
DM with a mask of the ligand in chain A then applying the NCS matrices and 
looking at the resulting density perhaps ?
Theoretically it should improve, this is of course assuming that your ligand 
does not adopt different conformations in the three chains.
In Refmac you can also add a NCS restraint per residue - I assume a ligand is 
considered a residue but I have not tried this.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Jan 30, 2015, at 7:38 PM, Ethan A Merritt 
merr...@u.washington.edumailto:merr...@u.washington.edu wrote:

Is there some way to apply NCS restraints to the binding pose of a ligand
during refmac refinement?



That is, suppose I have 3 copies of the binding site and the density in
each copy is OK but not great. I would be more confident of a refined
pose that jointly satisfied the electron density at all 3 sites than a
refinement that resulting in slightly different poses at each site.



If not, is there an equivalent to the shelxl SAME directive?
I.e. is there a way to tell it I don't know what the true
distance is from ligand atom X to protein atom Y, but I want to restrain
it to be the same in all 3 copies?



Ethan



--
Ethan A Merritt
Biomolecular Structure Center, K-428 Health Sciences Bldg
MS 357742, University of Washington, Seattle 98195-7742

Re: [ccp4bb] coot 0.8.1 freezes my graphics

[Jurgen Bosch]

Wrong board, try sending it to the cootbb
Jūrgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Jan 18, 2015, at 13:32, Kenneth A. Satyshur 
satys...@wisc.edumailto:satys...@wisc.edu wrote:

Coot is our best program there ever was for fitting electron density. It is 
very simple to
use and easy to teach. But sometimes improvements are made that seem to just 
slow
things down. Having used 0.7.1 for a long time, i noticed that rotation and 
scaling of
density is very quick, but translations are much slower (cntrl left mouse). Now 
in 0.8.1, translations
have become impossibly slow. They freeze the whole graphics system for as long 
as 10 seconds.
It is recalculating a map, and this can be seen using top to display the cpu 
usage. Also, we are now given
a spherical density, which is annoying, really, since cell edges are not 
spherical and its
hard to examine 3D space in a bubble. But there must be a way of speeding up the
recalculation of the map during translation. I have a dual quad core with 15 
idle cores while
coot recalculates its new map in one core. Maybe multi core is the way to go. I 
hope this can be fixed.
Otherwise I will stick with the 0.7 version that makes a cuboid map. I really 
enjoy the rapid
examination of density that coot provides especially in 3D.

thanks to the Coot team.

Linux paprika 2.6.32-504.3.3.el6.x86_64 #1 SMP Fri Dec 12 16:05:43 EST 2014 
x86_64 x86_64 x86_64 GNU/Linux
24 Gb memory, Nvidia Quadro FX 4800 Stereo graphics with Nvidia drives 
installed and the kernal recompiled.
--
Kenneth A. Satyshur, M.S.,Ph.D.
Senior Scientist
University of Wisconsin
Madison, Wisconsin 53706
608-215-5207
satyshur.vcf

Re: [ccp4bb] Post-translational modification of cystine

[Jurgen Bosch]

lower left corner, I buy a water molecule there
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Jan 13, 2015, at 7:48 PM, RHYS GRINTER 
r.grinte...@research.gla.ac.ukmailto:r.grinte...@research.gla.ac.uk wrote:


Hi All,

I think everyone enjoys this game, so to save me a trawl through the literature 
can anyone help me interpret this density? The density on the end extents to 
7.4 sigma, so something reasonably large.
I guess it's some kind of PTM of the cystine residues, but nothing specific 
springs to mind. the crystallization conditions were 0.1 M CITRIC ACID, PH 5.0, 
2.0 M NACL.

Cheers,

Rhys
Cyc_PTM2.jpgCyc_PTM.jpg

Re: [ccp4bb] Queries regarding bead beater and french press.

[Jurgen Bosch]

[Advertisement on] Avestin Emulsiflex C5 [/Advrtisement off]
Google is your friend.

Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Jan 12, 2015, at 10:44 AM, Johnson Luwang 
jlw_...@iisertvm.ac.inmailto:jlw_...@iisertvm.ac.in wrote:

Dear All,
I am looking for an equipment that can do Saccharomyces cerevisiae cells lysis 
(say about 100-200ml lysate volume). I have used the Constant Systems cell 
disruptor TS 0.75kW model (at another facility)  that can go up to 40kpsi.  It 
works perfect for my yeast cell lysis experiment.   We were planning to set up 
similar facility at our place, but some of my colleagues suggested me about 
bead beater  for the same purpose.  Quite frankly I don't have much idea 
about bead beater. And I need the suggestions from the experts who have used 
these two systems (french press and bead beater). Is the bead beater better 
than the french press for yeast cell lysis? If so can you suggest me a bead 
beater model which is the best for our purpose?

Many thanks.

Best Regards,
Johnson L.W.

Re: [ccp4bb] question related to MTZ file

[Jurgen Bosch]

I assume you mean with initial mtz file the one derived from Mosflm after 
processing your images. If so, then how about running that file through scala 
http://www.ccp4.ac.uk/html/scala.html  ?
I bet there are some tutorials on the CCP4 webpage on that topic.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Dec 31, 2014, at 9:19 PM, Dialing Pretty 
03f1d08ed29c-dmarc-requ...@jiscmail.ac.ukmailto:03f1d08ed29c-dmarc-requ...@jiscmail.ac.uk
 wrote:

Dear All,

After I got the initial MTZ file without the structure factors, will you please 
tell me by which CCP4 program I can get the MTZ file with the structure factors?

I am looking forward to getting your reply.

Dialing

Re: [ccp4bb] PDB deposition - sequence file

[Jurgen Bosch]

I would disagree. You list as sequence what you cloned and expressed. If you 
are missing parts then you have to describe why e.g. Proteolysis or disordered 
etc.
Best to actually do a mass spec analysis on those crystals since a significant 
portion is missing.

Jūrgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Dec 30, 2014, at 15:50, Jeffrey, Philip D. 
pjeff...@princeton.edumailto:pjeff...@princeton.edu wrote:

Mohamed,

You always list the sequence of what's actually in the crystal, e.g. 1-105. 
(Not: what's in the model or what the sequence of the full length protein is).  
Make sure that if there's any lingering residues from any affinity/purification 
tags they get included in the sequence too.

Phil Jeffrey
Princeton



From: CCP4 bulletin board [CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK] 
on behalf of Mohamed Noor 
[mohamed.n...@staffmail.ul.iemailto:mohamed.n...@staffmail.ul.ie]
Sent: Tuesday, December 30, 2014 3:26 PM
To: CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] PDB deposition - sequence file

Dear all

The protein that was crystallized is only the first 105 residues of a 
230-residue protein. In the structure, I can see density for residues 6-72. For 
deposition, should the whole native/biological sequence be deposited?

Thanks.
Mohamed

Re: [ccp4bb] crystallography software on mac

[Jurgen Bosch]

Hi Lisa,

you made quite a jump from 10.6 (released august 2009) to 10.10 !

You definitely will need to update your Fink - I assume you are familiar with 
Bill Scott’s page
http://scottlab.ucsc.edu/~wgscott/xtal/wiki/index.php/Fink_for_10.10

Regarding Pymol - have you accepted the conditions for the Xcode tools that 
were updated too ? That may be the trick. I assume X11 is not working either 
right now, you’ll need to get XQuartz.2.7.7

You will likely find other programs that will not work in their 10.6 
incarnation on 10.10 such as Word 2009 or Endnote or VMWare Fusion.

Once you have everything back up and running it’s a pleasure - I hope though 
that you updated also to a recent Mac with 10.10 otherwise it will be slow on 
Hardware form 2009.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Dec 27, 2014, at 10:00 PM, LISA 
science...@gmail.commailto:science...@gmail.com wrote:

Hi all,

Since I updated to Yosemite on my Mac, pymol and phenix does not work any more. 
Pymol can not be re-installed after updated to yosemite.
The previous version of mac is 10.6 and the fink on my mac is also 10.6. Do I 
need to update the fink to 10.10? How to make the pymol work?  Thank you.

Best Regards,

Lisa

Re: [ccp4bb] asymmetric homotrimer in the asu

[Jurgen Bosch]

Not sure if you are looking for something similar like this perhaps:
http://www.rcsb.org/pdb/explore.do?structureId=2AUC

Trimer in asu but all different.

Jūrgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Dec 11, 2014, at 20:06, Jeremy Tame 
jt...@tsurumi.yokohama-cu.ac.jpmailto:jt...@tsurumi.yokohama-cu.ac.jp wrote:

Dear Hay

I suggest that you use analytical ultracentrifugation to determine the 
oligomeric state of the protein in solution.
Mass spectrometry and light scattering are also useful, but there are so many 
examples of gel filtration proving
erroneous it has questionable value as an analytical technique. For an example 
of a dimer interface predicted by
PISA to be real you could look at Yoshida et al, JMB 423, 351 (2012). The 
protein is in fact a monomer in solution.
PISA is a fantastic tool, but interfaces in crystals do not always reflect the 
solution state. My guess (with the
information I have) is that your protein is probably a monomer too.

With regard to Michael Garavito's reply requesting more information, I would 
like to comment that scepticism
is indeed an important god in the pantheon of science, but that that minor 
deity open-mindedness also deserves the
occasional nod. 10-fold crystal symmetry is one example, but the list of 
impossible things now become mainstream
is a long one (continental drift, Earth 100,000 years old, quantum 
mechanicsand so on). Bayes theorem cannot
help you discover the truth if you have set its prior probability to zero. But 
I haven't my morning o-cha yet either.

good luck
Jeremy


On Dec 11, 2014, at 9:27 PM, Hay Dvir wrote:

Dear all,


We have a structure of a rather tightly packed homotrimer protein in the ASU 
with no apparent crystallographic or non-crystallographic rotational symmetry 
between monomers.
Attempting to establish the biological assembly, we are very interested to hear 
about additional similar cases you might know of.

Thanks in advance,
Hay


---
Hay DvirPh. D.
HeadTechnion Center for Structural Biology
TechnionHaifa 323, Israel
Tel:+(972)-77-887-1901
Fax:+(972)-77-887-1935
E-mailhd...@technion.ac.ilmailto:hd...@technion.ac.il
Websitehttp://tcsb.technion.ac.il

Re: [ccp4bb] Correct usage of AIMLESS in combination with XDS/XSCALE

[Jurgen Bosch]

Hi Renato,

have a look at the first example:
http://strucbio.biologie.uni-konstanz.de/xdswiki/index.php/Xscale
A minimal input file to combine two datasets into one file is:

OUTPUT_FILE=fae-native.ahkl
INPUT_FILE= ../fae-native/xds_1/XDS_ASCII.HKL
INPUT_FILE= ../fae-native/xds_2/XDS_ASCII.HKL


Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Dec 10, 2014, at 3:38 PM, Renato Weisse 
rwei...@strubio.uni-kiel.demailto:rwei...@strubio.uni-kiel.de wrote:

Hi CCP4BBers,

I would like to ask a question about how to use AIMLESS correctly with
scaled data from XDS. I collected two data sets of the same crystal, both
of which scaled individually with CORRECT from XDS. Merging of reflexes
should be done with AIMLESS. Also to obtain a more comprehensive data
statistic.
So I fed both data sets into AIMLESS with the option ONLYMERGE. But I
think that both data sets were not scaled to each other (which indeed is
no surprise with key ONLYMERGE).
So, my question is the following: what is the right order to scale and
merge multiple datasets with XDS/AIMLESS.
The output from XSCALE is a file with suffix .ahkl. Is it the same format
like .hkl and does it fit into AIMLESS?

I really appreciate your valuable sugestions.

Kind regards,
Renato

Re: [ccp4bb] Correct usage of AIMLESS in combination with XDS/XSCALE

[Jurgen Bosch]

You can also do this in XDSCONV.INP simply change the output to what you prefer

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Dec 10, 2014, at 3:57 PM, Renato Weisse 
rwei...@strubio.uni-kiel.demailto:rwei...@strubio.uni-kiel.de wrote:

Hi Jürgen,

thank you very much. Actually I overread the line can be converted into
mtz via pointless.

