Re: [Artemis-users] loading a eukaryotic genome assembly(multifasta) and annotation into Artemis 16.0.0
In Artemis, with a multi-fasta sequence file, the options for the annotation file are to use a GFF file or to in some way to concatenate the EMBL/GenBank feature table (adjusting the coordinates to match the correct position of the assembly). This is what union¹ should do with EMBL files. I am not sure why this wasn¹t successful for you. You obviously do need to use -feature¹ with union to get the feature table included: union feature osf embl entry.embl Using GFF and union are the options used here. Regards Tim On 24/02/2014 20:05, Steven Sullivan sulli...@nyu.edu wrote: ENA (EMBL) provides TEXT and FASTA file downloads for eukaryotic assemblies. The FASTA download is single a multi-fasta file containing separate records for each chromosome. The TEXT download is a single EMBL feature table concatenating all the feature tables of the individual chromosomes. It does not contain the DNA sequence. Loading these two files into Artemis yields a view of the entire assembly as a concatenated sequence, but only the features for the first chromosome in the feature file are loaded. I understand that this issue has been brought up before. (e.g. https://www.mail-archive.com/artemis-users%40sanger.ac.uk/msg00690.html) What I don't see is a workaround. Mention was made of the EMBOSS 'union' command, which I have tried, but I am unable to make that generate an .embl file that contains the correctly remapped coordinates of the features onto the concatenated sequence. The closest I came to success was an .embl file that mapped the first chromosome features only , and incorrectly, onto the concatenated sequence. Is there a 'correct' way to do load a multifasta record and its annotation into Artemis? The Artemis user manual is rather opaque on this topic. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://publists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Automatically create gene names
Hi Mircea I think you have to careful about how you are selecting. If you select the first CDS in the sequence and then use 'Select'-'Same key' and then use the Auto Create Gene Names option the numbering will be from left to right. Then you do the same for 'gene' (using the same start and increment values as before) and for the RNAs. The numbering then should be consistent. Regards Tim On 18/02/2014 17:41, Podar, Mircea pod...@ornl.gov wrote: Hello, I am having difficulties filling in fields for a microbial genome. I have a Genbank format file that already has genes called etc. I wanted to do a renumbering of the genes and CDSs and RNAs so I deleted the original locus_tag from the file. Then I applied Automatically Create Gene Names and used locus_tag as a target. All good. But I also need the same locus tag to go on the CDS/RNAs as well. If I have selected all genes and then apply the select features matching qualifier the selection shifts ao all CDS and RNA genes. Perfect. Now if I want to do again the Automatically Create Gene Names to apply a locus_tag on these it does it but the ordering is all messed up (i.e. I get locus tag 1 for the CDS and locus tag 2 for the gene of that CDS and vice-versa, makes no sense and doesn't seem to be linked with the strand orientation). How can that be fixed? Unfortunately a very simple feature, to copy the locus tag from gene to CDS seems to be missing, or at least I havent figured out how to do it for all genes at once. Unfortunately the locus tag is needed on both gene and CDS in order to import the file into Sequin for GenBank submission. Its much harder to submit a genome nowadays than to actually sequence it... Thanks! Mircea ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://publists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://publists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT - error message: out of range
Hi Astrid I would double check that you are working with single FASTA files (not EMBL/GenBank) when creating the BLAST comparison. Also check that you have the subject sequence above the query sequence. If not let me know where the files are and I will take a look. Regards Tim On 13/09/2013 21:54, Astrid von Mentzer a...@sanger.ac.uk wrote: Hi, I get the error message: match goes off end of subject sequence 4419519. I can't seem to locate why it doesn't work. Ran files through seqret and tried again, didn't work. Ideas? Regards, Astrid *** Astrid von Mentzer, PhD-student University of Gothenburg Institute of Biomedicine Department of Microbiology and Immunology Box 435 405 30 Göteborg Sweden Phone: +46 31 786 62 21 Fax: +46 31 786 62 05 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Invisible line colour option?
Hi Mike No there is no way of doing that currently within Artemis (other than setting the lines to white which you have tried). It may be necessary to prepare several user plot files with just the data you want to display. I will look at adding in the option of being able to hide lines from the graph panel in a future release. Regards Tim On 03/07/2013 16:27, Michael Herron herro...@umn.edu wrote: I am doing user plots that have 8 lines in a frame. I like to set some lines to WHITE while I am studying other lines, but the white line sometimes obscures the other colored lines making the process tedious. Is there a way to set a line to invisible? (or the thickness to zero). Mike ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
[Artemis-users] Artemis and ACT new release
The new Artemis v15 and ACT v12 are available for download from the website. Some of the highlights are: * project file manager, to help group files and make it easier to return to and open project files (annotation, BAM, VCF). * SVG (scalable vector graphics) support for producing high resolution images * indexed user plots (using tabix) - useful for large data sets * read-only indexed GFF support * read alignment heat maps * Feature Stack View¹ to help visualise overlapping gene features The release notes are available here: ftp://ftp.sanger.ac.uk/pub4/resources/software/artemis/release_notes.txt The new releases and current manuals are available from the Artemis and ACT home pages: http://www.sanger.ac.uk/resources/software/artemis/ http://www.sanger.ac.uk/resources/software/act/ -Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT - loading a .tab file
Hi Astrid That message means that one or more of the features in the tab file extends beyond the end of the sequence. I would check the features in the file and find which ones are not within the plasmid sequence. Do you have the additional genes in there as well for example. If you let me know where the files are I can have a look. Regards Tim On 11/16/12 3:09 PM, Astrid von Mentzer a...@sanger.ac.uk wrote: I have run biggerblast and open all the files in ACT and it looks fine. So sequence one is fasta file which contains a plasmid and three additional genes (in that order). When I then try to load a .tab file with the annotations for the plasmid it says one of the features in the entry has an out of range location 1..101857 So the .tab file only contains the annotation for the plasmid and not the three added genes... is that the problem? No way to come around this? I want to look for several genes in a velvet assembled strain at the same time but need to load the annotation for the plasmid. //Astrid *** Astrid von Mentzer, PhD-student University of Gothenburg Institute of Biomedicine Department of Microbiology and Immunology Box 435 405 30 Göteborg Sweden Phone: +46 31 786 62 21 Fax: +46 31 786 62 05 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Fwd: ACT 11.0/big_blast.pl
Hi John As discussed with you off list but for other users... you can use the output from blast+ (using outfmt 6) as the comparison file. So you do not actually need to use the script to generate that. Regards Tim On 10/10/12 2:39 PM, John Legato lega...@nhlbi.nih.gov wrote: Hello, We are attempting to use big_blast.pl and running into errors generating MSPcrunch output for import into ACT. We're running big_blast.pl version: # $Header: /nfs/disk222/yeastpub/Repository/zoo/general/big_blast.pl,v 1.23 2000/11/27 09:44:12 kmr Exp $ We're running blast+ as follows: /v/apps/ncbi-blast-2.2.26+/bin/blastn -query ../../human_screen/nohost_2.fa -db ../../../../Ichthyosporea/Ichthyosporea_874 -out Ichthyosporea_874.2.blast6.txt -outfmt 6 -dust yes We've installed the Pathogen Sequencing Unit's internal Perl module, which the script appears to find. When we run big_blast.pl we get the following error and 0 length output: pened Ichthyosporea_874.1.blast6.txt.crunch for writing Couldn't read any blast results from Ichthyosporea_874.1.blast6.txt wrote Ichthyosporea_874.1.blast6.txt.crunch and Ichthyosporea_874.1.blast6.txt.tab We've checked the manual which suggests outfmt 6 with blast+. The mailing list archives didn't have much coverage of blast+. Is there an updated option we need to pass to big_blast.pl or blast+? We've attached a sample of the output we are working with. We've also tried uncommenting the other blast parse from file line 326 to no avail, Perl can't find the blast parsing module used. We would appreciate any insight into how to generate blast+ output suitable for input into ACT. Thanks John ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] [artemis-users] RAST generated gbk file open error