Renato

Hi Renato,

have a look at the first example:
http://strucbio.biologie.uni-konstanz.de/xdswiki/index.php/Xscale
A minimal input file to combine two datasets into one file is:

OUTPUT_FILE=fae-native.ahkl
INPUT_FILE= ../fae-native/xds_1/XDS_ASCII.HKL
INPUT_FILE= ../fae-native/xds_2/XDS_ASCII.HKL


Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Dec 10, 2014, at 3:38 PM, Renato Weisse
rwei...@strubio.uni-kiel.demailto:rwei...@strubio.uni-kiel.demailto:rwei...@strubio.uni-kiel.de
 wrote:

Hi CCP4BBers,

I would like to ask a question about how to use AIMLESS correctly with
scaled data from XDS. I collected two data sets of the same crystal, both
of which scaled individually with CORRECT from XDS. Merging of reflexes
should be done with AIMLESS. Also to obtain a more comprehensive data
statistic.
So I fed both data sets into AIMLESS with the option ONLYMERGE. But I
think that both data sets were not scaled to each other (which indeed is
no surprise with key ONLYMERGE).
So, my question is the following: what is the right order to scale and
merge multiple datasets with XDS/AIMLESS.
The output from XSCALE is a file with suffix .ahkl. Is it the same format
like .hkl and does it fit into AIMLESS?

I really appreciate your valuable sugestions.

Kind regards,
Renato

Re: [ccp4bb] Correct usage of AIMLESS in combination with XDS/XSCALE

[Jurgen Bosch]

Best is what at the end provides the solution :-)
Kay Diedrich recently had a thread about two weeks ago about the pro and cons 
of various options of scaling and why not to do certain things. I’m sure google 
in combination with CCP$ will help find that thread ….

I believe it was called “To scale or not to scale

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Dec 10, 2014, at 4:28 PM, Phil Evans 
p...@mrc-lmb.cam.ac.ukmailto:p...@mrc-lmb.cam.ac.uk wrote:

You have several options:

1. scale together in XSCALE, use XDSCONV to export and avoid Aimless altogether
2. scale together in XSCALE, import into Pointless, then Aimless ONLYMERGE
3. take the two XDS_ASCII.HKL files into Pointless, then AIMLESS, either (a) 
SCALE CONSTANT to give a single scale for each dataset, or (b) rescale
4. take the two INTEGRATE.HKL files into Pointless and do all the scaling in 
Aimless

I have no idea which of these is best

Phil

On 10 Dec 2014, at 20:38, Renato Weisse 
rwei...@strubio.uni-kiel.demailto:rwei...@strubio.uni-kiel.de wrote:

Hi CCP4BBers,

I would like to ask a question about how to use AIMLESS correctly with
scaled data from XDS. I collected two data sets of the same crystal, both
of which scaled individually with CORRECT from XDS. Merging of reflexes
should be done with AIMLESS. Also to obtain a more comprehensive data
statistic.
So I fed both data sets into AIMLESS with the option ONLYMERGE. But I
think that both data sets were not scaled to each other (which indeed is
no surprise with key ONLYMERGE).
So, my question is the following: what is the right order to scale and
merge multiple datasets with XDS/AIMLESS.
The output from XSCALE is a file with suffix .ahkl. Is it the same format
like .hkl and does it fit into AIMLESS?

I really appreciate your valuable sugestions.

Kind regards,
Renato

Re: [ccp4bb] Regarding prediction of Binding pocket

[Jurgen Bosch]

Dear Sanjit,

use the BD with lots of grains of salt and verify with a real experiment that 
the found binding pocket is real, else this is waste of money.
If you know of a known ligand to interact with your particular protein, you can 
use this as a test BUT depending what your input model is e.g. NMR or X-ray 
structure, resolution, conformations of side chains etc. you might not even 
find a true ligand binding to your protein.
VLS is tricky and can serve as a guide but NEVER take it as the only truth for 
your experiments.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 15, 2014, at 11:11 AM, Sanjit Roy 
sanjitkr...@gmail.commailto:sanjitkr...@gmail.com wrote:

Dear All
   I wish to know If the experimental determination of
ligand-protein complex structures is difficult to analyze or if the
ligand protein complex structure is not known. Then blind docking (BD)
and pocket search (PS) calculations would be good in the prediction of
binding mode and the location of the pocket of a ligand on the entire
protein surface.
Sincerely
Sanjit Kumar
--
*Dr. Snjit Kumar*
*Work gives you meaning and purpose and life is empty without it. *

[ccp4bb] offtopic - Ebola Forum Webcast @JHSPH

[Jurgen Bosch]

I know this has not much to do with crystallography, but I think it’s worth the 
time reading and deciding if you want to watch the webcast that took place 
yesterday at Johns Hopkins School of Public Health.

http://www.jhsph.edu/events/2014/ebola-forum/

http://www.jhsph.edu/events/2014/ebola-forum/webcast.html

Call it advertisement if you want. But for those interested, I think it’s worth 
the time to listen to it. The live cast was a bit choppy in the transmission, 
but now it is much better quality.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

Re: [ccp4bb] crystallization with hydrophobic ligands

[Jurgen Bosch]

An alternative is to dissolve your compound in MeOH and dispense it either 
manually or via robot, let the plate sit sometime in the hood for faster 
evaporation and then add your protein + reservoir.
Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 15, 2014, at 5:18 PM, Keller, Jacob 
kell...@janelia.hhmi.orgmailto:kell...@janelia.hhmi.org wrote:

Since you mentioned EtOH, why not do this:

-Make a tray with the appropriate mother liquors
-Make a drop for each well containing mother liquor and high-concentration 
ligand in EtOH (you could vary the ratios here as needed.)
-Equilibrate by vapor diffusion until EtOH all goes into the well soln (couple 
of hours at the most?)
-Add protein to these drops

You could skip right to the protein step if your protein doesn't mind EtOH at 
fairly high concentrations, and anyway it will be gone fairly quickly, esp at RT

Jacob Keller


From: CCP4 bulletin board [CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK] 
on behalf of Monica Mittal 
[monica.mitta...@gmail.commailto:monica.mitta...@gmail.com]
Sent: Wednesday, October 15, 2014 2:13 PM
To: CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] crystallization with hydrophobic ligands

Dear All

Can anyone give suggestions for handling the solubility problem of highly 
hydrophobic compounds, during co-crystallization or inhibition assays?
The ligands I am using are almost insoluble in aquous medium. In DMSO or 95% 
Ethanol, the solubility is higher.
Besides crystallization, this solubility is also a hindrance for in-vitro or 
in-vivo assays requiring higher conc. of ligand.