Hi Sheila The output of this looks to be a multiple genbank entries in a single file. Artemis therefore just opens the first contig in the genbank file. Looking at the example you sent me, you can use EMBOSS to create a multiple fasta file: seqret RAST.gbk out.fa and use union¹ to join the contigs together: union -feat -osf RAST.gbk out.embl If you load the multiple fasta sequence (out.fa) into Artemis and then read the output from union (out.embl), File-Read An Entry, then you will see the combined sequence. The advantage of using the multiple fasta is that Artemis will show the separate sequences marked as fasta_record¹ features. Regards Tim On 8/13/12 3:01 PM, Sheila Patrick s.patr...@qub.ac.uk wrote: Hi, When I try to open a genome .gbk file generated using RAST in Artemis I only get the first CDS to load and the following error messages- while reading from HW RAST.gbk: source can't have genome_md5 as a qualifier while reading from HW RAST.gbk: source can't have project as a qualifier while reading from HW RAST.gbk: source can't have genome_id as a qualifier 13 Aug 12:42:56 - BAM VCF not visible Any advice would be welcome! Thanks and best wishes Sheila Chair Society for Anaerobic Microbiology http://www.clostridia.net/SAM/ http://www.clostridia.net/SAM/ We are recruiting up to 20 Clinical Academic and 15 Academic staff in a range of clinical and scientific disciplines. For further information, visit www.qub.ac.uk/sites/QUBJobVacancies/ http://www.qub.ac.uk/sites/QUBJobVacancies/ ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis and multiple (interactive) annotation tracks
Hi Alex You can use db_xref. However Artemis should recognise hyperlinks in any qualifier e.g. /note. Cheers Tim On 4/12/12 9:15 PM, Bossers, Alex alex.boss...@wur.nl wrote: Tim, which FeaTure key would be best to use when wanting hyperlinked db refs? Is there some convention? /db_xref=GI:somenumber? Alex Van: Bossers, Alex Verzonden: woensdag 11 april 2012 22:31 To: Tim Carver; artemis-users@sanger.ac.uk Onderwerp: RE: Artemis and multiple (interactive) annotation tracks Tim, thanks for the rapid reply! I will have a look at the dev version. Sounds interesting. Regarding the blast tracks. What I do is I generate ORFs using gmHMM or prodigal... and blast those in one go limiting 4 hits each. I than postprocess these files into embl annotation files using the ORF prediction location and the blast info... Looks lik the dev will exactly show the 4x annotation feature...hopefully :-) Will experiment with the hyperlinks Cheers Alex Van: Tim Carver [t...@sanger.ac.uk] Verzonden: woensdag 11 april 2012 15:50 To: Bossers, Alex; artemis-users@sanger.ac.uk Onderwerp: Re: Artemis and multiple (interactive) annotation tracks Hi Alex I am not sure of the best way to limit the number of hits to an ORF but you may be interested in a new view which is in development at the moment in Artemis. It displays overlapped features in a 'Feature Stack View'. Currently this is in the development version of Artemis, http://www.sanger.ac.uk/resources/software/artemis/#development. The option can be accessed from the 'Display' menu in Artemis. Artemis does know about some hyperlinked databases defined in the options file: hyperlinks = \ EMBL+SWALL+UniProt+UniProtKB srs_url \ InterPro http://www.ebi.ac.uk/interpro/ISearch?query= \ PlasmoDB http://plasmodb.org/plasmodb/servlet/sv?page=genesource_id= \ Pfam http://pfam.sanger.ac.uk/family?acc= \ SMART http://smart.embl-heidelberg.de/smart/do_annotation.pl?DOMAIN= \ Prosite http://www.expasy.org/prosite/ \ ... You can add this to the end of that list: GI http://www.ncbi.nlm.nih.gov/protein/ so GI numbers (GI:153930843) are then hyperlinked ( http://www.ncbi.nlm.nih.gov/protein/153930843). Regards Tim On 4/11/12 1:49 PM, Bossers, Alex alex.boss...@wur.nl wrote: Hi I am playing around again with multiple annotation tracks in Artemis latest version locally... I managed to get BLAST results in the annotation as well as other EMBL FT. I wondered is it possible to get for let's say a limited BLAST to 4 matches each entry, to display all those 4 as features to for instance an identified ORF? What would be the easiest or best way to accomplish this? Of course loading 4 entries for each sequences is cumbersome... In addition would it be possible to incorporate somehow an embedded link to the blasthit identified protein in ENTREZ? Using the gi this should be possible to create the link, but can it be functional in Artemis? thanks Alex Van: artemis-users-boun...@sanger.ac.uk [artemis-users-boun...@sanger.ac.uk] namens Tim Carver [t...@sanger.ac.uk] Verzonden: dinsdag 13 maart 2012 10:23 To: artemis-users@sanger.ac.uk Onderwerp: [Artemis-users] Artemis and ACT new release The software releases of Artemis (version 14) and ACT (version 11) are now available. The new releases can be downloaded from their home pages: http://www.sanger.ac.uk/resources/software/artemis/ http://www.sanger.ac.uk/resources/software/act/ As well as further optimisations some of the more notable changes are described here: ftp://ftp.sanger.ac.uk/pub4/resources/software/artemis/release_notes.txt -Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis and multiple (interactive) annotation tracks
Hi Alex No that isn't the intended behaviour. This view is still in development so thank you for the feedback. I have changed the code so that all frame line features (not just CDS features) should now be separated out. So you should hopefully then see your 4 BLASTCDS features. This is now available from the development download. Regards Tim On 4/12/12 8:26 PM, Bossers, Alex alex.boss...@wur.nl wrote: Tim, Just played with the latest dev version. Is this normal behaviour? See screendump? I have 4 annotations for one specific location (in this case a BLAST annotation of an ORF). I only see two on the stack view of which the bottem one seems to have an overlay of the other feature but slightly shifted... That is correct since that single one is slightly longer. But I would have expected that features would stack instead of overlap... Did I miss something? Alex On 4/11/12 9:31 PM, Bossers, Alex alex.boss...@wur.nl wrote: Tim, thanks for the rapid reply! I will have a look at the dev version. Sounds interesting. Regarding the blast tracks. What I do is I generate ORFs using gmHMM or prodigal... and blast those in one go limiting 4 hits each. I than postprocess these files into embl annotation files using the ORF prediction location and the blast info... Looks lik the dev will exactly show the 4x annotation feature...hopefully :-) Will experiment with the hyperlinks Cheers Alex Van: Tim Carver [t...@sanger.ac.uk] Verzonden: woensdag 11 april 2012 15:50 To: Bossers, Alex; artemis-users@sanger.ac.uk Onderwerp: Re: Artemis and multiple (interactive) annotation tracks Hi Alex I am not sure of the best way to limit the number of hits to an ORF but you may be interested in a new view which is in development at the moment in Artemis. It displays overlapped features in a 'Feature Stack View'. Currently this is in the development version of Artemis, http://www.sanger.ac.uk/resources/software/artemis/#development. The option can be accessed from the 'Display' menu in Artemis. Artemis does know about some hyperlinked databases defined in the options file: hyperlinks = \ EMBL+SWALL+UniProt+UniProtKB srs_url \ InterPro http://www.ebi.ac.uk/interpro/ISearch?query= \ PlasmoDB http://plasmodb.org/plasmodb/servlet/sv?page=genesource_id= \ Pfam http://pfam.sanger.ac.uk/family?acc= \ SMART http://smart.embl-heidelberg.de/smart/do_annotation.pl?DOMAIN= \ Prosite http://www.expasy.org/prosite/ \ ... You can add this to the end of that list: GI http://www.ncbi.nlm.nih.gov/protein/ so GI numbers (GI:153930843) are then hyperlinked ( http://www.ncbi.nlm.nih.gov/protein/153930843). Regards Tim On 4/11/12 1:49 PM, Bossers, Alex alex.boss...@wur.nl wrote: Hi I am playing around again with multiple annotation tracks in Artemis latest version locally... I managed to get BLAST results in the annotation as well as other EMBL FT. I wondered is it possible to get for let's say a limited BLAST to 4 matches each entry, to display all those 4 as features to for instance an identified ORF? What would be the easiest or best way to accomplish this? Of course loading 4 entries for each sequences is cumbersome... In addition would it be possible to incorporate somehow an embedded link to the blasthit identified protein in ENTREZ? Using the gi this should be possible to create the link, but can it be functional in Artemis? thanks Alex Van: artemis-users-boun...@sanger.ac.uk [artemis-users-boun...@sanger.ac.uk] namens Tim Carver [t...@sanger.ac.uk] Verzonden: dinsdag 13 maart 2012 10:23 To: artemis-users@sanger.ac.uk Onderwerp: [Artemis-users] Artemis and ACT new release The software releases of Artemis (version 14) and ACT (version 11) are now available. The new releases can be downloaded from their home pages: http://www.sanger.ac.uk/resources/software/artemis/ http://www.sanger.ac.uk/resources/software/act/ As well as further optimisations some of the more notable changes are described here: ftp://ftp.sanger.ac.uk/pub4/resources/software/artemis/release_notes.txt -Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE
Re: [Artemis-users] Artemis and multiple (interactive) annotation tracks
Hi Alex I am not sure of the best way to limit the number of hits to an ORF but you may be interested in a new view which is in development at the moment in Artemis. It displays overlapped features in a 'Feature Stack View'. Currently this is in the development version of Artemis, http://www.sanger.ac.uk/resources/software/artemis/#development. The option can be accessed from the 'Display' menu in Artemis. Artemis does know about some hyperlinked databases defined in the options file: hyperlinks = \ EMBL+SWALL+UniProt+UniProtKB srs_url \ InterPro http://www.ebi.ac.uk/interpro/ISearch?query= \ PlasmoDB http://plasmodb.org/plasmodb/servlet/sv?page=genesource_id= \ Pfam http://pfam.sanger.ac.uk/family?acc= \ SMART http://smart.embl-heidelberg.de/smart/do_annotation.pl?DOMAIN= \ Prosite http://www.expasy.org/prosite/ \ ... You can add this to the end of that list: GI http://www.ncbi.nlm.nih.gov/protein/ so GI numbers (GI:153930843) are then hyperlinked ( http://www.ncbi.nlm.nih.gov/protein/153930843). Regards Tim On 4/11/12 1:49 PM, Bossers, Alex alex.boss...@wur.nl wrote: Hi I am playing around again with multiple annotation tracks in Artemis latest version locally... I managed to get BLAST results in the annotation as well as other EMBL FT. I wondered is it possible to get for let's say a limited BLAST to 4 matches each entry, to display all those 4 as features to for instance an identified ORF? What would be the easiest or best way to accomplish this? Of course loading 4 entries for each sequences is cumbersome... In addition would it be possible to incorporate somehow an embedded link to the blasthit identified protein in ENTREZ? Using the gi this should be possible to create the link, but can it be functional in Artemis? thanks Alex Van: artemis-users-boun...@sanger.ac.uk [artemis-users-boun...@sanger.ac.uk] namens Tim Carver [t...@sanger.ac.uk] Verzonden: dinsdag 13 maart 2012 10:23 To: artemis-users@sanger.ac.uk Onderwerp: [Artemis-users] Artemis and ACT new release The software releases of Artemis (version 14) and ACT (version 11) are now available. The new releases can be downloaded from their home pages: http://www.sanger.ac.uk/resources/software/artemis/ http://www.sanger.ac.uk/resources/software/act/ As well as further optimisations some of the more notable changes are described here: ftp://ftp.sanger.ac.uk/pub4/resources/software/artemis/release_notes.txt -Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Edit Menu, adding qualifiers for CDS's
Hi Rudi One way to achieve this would be to select the features you would like to add the qualifier to and then from the Edit¹ menu pick Qualifier of Selected Feature(s)¹ and Change¹. From this window you can add or replace existing qualifiers and their values, so you can add /inference=similar to AA sequence. In that way you can add the same qualifier to multiple features. Regards Tim On 3/29/12 11:29 AM, Rudolf Lütticken rudolf.luettic...@rwth-aachen.de wrote: Dear All, when editing a feature, how (if possible at all) can I change (using Linux OS) the ³options² and/or ³qualifier_types² file(s) to add a new qualifier with a default text already included as in the following example: Instead of inference=²² I would like to have an additional selection in the ³Add qualifier² drop-down menu like inference=²similar to AA sequence² or inference=²similar to AA sequence (same species):UniProtKB:² Does anybody know how to achieve this? Thank you in anticipation of a useful hint! Kind regards, Rudi Luetticken Univ.-Prof. Dr. med. Rudolf Lütticken former Director, Inst. Med. Microbiology, RWTH Aachen c/o DWI an der RWTH Aachen e. V. Forckenbeckstr. 50 52074 Aachen Germany Phone: +49 241 80-23306 Fax: +49 241 80-23301 E-mail: rudolf.luettic...@rwth-aachen.de www.dwi.rwth-aachen.de www.streptococcus.de ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Java web start with Artemis
Hi Preethi There is some general JNLP documentation online if you search for jnlp syntax¹. For Artemis arguments and properties, you may find it useful to download some of the JNLP files on that webpage and start with those. Below is one of these examples. The properties and arguments are the same as they would be for the command line. For example on the command line to open a BAM file (locally or over http) automatically using the Dbam option: -Dbam=http://www.genedb.org/artemis/NAR/Malaria_RNASeq/version2.1.4/MAL_8h.b am It assumes the index file (.bai) is in the same place as the BAM file. This is then defined in the JNLP with as a property: property name=²bam² value=²http://..²/ http://..²/ The sequence and annotation files are loaded as arguments (within argument/argument tags). To open a sequence and a separate annotation file (e.g. art St.dna + St.embl) the plus sign is a separate argument: argumentftp://ftp.sanger.ac.uk/pub/pathogens/st/St.dna/argument argument+/argument argumentftp://ftp.sanger.ac.uk/pub/pathogens/st/St.art/argument To position the Artemis display at a base position the offset¹ can be defined, e.g.: property name=offset value=100800 / If you keep the codebase line the same I think it should download the most current version from the Sanger. Regards Tim ?xml version=1.0 encoding=UTF-8? jnlp spec=1.0+ codebase=http://www.sanger.ac.uk/resources/software/artemis/java/; information titleArtemis/title vendorSanger Institute/vendor homepage href=http://www.sanger.ac.uk/resources/software/artemis// descriptionArtemis/description description kind=shortDNA sequence viewer and annotation tool. /description offline-allowed/ /information security all-permissions/ /security resources j2se version=1.6+ initial-heap-size=32m max-heap-size=800m/ jar href=sartemis_dev.jar/ property name=com.apple.mrj.application.apple.menu.about.name value=Artemis / property name=artemis.environment value=UNIX / property name=j2ssh value= / property name=apple.laf.useScreenMenuBar value=true / property name=offset value=100800 / property name=bam value=http://www.genedb.org/artemis/NAR/Malaria_RNASeq/version2.1.4/MAL_8h. bam,http://www.genedb.org/artemis/NAR/Malaria_RNASeq/version2.1.4/MAL_24h.ba m / /resources application-desc main-class=uk.ac.sanger.artemis.components.ArtemisMain argumentftp://ftp.sanger.ac.uk/pub4/pathogens/Plasmodium/falciparum/3D7/3D 7.latest_version/December_2010/Pf3D7_01.embl.gz/argument /application-desc /jnlp On 3/19/12 7:20 PM, PIRA (Preethi Ramaiya) p...@novozymes.com wrote: Hi I would like to be able to serve up genomes with BAM files as shown in http://www.sanger.ac.uk/resources/software/artemis/ngs/. It is very handy for our end-users to be able to visualize the a NGS alignments in a familiar tool. Is there a how to set up artemis with Webstart and bam files loaded per genome- how do you get from my genome file and the correspond .bam and .bai to the jlnp file that is needed by the web start. its probably obvious but I am new to web-start and would appreciate any help. The server is running Ubuntu with Apache as the web server. It is set up with the right mime types for Java Webstart. Thank you Preethi Best Regards Preethi Ramaiya ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Problems viewing VCF files
Hi Louis You need to read in the bgzip'ed vcf file not the tabix index file. It is expecting a file to be loaded with the suffix .vcf.gz rather than .tbi. It will then automatically look for the index (.tbi) file in the same directory as the VCF file. Regards Tim On 3/17/12 2:48 PM, Louis Grandjean drlouisgrandj...@hotmail.com wrote: Dear All, I'm new to Artemis and have had problems reading in vcf files. I've indexed the vcf files using bgzip and tabix as detailed in the manual and I'm also using the Artemis developer version 14.0. First I load in the reference embl file with no problems then go to File Read VCF and select my .tbi file output from tabix. However nothing appears on the screen. I'm not sure where I'm going wrong. Any help would be gratefully appreciated. Best wishes Louis ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] How to show normalized RNA-seq data?