Thanks in advance !
Monica

Re: [ccp4bb] I222 - P22121 space-group ambiguity

[Jurgen Bosch]

I think Eleanor was looking at the cell axis in particular a and b they are off 
by almost 10%, hence unlikely to be identical, unless I missed something there.
Jürgen
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 13, 2014, at 11:30 AM, Bernhard Rupp 
b...@ruppweb.orgmailto:b...@ruppweb.org wrote:

It might help to look at the images and predictions. You a have serial vs 
integral extinctions
(i.e. conditions limiting reflections are:)
P 2 21 21 (Standard: P 21 21 2, btw)
0K0 : K=2N only
00L : L=2N only

I222
HKL : H+K+L=2N only

Alternatively you could process unmerged data with XPREP or so and look
at the systematic absence violations.

The lattice metric  is the same for both SGs (did not understand Eleanor’s 
remark)

In principle, differences between NCS and XS of compatible metric become more 
distinct at
higher resolution (i.e. at night, all cats are grey).

Best, BR

From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Florian 
Schmitzberger
Sent: Montag, 13. Oktober 2014 10:47
To: CCP4BB@JISCMAIL.AC.UKmailto:CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] I222 - P22121 space-group ambiguity

Hi everybody,

I collected a number of X-ray data sets from crystals originating from the same 
cryst. drop. I solved the initial structure in P22121 space group by MR with 
Phaser locating two molecules (data to ~ 2.1 Angstr.); refined R/Rfree: 
0.213/0.244.

Processing of some of the other data sets with XDS/Aimless is consistent with 
I222 space group (resolution ~ 2.6 Ang.). I can locate one molecule. The 
unit-cell dimensions for I222 and the initial P22121 space groups for two of 
the data sets are:
I222: a=87.8 b=101.18 c=123.63; P22121: a=93.34 b=105.47 c=122.98;

I superposed the molecule in I222 onto one of the two located for the initially 
solved P22121; the orientation of the NCS-related molecule in P22121 differs 
from the crystallographic-symmetry related one in I222. Trying to solve this 
P22121 data set in I222 with MR, does not result in high Z scores, and maps do 
not look good.

Some of the data sets that process in I222 to ~ 3 Angstr., I can also solve in 
P22121, locating two molecules (differences may not be that clear in this case, 
since the resolution is lower).

Some other data sets process in P22121 with Aimless; with a substantial 
off-origin Patterson peak, indicating translational NCS. For these, Phaser 
positions two molecules that are related by crystallographic translational NCS. 
These two molecules are crystallographic-symmetry related in the original 
P22121 data set. I can also solve these data sets in I222 space group, with the 
overall Z score higher than for the P22121 data.

I am uncertain, what the ‘true’ space group for some of my data sets is. Could 
it be that for data that process in P22121, but can be solved in I222, 
reflections that would indicate I222 space group were not collected? 
Alternatively, perhaps what I am seeing is that there is a (gradual) transition 
of the crystal lattice (between P22121 and I222 or vice versa), caused by 
variation in crystal handling/cooling or exposure to X-rays.

It’s relevant to me, because in P22121 space group, a region of the molecule 
that is of biological interest makes NCS-related crystal contacts that are 
crystallographic-symmetry related in I222.

Has anybody observed similar cases? I would appreciate comments.

Cheers,

Florian

Re: [ccp4bb] Biolayer Interferometry

[Jurgen Bosch]

Whatever you decide to do, it is good practice to confirm your “hit” with an 
orthogonal method.
Interactions in both directions with the same piece of equipment is a start but 
that in my eyes does not count as another method.

If you are trying to decide between the Blitz and an Octet I would definitely 
go for the Octet but there may be some money constrains related to this 
question.
You should also be clear about the differences between EPR and SPR and their 
limitations.
Good luck and have fun with it.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 10, 2014, at 10:56 AM, Alfredo Torres 
tor...@correo.ifc.unam.mxmailto:tor...@correo.ifc.unam.mx wrote:

Dear all,

Sorry for the non-CCP4 question. We are evaluating the current techniques to 
measure target-ligand interactions, and we would very much like to know the 
experience that the members of this community have about the BLItz/Octet system 
from ForteBio, in particular the rate of false positives/negatives and the 
feasibility of biosensor regeneration.

Many thanks in advance for your feedback, Alfredo.

Alfredo Torres-Larios, PhD
Instituto de Fisiologia Celular, UNAM
Mexico, DF, Mexico

Re: [ccp4bb] XDS.INP for X25

[Jurgen Bosch]

This helps:
http://strucbio.biologie.uni-konstanz.de/xdswiki/index.php/XDSGUI

But you also have my script off list :-)

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 9, 2014, at 2:17 PM, Patrick Loll 
pat.l...@drexel.edumailto:pat.l...@drexel.edu wrote:

Hi,
I'm trying to help a colleague process some data collected at beamline X25 of 
the late, lamented NSLS. Does anyone have an XDS.INP file that they know works 
for such data (this is for the Pilatus detector)? I have kludged together a 
file that looks right, but the processing still doesn't feel quite right...
Thanks,
Pat

---
Patrick J. Loll, Ph. D.
Professor of Biochemistry  Molecular Biology
Director, Biochemistry Graduate Program
Drexel University College of Medicine
Room 10-102 New College Building
245 N. 15th St., Mailstop 497
Philadelphia, PA  19102-1192  USA