Hi Qinglu I suspect these two plots are loaded into Artemis as user plots. So they probably generated the plot data with scripts and loaded them via the Graph menu as user plots. For the strand-specific plot you could generate this via the BAM view by separating the strands into separate BAM files, using samtools: Forward: samtools view -bF 0x10 inFile.bam inFileFwd.bam Reverse: samtools view -bf 0x10 inFile.bam inFileBwd.bam Load the forward and reverse BAM files and when you right click on the BAM panel and from the Graph menu select Coverage they will be plotted separately. Regards Tim On 2/26/12 2:29 AM, Qinglu Zeng qin...@mit.edu wrote: Hi Tim, I have two questions: 1. I want to compare different RNA-seq libraries. How can I normalized the coverage to the sequencing depth of each library? Oliver et al (2009 BMC Genomics) did this in Figure 2, but I could not figure out how to do it. 2. How to show a strand-specific coverage plot as Croucher et al (2010 Curr Opin Microbiol) showd in Figure 2d? Thanks! Qinglu ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] error message with artemis
Hi Zeenia This is a warning message. Artemis attempts to match the length of the sequence in the GFF with the sequence lengths in the BAM header. If it doesn't then it gives that message. It may be worth checking the header of the BAM. Regards Tim On 2/17/12 4:21 AM, Zeenia Jagga zee...@icgeb.res.in wrote: Dear Sir, I have generated a alignment file in .bam format(.bam format is sorted and indexed). I am facing problem while viewing it in artemis. 1. loaded reference file in .gff format. 2. From Read BAM/VCF tab, I load .bam file error is generated length of sequence loaded does not match the length of the default reference sequence in the BAM (psu|M76611) but psu|M76611 which is mitochondrial genome of plasmodium is of same length in GFF file and the file from which index of .bam was generated. Plz help to trouble-shoot this issue. Regards, Zeenia Jagga ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] How to save memory
Hi Feifei Artemis is optimised already so that it loads into memory only the reads that are visible in the display, i.e. for the region you are looking at. If you have not already done so you should look at increasing the memory available to Artemis. See below for instructions on how this can be done for each operating system. You may also want to avoid zooming out too much in particularly high coverage regions, although Artemis will switch to a coverage view so less memory is required. Also I would recommend you investigate the read filter options in the BamView window. If you right click on the window with the reads in, there is an option to 'Filter Reads...'. You can then filter by mapping quality for example. Regards Tim For UNIX: - Edit the 'art' script and change the line that looks like: MEM=-mx500m -ms20m Change the first number which specifies the maximum size, in bytes, of the memory allocation pool. Append m indicate megabytes. For windows: Create a shortcut to the Artemis JAR file. Edit the properties of the shortcut and add : java -mx800m -jar to the start of the Target: field. -mx800m sets the maximum memory Java will allocate to Artemis. You will need to use the shortcut to run Artemis from then on. For MacOSX: --- To change the memory allocated to Artemis on MacOSX, set the value in the file Info.plist in the directory Artemis.app/Contents. Towards the bottom of the file there are a couple of lines that look like this: keyVMOptions/key string-Xmx800m/string Changing the value after -Xmx will change the memory used by Artemis. On 9/21/11 9:12 PM, Feifei Xu feifei...@ebc.uu.se wrote: Hi again! We are manually annotating a genome of around 13 Mbases. It's fine to load only GFF3 files. But it's very slow to load the 2.5Gb .bam file of mapped RNA-Seq data. The RNA-Seq is very important for us in manual annotation, so we would very much like it to be loaded into Artemis as well as other GFF3 files of gene calling evidences. Do you have any suggestions of how to save memory? I am also wondering if there is any way to examine only one scaffold at a time in Artemis, which will certainly reduce memory usage. Or is there any way to split the big .bam file into smaller chunks that Artemis will still be happy with? Thanks! Feifei ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Order of attribs in gff3 file
Hi Feifei It seems that we can not guarantee the order. Although I did try label and accession_id on a feature and the order did remain label, accession_id between saving out to separate files. Were you adding new features or annotations on features? Artemis does an auto-save once changes are made. It will backup a file as #filename.gff# unless you use save it out manually from the File menu. Regards Tim On 9/20/11 7:42 AM, Feifei Xu feifei...@ebc.uu.se wrote: Yes. I am using the gff3 file as the base for manual annotation. I am keeping it versioned to keep track of what has been changed. So if there is no way to retain the order of attributes, it's just killing the the version system. So far I managed to retain the order by changing accession_id to something else. But it would be good to know how Artemis saves gff3 files. I need to know if the order will always be retained, or it's just purely random? BTW, is there any way to auto save the gff3 file in artemis? Thanks! Feifei On 19 sep 2011, at 18.01, Scott Cain wrote: Hi Feifei, Is there a reason you want to retain order? The order of attributes should not matter. Scott On Mon, Sep 19, 2011 at 11:11 AM, Feifei Xu feifei...@ebc.uu.se wrote: Hi! Is there any way to conserve the order of the attributes (column 9) in gff3 file? The problem I have now is between the two tags label and accession_id. If I load a version (v1) of gff3 file with label before accession_id, then it will be saved into a new version (v2) of gff3 file with accession_id before label. When I thought that I can live with the order in v2, and tried to save v2 into yet another version (v3), then the order changed back to label before accession_id. It would be great if there is any way to fix the order. I will also try to change the tags, see if that will do. Thanks! Feifei ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- Scott Cain, Ph. D. scott at scottcain dot net GMOD Coordinator (http://gmod.org/) 216-392-3087 Ontario Institute for Cancer Research ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] problem running blast from within Artemis on Linux
Hi Laura This needs to be configured for your site. You will need the databases to be searched set up locally and you may need to edit the Artemis scripts that run blast. There is some documentation in the manual for Configuring the Run Menu¹. The error you get may mean that blastall is not in your PATH. If you are using blast+ you will need to change the script to use legacy_blast.pl. You can test the script from the command line and this is a way of debugging it: etc/run_blastp file_of_filenames database The other option is to use the Run-NCBI searches option. Regards Tim On 8/17/11 8:04 PM, Laura Lorenz lalore...@gmail.com wrote: I am trying to run batch blasts on a genome in Artemis but recieve an error whenever trying to run blast (particularly blastp) from within Artemis. The error is nice:invalid option -- 'd' Try 'nice --help' for more information I assume this means the command after nice ($EXEC) is not specified properly. How do I fix this? Thank you, Laura ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Bitten by multiFASTA annotation bug
Hi Florent Apologies for not getting round to this. It has not been a priority here as the EMBOSS application 'union' does this. I shall try and promote it up the todo list. Regards Tim On 8/1/11 7:28 AM, Florent Angly florent.an...@gmail.com wrote: Hi, I was trying Artemis to view some annotations I have in a multiFASTA and GFF3 file. In my use case, it is not common to have this type of data. I noticed a problem though, in that Artemis assigns all the GFF features to the first sequence in the FASTA file (see attached screenshot). After some research, I found that this issue has been reported 2-3 years ago: http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00468.html http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00401.html Any chance that this will be fixed? Regards, Florent PS/ I attached a subset of the contigs and annotations that illustrate the bug. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Bitten by multiFASTA annotation bug