(215) 762-7706
pat.l...@drexelmed.edumailto:pat.l...@drexelmed.edu

Re: [ccp4bb] Space group numbers

[Jurgen Bosch]

Yes, we ran into exactly that issue as well.
Jūrgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Streetx-apple-data-detectors://4, W8708
Baltimore, MD 21205x-apple-data-detectors://5/0
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/

On Oct 2, 2014, at 05:38, Kay Diederichs 
kay.diederi...@uni-konstanz.demailto:kay.diederi...@uni-konstanz.de wrote:

On Tue, 30 Sep 2014 13:29:02 +0100, Phil Evans 
p...@mrc-lmb.cam.ac.ukmailto:p...@mrc-lmb.cam.ac.uk wrote:

Be careful: the International Tables space group number may be ambiguous. For 
example sg number 18 may refer to P 21 21 2 or its permuted settings P 21 2 21 
or P 2 21 21, if you follow the proper IUCr convention that primitive 
orthorhombic space groups have abc

I would like to point out that there is an alternative interpretation of the 
International Tables (Vol A, 4th ed. 1995). In that interpretation (which e.g. 
XDS follows) space group 18 has the 'standard' space group symbol, P21 21 2 
(bold letters in Table 3.2). This is of course not ambiguous at all; the pure 
2-fold then corresponds to the c axis and there is always a permuation of 
axes to achieve this. As a result, the axes are not necessarily ordered such 
that abc . The latter ordering is just a convention which was chosen for 
convenience and the convention refer(s) to the cell obtained by the 
transformations from Table 9.3.1 (citing from table 9.3.2) - in other words, 
the convention is fulfilled _after_ the transformation (which of course is just 
order-permuting while keeping right-handedness) - nothing new here.

In my understanding, CCP4 developers have (years ago) understood this 
convention as a condition, which lead them to  invent CCP4 space group 
symbols 1017 and 2017 as well as 1018, 2018, 3018. This also seems to be the 
reason for the default being SETTING CELL-BASED in POINTLESS.

Users of XDS should be aware that by default, POINTLESS therefore permutes the 
axes such that abc . This however may lead to space groups 1017 / 2017 / 
1018/ 2018/ 3018 - indicated in the MTZ file, but not in the POINTLESS log file 
(last I checked).

In consequence, XDS will use the space group 17 or 18 (which is what POINTLESS 
reports), but the user must provide  the correct ordering (which does not 
necessarily mean abc) of cell parameters in XDS.INP. The easiest way, for XDS 
users, would be to run POINTLESS with the SETTING SYMMETRY-BASED option (I 
wish the latter were the default because the default SETTING CELL-BASED has no 
advantages that I can see). Or they use the good old manual way of 
inspecting, by eye, the systematic absences along H00 0K0 00L - this cannot 
fail.

To me, symmetry trumps cell metric so SETTING SYMMETRY-BASED should be the 
default.

I'm harping on this because I have recently seen how a Molecular Replacement 
solution was not obtained in space group 18 because of the misleading (I'd say) 
ordering abc .

I'm probably also harping on this because it took me so many years to discover 
this failure mode, and I would like to prevent others from falling into this 
trap.

HTH,

Kay




The space group names are unambiguous (though also watch out for R3  R32 which 
are normally indexed as centred hexagonal, but could be indexed in a primitive 
cell)

Phil


On 30 Sep 2014, at 13:07, Simon Kolstoe 
simon.kols...@port.ac.ukmailto:simon.kols...@port.ac.uk wrote:

Dear ccp4bb,

Could someone either provide, or point me to, a list of space-groups relevant 
to protein crystallography just by space group number? I can find lots of 
tables that list them by crystal system, lattice etc. but no simple list of 
numbers.

Thanks,

Simon

Re: [ccp4bb] Phaser question, twinning, DIALS, suggestions welcome

[Jurgen Bosch]

Thanks Randy,

so from your reply it seems that cutoff is differently treated. And if I 
interpret your email correctly it is better to provide Phaser with a truncated 
versus a full data set. I tried both cases, but I had assumed that if you 
restrict the resolution within Phaser it would be the same as if you give 
Phaser to begin with a truncated dataset.
Perhaps it would be a good idea in th automatic routine to first check if the 
user wants to truncate the data and then run the automatic scoring analysis 
with that value ?

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Oct 1, 2014, at 5:15 AM, Randy Read 
rj...@cam.ac.ukmailto:rj...@cam.ac.uk wrote:

Hi Jurgen,

You could send me a logfile off-list, and maybe I would spot something in there.

We’ve put some effort into putting more intelligence into the Phaser search, so 
that it adapts to the initial perceived difficulty of the problem in setting 
the initial parameters, and then adapts to indicators of success or failure 
during the search.  Much of the time this works very well, but there’s 
obviously room for improvement.  For one thing, it appears that we’re 
frequently too optimistic about how good the model will be and how easy the 
search will be.

One question: when you say that you cut at 2.5A for MR, do you do that by 
setting the resolution within the Phaser run, or do you have an MTZ file with 
only data to 2.5A?  If the former, then you’re over-riding some of Phaser’s 
automation, which will choose the initial resolution limit based on the 
perceived difficulty of the problem (a function of model completeness, expected 
RMS error of the model, and the number of reflections to different resolution 
limits).  It’s this initial automated choice that can go wrong if we’re too 
optimistic, because then a clear solution isn’t found, and then Phaser repeats 
the search with data to the full resolution, which can take longer than just 
choosing an intermediate resolution from the start.

Anyway, if the problem is expected to be easy but turns out to be difficult, 
this implies that some of the information used to decide it should be easy is 
wrong or too optimistic.  One top possibility is that the model is not as good 
as expected, e.g. because of conformational changes.  If there’s a potential 
hinge-bending motion, then you’re usually better off searching with separate 
domains.  If the change is something that can’t be described with rigid-body 
motions, then it would be better to increase the expected RMS error from what 
Phaser deduces from the sequence identity.  Increasing the RMSD by 10-20% would 
be a good first bet in such a case.

The other top possibility is that the space group is wrong.  Is there any 
ambiguity in the space group?  In particular, do any of the twinning tests 
indicate that the data may be twinned (which can lead to choosing too high 
symmetry)?

Best wishes,

Randy

On 1 Oct 2014, at 03:02, Jurgen Bosch jbos...@jhu.edumailto:jbos...@jhu.edu 
wrote:

Dear BB, or in particular Phaser developers :-)

This must be part of British humor right (or was that the Canadian influence 
Randy) ?

eLLG indicates that placement of ensemble ensemble_1 will be straightforward
   The data are sufficient to exceed the eLLG target

The search space is finite 143 x 143 x 80 Å with 3 or 4 molecules per asu, but 
Phaser has been burning CPU cycles quite a bit, we are approaching 24h by now. 
Data extends to 1.7 Å - for MR we cut at 2.5 Å.

I can hear Garib, yes, Molrep was done in few minutes but I’m not super 
convinced about the solution either. Same with BALBES and MrBump (which took a 
few more minutes, actually also days for MrBump)

The space group appears to be P63 22 as judged by XDS, pointless, xtriage, 
however the crystals are split (at least in some areas it’s visible) but I 
thought XDS would take care of these “aliens” and eliminate them mostly. My 
graduate student, Lauren, found a nifty program called DIALS that we wish to 
explore further to rescue the “nice” data we have and hopefully solve the 
structure.

Lower symmetry space groups were tried down to P21 with increasing number of 
molecules per asu and applying twin laws if necessary. The minor problem with 
the twins is how do I really know that it is a higher symmetry space group and 
not a 50% twin in a lower symmetry ? Rwork/Rfree in this particular case do not 
seem to help at all for distinguishing between the solutions. Maps looks sort 
of right but R-factors are not reflecting what you see on the screen.

We appreciate any suggestions and ideas what else we could do.

Thanks,

Jürgen

[ccp4bb] Phaser question, twinning, DIALS, suggestions welcome

[Jurgen Bosch]

Dear BB, or in particular Phaser developers :-)

This must be part of British humor right (or was that the Canadian influence 
Randy) ?

eLLG indicates that placement of ensemble ensemble_1 will be straightforward
   The data are sufficient to exceed the eLLG target

The search space is finite 143 x 143 x 80 Å with 3 or 4 molecules per asu, but 
Phaser has been burning CPU cycles quite a bit, we are approaching 24h by now. 
Data extends to 1.7 Å - for MR we cut at 2.5 Å.

I can hear Garib, yes, Molrep was done in few minutes but I’m not super 
convinced about the solution either. Same with BALBES and MrBump (which took a 
few more minutes, actually also days for MrBump)

The space group appears to be P63 22 as judged by XDS, pointless, xtriage, 
however the crystals are split (at least in some areas it’s visible) but I 
thought XDS would take care of these “aliens” and eliminate them mostly. My 
graduate student, Lauren, found a nifty program called DIALS that we wish to 
explore further to rescue the “nice” data we have and hopefully solve the 
structure.

Lower symmetry space groups were tried down to P21 with increasing number of 
molecules per asu and applying twin laws if necessary. The minor problem with 
the twins is how do I really know that it is a higher symmetry space group and 
not a 50% twin in a lower symmetry ? Rwork/Rfree in this particular case do not 
seem to help at all for distinguishing between the solutions. Maps looks sort 
of right but R-factors are not reflecting what you see on the screen.

We appreciate any suggestions and ideas what else we could do.

Thanks,

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

Re: [ccp4bb] how to measure the angle between two aromatic ring plane in PYMOL?

[Jurgen Bosch]

Coot? Measure angle
I assume you just want that value and not a script to run for multiple 
occasions?
Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://lupo.jhsph.edu

On Sep 25, 2014, at 17:30, Wang, Bing 
bingw...@ou.edumailto:bingw...@ou.edu wrote:

Hi everyone,

I want to tell an angel between two aromatic planes which comes from two 
different molecules and cross each other.

First, I tried the easier ways. I presume these two aromatic rings are in the 
perfect planes, that is why I tried plane_wizard.py and draw_plane_cgo.py which 
work very well. However after I got two plates by plane_wizard or draw_plane, I 
don't know how to measure the angle between these two plates. I also don't know 
whether I could get the angle I wanted from these two ways. I tried 
vector_angly.py which cann't loaded into pymol properly. If it could, how can i 
do to get the angel from these two plates I drew. Solutions? Since I am in the 
beginner state, please show me details which i could follow step by step.

Second, If these two aromatic rings are not in the perfect planes, how can i 
find the best fit planes? And then find the angle between the best fit planes? 
I tried svdplos.py and makeCGOplates.py which are downloaded on line. 
unfortunately both of these can't be loaded into pymol properly. Solutions?

Thanks!

Bing Wang

Re: [ccp4bb] XDSGUI @ OSX 10.9.5 (13F34)

[Jurgen Bosch]

Dear BB,

since some replies went off the board and some of you might get stuck with the 
same minor problem, here’s the solution to the XDSGUI issue when updating your 
Mac (in  particular Xcode). Engin was spot on with his reply below.

Jürgen



You might want to update the bulletin board, since the emails did not go to the 
list.

Engin

On 9/23/14 3:35 PM, Jurgen Bosch wrote:
Thanks Engin,

the collective wisdom of the CCP4BB helped again within 10 minutes of sending 
off my email (even though the timestamp says something different).

Thanks - now I’m happy and can process some data.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Sep 23, 2014, at 4:27 PM, Engin Özkan 
eoz...@uchicago.edumailto:eoz...@uchicago.edu wrote:

Did you try to run Xcode after the Xcode update? It asks for a user agreement 
during startup and then re-installs commandline tools. Until I did that, gcc 
did not work.

Engin

On 9/23/14 3:19 PM, Jurgen Bosch wrote:
Dear BB,

can anybody reproduce the problem with XDSGUI on the very latest Mac OSX update 
(from this weekend).
I am unable to run generate_XDS.INP with useful input parameters from the 
diffraction images.