Hi Florent Actually I need to correct myself. I did fix this for GFF files. If you add the sequence to the end of the GFF file (see attached GFF changes to your example) then it should correctly offset the features to the correct sequence. For other file formats (EMBL, GenBank) this has not been implemented. Regards Tim On 8/1/11 2:47 PM, Tim Carver t...@sanger.ac.uk wrote: Hi Florent Apologies for not getting round to this. It has not been a priority here as the EMBOSS application 'union' does this. I shall try and promote it up the todo list. Regards Tim On 8/1/11 7:28 AM, Florent Angly florent.an...@gmail.com wrote: Hi, I was trying Artemis to view some annotations I have in a multiFASTA and GFF3 file. In my use case, it is not common to have this type of data. I noticed a problem though, in that Artemis assigns all the GFF features to the first sequence in the FASTA file (see attached screenshot). After some research, I found that this issue has been reported 2-3 years ago: http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00468.html http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00401.html Any chance that this will be fixed? Regards, Florent PS/ I attached a subset of the contigs and annotations that illustrate the bug. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users test.gff Description: Binary data ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Search sequence
Hi Shahar You can use the Artemis Navigator under the Goto¹ menu for that. There are options to find base or amino acid strings. Regards Tim On 6/13/11 12:25 PM, Shahar . shahar...@gmail.com wrote: Hello, This is quite basic, but I couldn't figure out how to search for a DNA sequence or an amino acid sequence (in all 6 reading frames) in the loaded genome. Thanks, Shahar ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] problems in visualizing artemis plot
Hi Elena This may mean that the file is not in the correct format for Artemis to read. I would recommend you check the Artemis user manual (³Add User Plot² section) for the supported formats. Alternatively it may be that you just need to turn scaling on by right clicking on the graph window and selecting Scaling¹. ³Nothing selected² means that there are no bases or features selected in the feature display panel. Regards Tim On 5/3/11 5:01 PM, Del Tordello, Elena (Ext) elena.del_torde...@novartis.com wrote: Dear all, I have a problem in loading some artemis file with .dat extension. I load the file through the option add user plot but I cannot see the plot, everything is white and it is written nothing selected. Does anyone know why? Could you give me some advices to solve this problems? Looking forward to have any news, Thanks a lot. Elena ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] BAM in Artemis
Hi Ed Given a BAM file e.g. x.bam the application is looking for the file x.bam.bai in the same directory. It sounds this is the case? If you create the index file with samtools : samtools index x.bam then it will create x.bam.bai. You could try re-creating the index with samtools. Regards Tim On Wed, 20 Apr 2011, Edward Dudley wrote: I'm trying to read a BAM file into Artemis (release 13.0 for Mac), and keep getting an error message that it can't find my bam.bai file. I have 454 reads that were converted to BAM format using Galaxy, and I can visualize the alignment against an E. coli genome using the UCSC browser that is built in. So I downloaded the .bam and index file (which I changed the extension to .bam.bai), and loaded up an E. coli genome into Artemis. When I try to load in the .bam file, I get an error message that says it can't find the .bam.bai. Both files are in the same folder, and except for the extension are saved with identical names. Any suggestions? Thanks. Ed Edward G. Dudley, Ph.D. Assistant Professor of Food Science The Pennsylvania State University 326 Food Science Building University Park, PA 16802 (814) 867-0439 http://www.foodscience.psu.edu/Department/Faculty/Dudley.html ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] annotation and saving problem
Hi, So you constructed the file of genes in Artemis but then you cannot see the annotation when loaded back in? One thing to check is that you have not given it a filename with spaces in the name. Regards Tim On 3/29/11 12:49 PM, Dragica Šalamon salamo...@gmail.com wrote: Hello, everyone! I've just stated using Artemis, and am finding a lot of help using the Cambridge manual and this one: http://www.pseudomonas-syringae.org/Artemis-ACT-NOVA.html#ACT However, I have a big problem when I try to use the chromosome sequence (Ovis aries v.2) with the small annotation file of the few genes that I've constructed using the online tutorial. What ever I do - I can't see the annotation. The other thing is- when I try to save the entry - I just get the blank file. If anyone can set me in the wright way, I'd be s grateful! Thanks! d. -- We are what we repeatedly do. Excellence, therefore, is not an act but a habit. -Aristotle ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Java Web Start on Windows - option file location
Hi Leighton Actually using .artemis_options in the users home directory works on windows, or at least on the windows version I have tried it on here. To find where java thinks the user home directory is there is an application here: ftp://ftp.sanger.ac.uk/pub4/resources/software/artemis/util/JavaSystemProps. jar download and double clicking on this will print out the system properties. One of the properties is 'user.home' which the folder where Artemis should look for the .artemis_options file. I shall update the manual to reflect this. Regards Tim On 3/16/11 11:00 AM, Leighton Pritchard leighton.pritch...@scri.ac.uk wrote: Hi, Historically, of the places Artemis can look for an options file, only two were available on Windows (http://bioweb2.pasteur.fr/docs/artemis/art/options-chapt.html) - one requiring repacking of the artemis.jar file, and the other being to place the file in the folder containing the artemis.jar file. When using the Java Web Start version of Artemis on Windows, we can't really ask users to unpack and repack the artemis.jar file, but we can put an options.txt file in the Downloads folder that contains the artemis.jnlp file - this is a little volatile as a solution, though. On OSX the JWS version reads my .artemis_options file, happily. I may have missed it in the documentation, but is there another way to specify options when using Java Web Start for Artemis on Windows? Cheers, L. -- Dr Leighton Pritchard MRSC Plant Pathology Programme, SCRI (C block) Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA e:lpr...@scri.ac.uk w:http://www.scri.ac.uk/staff/leightonpritchard gpg/pgp: 0xFEFC205C tel: No telephone during office refurbishment [The James Hutton Institute logo] Please note that from 1 April 2011, SCRI and the Macaulay Land Use Research Institute will join to become The James Hutton Institute. __ SCRI, Invergowrie, Dundee, DD2 5DA. The Scottish Crop Research Institute is a charitable company limited by guarantee. Registered in Scotland No: SC 29367. Recognised by the Inland Revenue as a Scottish Charity No: SC 006662. DISCLAIMER: This email is from the Scottish Crop Research Institute, but the views expressed by the sender are not necessarily the views of SCRI and its subsidiaries. This email and any files transmitted with it are confidential to the intended recipient at the e-mail address to which it has been addressed. It may not be disclosed or used by any other than that addressee. If you are not the intended recipient you are requested to preserve this confidentiality and you must not use, disclose, copy, print or rely on this e-mail in any way. Please notify postmas...@scri.ac.uk quoting the name of the sender and delete the email from your system. Although SCRI has taken reasonable precautions to ensure no viruses are present in this email, neither the Institute nor the sender accepts any responsibility for any viruses, and it is your responsibility to scan the email and the attachments (if any). __ ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] launching DnaPlotter with a sequence file
Hi Scott Yes it is template driven, so there is no -f option. You can manually create a template or export a template out from a DNAPlotter session. Example templates can be found in the online manual page: http://www.sanger.ac.uk/resources/software/dnaplotter/#t_3 The template then restores the track information that gets saved to the template. Regards Tim On 2/18/11 6:40 PM, Scott Markel scott.mar...@accelrys.com wrote: I'd like to launch DnaPlotter with a sequence file name. Best I can tell by looking at main() in uk.ac.sanger.artemis.circular.DNADraw, DnaPlotter either reads a template file (indicated by using -t) or launches a wizard, allowing navigation to a sequence file or template. I'm looking for a -f kind of option, where I can indicate the EMBL or GenBank file I want to display. An alternate, two-step approach would be to create a template from the sequence file automatically, e.g., some sort of command-line converter (no user interaction like browsing), and then launch with that template. I checked the mailing list archives but didn't see anything germane. Apologies in advance if I'm missing something obvious. Scott Scott Markel, Ph.D. Principal Bioinformatics Architect email: smar...@accelrys.com Accelrys (Pipeline Pilot RD) mobile: +1 858 205 3653 10188 Telesis Court, Suite 100 voice: +1 858 799 5603 San Diego, CA 92121 fax:+1 858 799 5222 USA web:http://www.accelrys.com http://www.linkedin.com/in/smarkel Secretary, Board of Directors: International Society for Computational Biology Chair: ISCB Publications Committee Associate Editor: PLoS Computational Biology Editorial Board: Briefings in Bioinformatics ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] artemis inside other software