It might just be a permission think perhaps that Apple has introduced in the 
last software update that leads to this problem. These are the values it seems 
to have problems obtaining from the files - sure I can enter them manually but 
hey, it’s the 21st century and we ought to talk to the computer and get a 
structure.

Thanks for any suggestions,

Jürgen

ORGX= XXX ORGY= XXX ! check these values with adxv !
DETECTOR_DISTANCE= XXX
OSCILLATION_RANGE= XXX
X-RAY_WAVELENGTH= XXX
DETECTOR= XXX MINIMUM_VALID_PIXEL_VALUE=XXX OVERLOAD=XXX
SENSOR_THICKNESS= 0
! attention CCD detectors: for very high resolution (better than 1A) make sure 
to specify SILICON
! as about 32* what CORRECT.LP suggests (absorption of phosphor is much higher 
than that of silicon)
NX= XXX NY= XXX QX= XXX QY= XXX ! to make CORRECT happy if frames are 
unavailable

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.eduhttp://lupo.jhsph.edu/



--
Engin Özkan, Ph.D.
Assistant Professor
Dept of Biochemistry and Molecular Biology
University of Chicago
Phone: (773) 834-5498
http://ozkan.uchicago.eduhttp://ozkan.uchicago.edu/

[ccp4bb] XDSGUI @ OSX 10.9.5 (13F34)

[Jurgen Bosch]

Dear BB,

can anybody reproduce the problem with XDSGUI on the very latest Mac OSX update 
(from this weekend).
I am unable to run generate_XDS.INP with useful input parameters from the 
diffraction images.

It might just be a permission think perhaps that Apple has introduced in the 
last software update that leads to this problem. These are the values it seems 
to have problems obtaining from the files - sure I can enter them manually but 
hey, it’s the 21st century and we ought to talk to the computer and get a 
structure.

Thanks for any suggestions,

Jürgen

ORGX= XXX ORGY= XXX ! check these values with adxv !
DETECTOR_DISTANCE= XXX
OSCILLATION_RANGE= XXX
X-RAY_WAVELENGTH= XXX
DETECTOR= XXX MINIMUM_VALID_PIXEL_VALUE=XXX OVERLOAD=XXX
SENSOR_THICKNESS= 0
! attention CCD detectors: for very high resolution (better than 1A) make sure 
to specify SILICON
! as about 32* what CORRECT.LP suggests (absorption of phosphor is much higher 
than that of silicon)
NX= XXX NY= XXX QX= XXX QY= XXX ! to make CORRECT happy if frames are 
unavailable

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

Re: [ccp4bb] composite omit map

[Jurgen Bosch]

http://www.ccp4.ac.uk/html/comit.html
..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Aug 26, 2014, at 2:47 PM, dusky dew duskyde...@gmail.com wrote:

Can you people please tell me how to calculate a composite omit map in ccp4?

Thanks
Madhu

Re: [ccp4bb] Generate small molecule library

[Jurgen Bosch]

you can do this via SMILES and your own script in any flavor and then use your 
preferred program afterwards.
Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

On Aug 11, 2014, at 10:34 AM, Harshavardhan Khare 
harshkh...@gmail.commailto:harshkh...@gmail.com wrote:

Dear all,
I have a small organic molecule with three functional groups. I also have 
another list of functional groups. I want to generate all possible combinations 
of the molecule and any of the three functional groups from the list.
Does anybody know a program that performs this task and writes all the 
generated structure coordinates?

Thanks.

regards,
harsh

[ccp4bb] test

[Jurgen Bosch]

Dear BB,

sorry for the email I’m just validating that after 6 months abstinence I’m back 
on the CCP4BB and can actually post.

Jürgen

..
Jürgen Bosch
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Office: +1-410-614-4742tel:%2B1-410-614-4742
Lab:  +1-410-614-4894tel:%2B1-410-614-4894
Fax:  +1-410-955-2926tel:%2B1-410-955-2926
http://lupo.jhsph.edu

Re: [ccp4bb] linux question

[Jurgen Bosch]

Google for knopix

Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.mac.com/bosch_lab/

On Feb 27, 2010, at 22:10, David Roberts drobe...@depauw.edu wrote:

I have a quick question about linux for all.  Is there anybody  
running a windows pc with linux on a bootable cd or bootable drive/ 
flash drive/??? that works for crystallography apps?  I have a  
colleague who does molecular dynamics calculations and he needs some  
conversion programs that are unix based (not pc based - they just  
haven't been ported and that's not my area).  We have linux  
computers that he can use, but I thought in the end it might be  
easiest if he could just boot up a linux flash drive to run his  
conversion, then go back to his pc and windows.  Something like  
damn small linux or ??


Any thoughts on this?  Thanks

Dave

Re: [ccp4bb] Reg. Protein purification

[Jurgen Bosch]

How about using an anion exchanger after your NTA step ?

Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.mac.com/bosch_lab/

On Jan 8, 2010, at 7:41, Sivaraman Padavattan s.padavat...@gmail.com  
wrote:



Dear all,
I am trying to express the human protein using bacterial expression  
strain (Rosetta) and purified using Ni-NTA affinity purification.  
The Molecular weight of out protein is 47 kDa. In SDS-PAGE, we have  
seen that 27 kDa contaminant protein co-eluted with our protein even  
at high concentration of Imidazole. In Superose 12 column, these two  
proteins eluted as a single peak and its corresponding molecular  
weight suggestive of partial interaction. By mass mapping we have  
found 27 kDa band is an adenylate kinase. Is there any specific way  
to separate adenylate kinase  from our protein?

Thanks in advance,

Sivaraman Padavattan

Re: [ccp4bb] IMAC and Low Ionic Strength

[Jurgen Bosch]

Hi Jacob,
an alternative explenation might be your protein does not bind via the  
tag to the resin but unspecifically. What happens if you add the  
recommended NaCl concentration? Does it fall off too?