Hi Bernd Thank you for your message. There are command line options for running Artemis and setting various display parameters, e.g. you can open sequences and feature tables from different files from the command line. The options are documented in the user manual. There is no programmer manual for Artemis but the majority of the code is well documented. If you download the software from the Artemis home page or from GitHub you can use the 'Makefile' to generate javadocs. Regards Tim On 2/20/11 8:26 AM, Bernd Jagla bernd.ja...@pasteur.fr wrote: Hi, I just got aware of the Artemis project and am quite excited about it. I am using KNIME (knime.org) a workflow management software that is also JAVA based and develop functionality for using KNIME on NGS and HCA related problems. My questions would be: is it possible to integrate ARTEMIS with other software? Is there an API? Is there a way control what it is displaying from outside the Artemis application (like e.g. IGV)? Can you please give me some pointers on where to start looking for further instructions (beyond the manual) like some introductions for programmers... Please let me know if you have any other suggestions/comments on this project. Kind regards, Bernd ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] launching DnaPlotter with a sequence file
Hi Scott No there is no way to do that other than editing an exiting template. Users tend to open the sequence file from the interface and export the template. If you wanted to get this running with a sequence file you could use a wrapper script to take a copy of a dummy template and makes the changes, something like this (with the attached template): #!/bin/sh seq=$1 DIR=`dirname $seq` FILE=`basename $seq` echo opening $DIR/$FILE sed s|SEQDIR|$DIR| /Users/tjc/Desktop/example1.template ./tmp sed s|SEQFILE|$FILE| ./tmp ./new.template rm -f ./tmp java -jar dnaplotter.jar -t ./new.template Tim On 2/21/11 2:54 PM, Scott Markel scott.mar...@accelrys.com wrote: Tim, Thank you for confirming that sequence files can't be read directly. Is there a common or frequently-used way of creating a template from a sequence file *without* launching DnaPlotter? I'd like the user's first view to be the circular plot. Scott -Original Message- From: Tim Carver [mailto:t...@sanger.ac.uk] Sent: Monday, 21 February 2011 1:32 AM To: Scott Markel; artemis-users@sanger.ac.uk Subject: Re: [Artemis-users] launching DnaPlotter with a sequence file Hi Scott Yes it is template driven, so there is no -f option. You can manually create a template or export a template out from a DNAPlotter session. Example templates can be found in the online manual page: http://www.sanger.ac.uk/resources/software/dnaplotter/#t_3 The template then restores the track information that gets saved to the template. Regards Tim On 2/18/11 6:40 PM, Scott Markel scott.mar...@accelrys.com wrote: I'd like to launch DnaPlotter with a sequence file name. Best I can tell by looking at main() in uk.ac.sanger.artemis.circular.DNADraw, DnaPlotter either reads a template file (indicated by using -t) or launches a wizard, allowing navigation to a sequence file or template. I'm looking for a -f kind of option, where I can indicate the EMBL or GenBank file I want to display. An alternate, two-step approach would be to create a template from the sequence file automatically, e.g., some sort of command-line converter (no user interaction like browsing), and then launch with that template. I checked the mailing list archives but didn't see anything germane. Apologies in advance if I'm missing something obvious. Scott Scott Markel, Ph.D. Principal Bioinformatics Architect email: smar...@accelrys.com Accelrys (Pipeline Pilot RD) mobile: +1 858 205 3653 10188 Telesis Court, Suite 100 voice: +1 858 799 5603 San Diego, CA 92121 fax:+1 858 799 5222 USA web:http://www.accelrys.com http://www.linkedin.com/in/smarkel Secretary, Board of Directors: International Society for Computational Biology Chair: ISCB Publications Committee Associate Editor: PLoS Computational Biology Editorial Board: Briefings in Bioinformatics ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users example1.template Description: Binary data ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT comparisons
Hi Magdalen Sorry to hear you are having trouble with WebACT. I have tried it a couple of times and it is working for me. It may be a temporary glitch or possibly an issue with the size of the sequence. It may be worth trying again? Regards Tim On 2/16/11 3:34 PM, Bossers, Alex alex.boss...@wur.nl wrote: Magdalen, not sure if its supported but we successfully use MUMmer locally (or blast+) to generate the required comparison files. Best wishes, Alex Van: artemis-users-boun...@sanger.ac.uk [artemis-users-boun...@sanger.ac.uk] namens Magdalen Lindeberg [m...@cornell.edu] Verzonden: woensdag 16 februari 2011 15:32 Aan: artemis-users@sanger.ac.uk Onderwerp: [Artemis-users] ACT comparisons After years of using the ³Generate² feature at WebACT http://www.webact.org/WebACT/generate for generating ACT readable comparison files, my recent attempts to generate comparisons with this feature have not been successful (basically, the comparison generator never concludes the job). Fortunately, I can get results with DoubleACT, but the output is not as convenient. Does anyone know if WebACT is still being supported? No one is responding to the ³contact us² link. thanks, Magdalen Magdalen Lindeberg PhD Department of Plant Pathology and Plant-Microbe Interactions 302A Plant Science Building Cornell University Ithaca NY 14853 http://pseudomonas-syringae.org http://www.citrusgreening.org ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] multiple contigs, blast and interproscan
Hi Intikhab Artemis can read in the output from blastall when it is run with the -m 8¹ flag to generate the one line per HSP. It then displays each blast HSP as a separate feature. The blast needs to be run on the single fasta sequence of the contigs (rather than a multiple fasta) so that the coordinates written from blast match each contig correctly. Artemis struggles converting between formats. However you can look at the keys and qualifiers in etc/feature_keys_gff and etc/qualifier_types_gff and add to them if required. Regards Tim On 2/16/11 11:16 AM, Dr. Intikhab Alam intikhab.a...@kaust.edu.sa wrote: Hi, I've got contigs from an assembly where I predicted ORFs and performed blasts against NR, UNIprot etc and also perfomed interproscans. Is there a way to correctly load these results into Artemis? I tried loading all multiple sequences and GFF files with co-ordinates on the genomic context, it always complaints about qualifiers and do not let me load annotations. Is there a list of valid qualifiers so that annotations can be loaded properly? To test I tried an entry from EMBL, loaded into Artimas and saved the entry as GFF. The resulting GFF when loading into Artemas fails that it is not the right format. What is the best way to upload blast and interproscan results for multiple contigs? Any suggestions? Regards, Intikhab ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] DNAplotter for MacOSX
Hi Yealing Thanks again. You are right, restricting the sequence range doesn¹t work in the linear display. If you want to remove the track you can do this from the Track Manager¹ using the Remove¹ buttons on the right. Regards Tim On 11/1/10 2:42 AM, Yealing yealingt+arte...@gmail.com wrote: Thanks, Tim, for the rapid reply. I've did exactly that, removing the tracks in artemis before launching DNAPlotter. But is there a way to ask DNAPlotter not to draw the line for the sequence without any tracks? What I previously meant was that I tried to use the DNA wizard to define start and stop positions. But it only seems to work in circular view and not linear view. E.g. When I have start set to 1000 and stop set to 2000, the circular view displays bases 1000 to 2000, but when I switch to linear view, it shows bases 1 to 2000. Sorry for asking a not-so-clear question before. Thanks again. Regards, -- yealing -- On Fri, Oct 29, 2010 at 4:35 PM, Tim Carver t...@sanger.ac.uk wrote: Hi Yealing Thanks for the feedback. One way to restrict the range on a track is to define it in Artemis first, i.e. delete the features outside a range by first selecting the features in the range (select base range and then select overlapping features) and toggle the selection (under the Select menu). In that way you can temporarily delete the features outside that range and save it to a new file. Or you can filter by a list of gene names (see the first example in the manual http://www.sanger.ac.uk/resources/software/dnaplotter/#t_3) in DNAPlotter. Unfortunately there is no easy way round the arrow head problem but I will try and get time to look at that. Regards Tim On 10/29/10 1:53 AM, Yealing yealingt+arte...@gmail.com mailto:yealingt%2barte...@gmail.com wrote: Hello Tim I've had an experience with the DNA plotter where when I select to view only a certain range of the DNA sequence, it only works on the end range but not the begin range. For example, I have a 10kb DNA sequence and I'm interested to plot features on 5kb-6kb. However, when I set the range at the tracks, it plots from 1bp to 6kb. It works when I only set the begin range, where if I only enter 5000 at begin and nothing for end, it will display tracks from 5kb to 10kb. I wonder if anybody else is having that problem or if it's just me. Also, is there a way to automatically draw the arrow heads according to the directions that we a;ready specify from artemis? When we have a lot of features, it's troublesome to have to go check the direction for each of them and manually pick arrow head or arrow tail. Apologies if the answers can be found in the manual, but since Kajsa was just inquiring about the DNA plotter, I thought I might as well. Thanks and best regards, -- yealing -- On Thu, Oct 28, 2010 at 11:20 PM, Tim Carver t...@sanger.ac.uk wrote: Hi Kajsa The best way to avoid that is to set up the tracks first. The track manager works by filtering the features to display and will refresh them when you click UPDATE. So you should ideally do your editing after you have set the tracks. Regards On 10/28/10 3:59 PM, Kajsa Himmelstrand kajsa.himmelstr...@mykopat.slu.se wrote: Hello, I have a question about the DNAplotter to MacOSX that I got with Artemis v12. The program doesn't seem to work so well. For example, when I do things in the Track Manager, things that I have previously edited disappears. Do you have any better upgraded version without the bugs? It would otherwise be a very good tool for me to use. In other case, is there any other similar program to use while DNAplotter is being upgraded? Best regards from Kajsa ~~~ Kajsa Himmelstrand, PhD Student Swedish University of Agricultural Sciences Department of Forest Mycology and Pathology ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] DNAplotter for MacOSX
Hi Yealing Thanks for the feedback. One way to restrict the range on a track is to define it in Artemis first, i.e. delete the features outside a range by first selecting the features in the range (select base range and then select overlapping features) and toggle the selection (under the Select menu). In that way you can temporarily delete the features outside that range and save it to a new file. Or you can filter by a list of gene names (see the first example in the manual http://www.sanger.ac.uk/resources/software/dnaplotter/#t_3) in DNAPlotter. Unfortunately there is no easy way round the arrow head problem but I will try and get time to look at that. Regards Tim On 10/29/10 1:53 AM, Yealing yealingt+arte...@gmail.com wrote: Hello Tim I've had an experience with the DNA plotter where when I select to view only a certain range of the DNA sequence, it only works on the end range but not the begin range. For example, I have a 10kb DNA sequence and I'm interested to plot features on 5kb-6kb. However, when I set the range at the tracks, it plots from 1bp to 6kb. It works when I only set the begin range, where if I only enter 5000 at begin and nothing for end, it will display tracks from 5kb to 10kb. I wonder if anybody else is having that problem or if it's just me. Also, is there a way to automatically draw the arrow heads according to the directions that we a;ready specify from artemis? When we have a lot of features, it's troublesome to have to go check the direction for each of them and manually pick arrow head or arrow tail. Apologies if the answers can be found in the manual, but since Kajsa was just inquiring about the DNA plotter, I thought I might as well. Thanks and best regards, -- yealing -- On Thu, Oct 28, 2010 at 11:20 PM, Tim Carver t...@sanger.ac.uk wrote: Hi Kajsa The best way to avoid that is to set up the tracks first. The track manager works by filtering the features to display and will refresh them when you click UPDATE. So you should ideally do your editing after you have set the tracks. Regards On 10/28/10 3:59 PM, Kajsa Himmelstrand kajsa.himmelstr...@mykopat.slu.se wrote: Hello, I have a question about the DNAplotter to MacOSX that I got with Artemis v12. The program doesn't seem to work so well. For example, when I do things in the Track Manager, things that I have previously edited disappears. Do you have any better upgraded version without the bugs? It would otherwise be a very good tool for me to use. In other case, is there any other similar program to use while DNAplotter is being upgraded? Best regards from Kajsa ~~~ Kajsa Himmelstrand, PhD Student Swedish University of Agricultural Sciences Department of Forest Mycology and Pathology ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Export annotated Artemis data to CLC Bio
Hi Jack Artemis is not really meant as a conversion tool between formats and in particular EMBL/GenBank to GFF, although it will have a go. You could try EMBOSS (seqret) to convert. However, it sounds like you have multiple fasta records in your file which may cause problems if you are writing out embl files. So you may want to try writing the sequence out (File-Write-All bases). Open this single sequence file and then read your annotation into the sequence entry. Then write out the file as EMBL. Regards Tim On 10/21/10 12:26 PM, Jack van de Vossenberg j.vandevossenb...@science.ru.nl wrote: Addition: For Artemis export to GFF, I changed fasta_record to source, which is a Feature Key in standard nomenclature*, and added the mandatory fields /organism= and /mol_type=, but every time I get a message that the source field cannot be exported. Is that normal behaviour? Can anyone tell what goes wrong? Cheers, Jack * http://www.ebi.ac.uk/embl/Documentation/FT_definitions/feature_table.html On 10/21/2010 10:27 AM, j.vandevossenb...@science.ru.nl wrote: Dear all, I have annotated genome data in Artemis, and I would like to import the result of that annotation into CLC Bio Genomics Workbench (http://www.clcbio.com/). I tried direct import, selected all entries and exported from Artemis to EMBL, Genbank and Sequin. None of these were recognized by CLC, even though it should be able to import many file formats (http://www.clcbio.com/index.php?id=426). I tried SFF, which does not include sequence data. So I used a separate sequence file, the contigs concatenated into one large fasta sequence. CLC has a SFF import filter, which is very picky about the sequence names (read CLC SFF import manual). I managed to let it import SFF, but I did not see any annotation at all, I think because all ORFs are named artemis (gff_seqname artemis). Contig names are lost in SFF, so this option may import all annotated genes, but lose contig info. SFF does not recognize fasta record so I should rename this into something (but what? I tried contig, source, but the GFF file keeps on using ORFs only, all named gff_seqname artemis). Does anyone have experience with this? I thought of using another program as intermediate to convert Artemis data into CLC readable data. Thanks for your help, Jack ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] keyboard commands
For ACT, if you want to use shortcuts (other than edit selected feature) on any of the sequences you need to use the 'ALT' key with the shortcut, e.g. ALT+T to trim to any met. Regards Tim On 9/16/10 10:09 AM, Oscar Franzén oscar.fran...@ki.se wrote: Hi! I'm using ACT to compare three genomes, my problem is that I'm unable to use the keyboard shortcuts for any other genome than the top (first) one. For example, if I want to change start codon for a gene in the second or third genome, then ctrl+t is only working for the first genome. I have figured out that ctrl+shift+e can bring up the edit window for the second genome, and ctrl+shift+alt+e can bring it up for the third, but the corresponding commands for other functions do not work. I'm using ACT in Linux using java 1.6. Thanks in advance, Oscar ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Multiple Bamview plots
Hi Roy If you download the latest development version of Artemis (v12.1.1) you can colour reads for each file differently. So you can then differentiate them by the file. You can set this colour scheme by right clicking on the BamView window and selecting 'Colour By'-'Coverage Plot Colours' (the coverage plots are also separated out). Hopefully this helps. Regards Tim On 7/27/10 6:15 PM, Roy Chaudhuri roy.chaudh...@gmail.com wrote: Hi Tim (and list), I know it is possible to load multiple bam files into the bamview window in Artemis, but this causes reads from all the files to be combined into the same plot. Would it be possible to add an option to display the reads from the different files separately in stacked plots? I've attached a mocked up screenshot to show you what I mean. Cheers. Roy. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Searching for a qualifier?