Just a thought,
Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.mac.com/bosch_lab/

On Nov 16, 2009, at 16:05, Jacob Keller j- 
kell...@md.northwestern.edu wrote:



Dear Crystallographers,

Recently I incubated a small amount of His-select resin with bacterial
lysate in

(50 mM TRIS-HEPES pH 8.0, 10 mM CaCl2),

and washed the resin, for certain experimental reasons, with

(50 mM TRIS-HEPES pH 8.0, 0.2 mM CaCl2),

at which point a significant amount of my protein fell off the  
column. The
ratio of my protein : background proteins was much higher in these  
washes,
implying that my protein probably had bound, but was now falling off  
the
column due to the 10mM==0.2mM CaCl2 transition. Has anyone had  
problems
using such low ionic strength wash buffers? Is it possibly necessary  
for the

his-metal-ion interaction?

Jacob

***
Jacob Pearson Keller
Northwestern University
Medical Scientist Training Program
Dallos Laboratory
F. Searle 1-240
2240 Campus Drive
Evanston IL 60208
lab: 847.491.2438
cel: 773.608.9185
email: j-kell...@northwestern.edu
***

Re: [ccp4bb] small molecule soaking screening

[Jurgen Bosch]

Additional to all other suggestions you can also mix your ligand at  
low concentration to lots of low concentrated protein and then  
concentrate your protein over time. The advantage, ligands with low  
solubility can bind to your protein while you are concentrating it.  
And then I would attempt to set up trays with your known  
crystallization conditions and eventually cross-seed the drops with  
non-ligand crystals.


Good luck,
Jürgen


..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.mac.com/bosch_lab/

On Nov 13, 2009, at 3:35, herman.schreu...@sanofi-aventis.com herman.schreu...@sanofi-aventis.com 
 wrote:



Dear Rongjin,

In addition to what the others said, I would do the following:

1) check your apo-structure to make sure the putative ligand binding  
is not blocked by a crystal contact and also check that there is a  
channel leading to the binding site. You may not get hits in your  
cocrystallization experiments because the ligands interfere with a  
crystal contact. If the binding site is blocked, you need a  
completely different crystal form. Best would then be to do a de  
novo screening in the presence of the most potent ligand.
2) get independent evidence that your ligand does bind. This can be  
an (enzyme) assay, NMR, biacore, ITC etc. If you are lucky, you may  
be able to also check whether compounds of your crystallization  
buffer or DMSO are interfering with binding.
3) Take the most soluble and most potent compound from (2) and soak  
in the highest concentration you can achieve, which may be as high  
as 0.5-1.0 M. First try to dissolve the compound in water and only  
if that does not work, try ethanol or DMSO.
4) Try to soak crystals grown under very different conditions. We  
recently had a case where we could not soak-in compounds in the  
presence of PEG, but high-salt was no problem. I know cases where  
the reverse was true, where high salt was preventing binding.


Good luck!
Herman

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf  
Of Rongjin Guan

Sent: Thursday, November 12, 2009 10:57 PM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] small molecule soaking screening

Hi All

Sorry that this is a non-ccp4 question, but I hope I can get some good
suggestions from the community.

We have protein crystals under various conditons and want to soak them
with different potential inhibitors. Most of inhibitors havevery  
small
molecular weights (200-300), so it become a problem how to detect if  
the

small compounds have been soaked into the crystals or not.
(co-crystallization experiments yielded no hits so far, though the  
free

form is easy to be crysatllized under many conditions)

We pay $500/day for local X-ray facility access, so we wonder if  
there are

some more efficient ways that allow us to know if the small compounds
soaked in or not, without collecting a whole data set for MR.

We are also thinking if we can mix several compounds together for  
soaking,
to reduce the combinations of soaking experiments with various  
compounds
and crystals from various conditions. Is this practical, if some of  
them have

pretty similar binding affinities to the protein?

All comments/suggestions are welcome.

Thank you

Rongjin Guan

Re: [ccp4bb] small molecule library

[Jurgen Bosch]

Try Emerald, reasonable price, nö comment.
Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.mac.com/bosch_lab/

On Oct 27, 2009, at 10:58, c.weinert c.wein...@bioc.uzh.ch wrote:


Dear all.

I am looking for a library of small (biologically relevant)  
compounds to

test binding to a protein. Does somebody know, if there is a company
that sells such a library for fragment based library screening? (to a
reasonable price).

And does anybody has experience with screening such libraries? I  
assume

that one approach would be soaking the protein with the compounds,
followed by SEC and MS analysis. Anybody tried directly soaking  
crystals

followed by X-ray analysis?

Thanks alot already in advance for your help.

Sincerely,
Christopher

Re: [ccp4bb] heavy atom derivative choice

[Jurgen Bosch]

There is a Xenon chamber at 14-1 if I remember it correctly.
I never had luck though.
How about Iodine or Gadolinium?
Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://web.me.com/bosch_lab/

On Jul 15, 2009, at 13:13, Jacob Keller j- 
kell...@md.northwestern.edu wrote:


Xenon/Krypton, anyone? If you have the equipment, might as well try  
it. I

think I have seen the apparatus at some beamlines, although I did hear
recently that xenon is ridiculously expensive now.

Jacob Keller

***
Jacob Pearson Keller
Northwestern University
Medical Scientist Training Program
Dallos Laboratory
F. Searle 1-240
2240 Campus Drive
Evanston IL 60208
lab: 847.491.2438
cel: 773.608.9185
email: j-kell...@northwestern.edu
***

- Original Message -
From: Phil Jeffrey pjeff...@princeton.edu
To: CCP4BB@JISCMAIL.AC.UK
Sent: Wednesday, July 15, 2009 11:32 AM
Subject: Re: [ccp4bb] heavy atom derivative choice



X Xiong, Cellular  Molecular Medicine wrote:

My Question is:

Does mercury tends to get into the protein core to denature  
protein or

not?


This is more likely to happen for a small bare Hg like Hg2+ in  
HgCl2 or
Hg(OAc)2 than it is for a large organomercury compound like PCMB,  
PCMBS
etc so if you were especially concerned about that, start with the  
latter

compounds.  I'd also probably try Me3Pb(OAc) as an alternative to
mercurials.

Phil Jeffrey
Princeton