Hi Lionel You can use the feature selector to locate the pseudogenes. From the 'Select' menu open the 'Feature Selector'. Select the Key and Qualifier (CDS and pseudo) to search for and click the 'View' button. This will list those features with that qualifier in a separate window. You can use that list to select the features and the up and down arrows, on the keyboard, to move the feature display in the Artemis window to each in turn. For ACT, if you want to use shortcuts (other than edit selected feature) on any of the sequences you need to use the 'ALT' key with the shortcut, e.g. ALT+T to trim to any met. Regards Tim On 7/20/10 8:22 AM, Lionel Guy guy.lio...@gmail.com wrote: Hi all, Is there a way to search for the presence of a certain qualifier in artemis? For example, I have pseudogenes in the genome I'm analyzing, and they are tagged in gene features with the qualifier /pseudo (without a value). Is there a way to list them/navigate between them? Another unrelated question: in ACT, is there a way to use keyboard shortcuts (edit, view features, bring the navigator, for example) on another line (i.e. genome) than the first one? I use to have my genome of interest in the middle, to better see the differences with other genomes, but it's a bit annoying not to be able to directly access genes in the one I'm interested in. Any help appreciated! Regards, Lionel ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] using ACT tool with mummer output
Hi Sun-young You can load your own plots into Artemis/ACT. If you look at the section in the manual on the Graph Menu and the sub-section 'Add User Plot...'. This describes the available formats you will need the data to be in. ACT has menus for each of the sequences you load in and you will need to format the user plot so that it is against one of the sequences. However have you just tried zooming out (with the scroll bars on the right of the feature displays) to get the overview of reverse matches? The reverse matches are in blue. You can select them by clicking on them and from the File menu Write the bases of selection. Regards Tim On Sun, 11 Jul 2010, sylee wrote: Dear Tim. Hi, Thank you for your answer and.. I have more questions.. I want to see where reversed matches are and get sequences of there. in main window(loading 2 sequences files, comparison file), I have to move the scroll bar and find where reverse/forward matches are. but if I load a dot-plot file, I can see at a glance, i think.. so I am trying to load the dot plot file. following ACT manual, ACT can read users dot-plot. also, I have a plot file generated MUMmer. when I upload 2 fasta files and comparison file, the menu bars are changed. they have functions for each fasta file I loaded. I have one dot plot file compared two sequence,. 1. where I upload this file? 2. if I upload a dot-plot file generated mummerplot, do I need a parser? (following manual, mummmerplot output is different from users plot format recommended ACT, so I got error message when I upload) 3. if I upload a dot-plot file, can I select a region and get sequences of there? best regards. Sun-young 2010. 6. 28., 오후 4:50, Tim Carver 작성: Hi There are some useful examples on how to parse the output here: http://www.mail-archive.com/artemis-users@sanger.ac.uk/msg00487.html You can get the selected sequence either by going to the View menu and clicking the 'Bases of Selection as FASTA', or from the File menu under the 'Write' option you can write out the bases of selection. Regards Tim On 6/27/10 10:10 AM, sylee 209ab...@gmail.com wrote: Dear Sir/Ma'am Hi, I am trying to view the comparison files using ACT tool. I have been working with MUMmer, and I got the comparison file generated by MUMmer (using NUCmer function - .coords file). as I know, ACT can read the output of MUMmer. however, when loading the comparison file in ACT, I got error message about comparison file format. I don't know which files to use.. Do I need a parser for my MUMmer output files? If so, could you let me know how I can parse them using Python code? (I am not a perl person..so if not a complete code, I cannot use them... ) and, I have a one more question.. using ACT tool, can I get the sequences when I selected a part of comparison region? Thank you very much for your time, Sincerely from Sun-Young Lee - Sun-Young Lee Laboratory of Genomics Genomic Medicine Lee Gil Ya Cancer and Diabetes Institute Gachon University of Medicine and Science Tel : +82 32 899 6545 Fax : +82 32 899 6519 Mobile : +82 19 278 0920 e-mail: sy...@gachon.ac.kr; 209ab...@gmail.com - ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Chado connection Note/note case sensitivity
Hi Leighton At the moment it show /note and /comment in database mode. I will look at making it use /Note as well. For now you can change it manually by right clicking on the feature list and using the 'Show Selected Qualifiers ...' option to add the Note qualifiers. Regards Tim On 6/2/10 2:39 PM, Leighton Pritchard lpr...@scri.ac.uk wrote: Hi, Using Artemis 12.0 with Chado, and uploaded GFF3 data, I've noticed that the /note tag/value is not being presented in the feature table at the bottom of Artemis. Locally, we're sticking to the GFF3 specification (http://www.sequenceontology.org/gff3.shtml), which reserves /Note as a tag/value pair with a predefined meaning - the tag /note isn't reserved in this way, and we're not using it. Artemis appears to be case sensitive when reading feature tags for presentation in the feature table, and our /Note data is not being shown - is there a way to make Artemis either case-agnostic, or (set by an option somewhere?) to conform to the GFF3 spec? Thanks, L. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Hide forward and reverse frame lines
Hi Shahar No there isn¹t an option for this in the options file. If it would be useful I can add the options : show_forward_lines and show_reverse_lines so that these can be controlled from the options file. This would control both the zoomed out and zoomed in feature displays. Regards Tim On 5/24/10 1:53 PM, Shahar . shahar...@gmail.com wrote: Hello, Is it possible to hide the forward and reverse frame lines both in the overview and DNA view windows by default? Thanks, Shahar ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis-users post from jocelyne....@epfl.ch requires approval
Hi Jocelyne If you use the 'Find/Replace Qualifier Text' option under the Edit menu this should hopefully help. Regards Tim From: Lew Jocelyne jocelyne@epfl.ch Date: Tue, 16 Feb 2010 18:35:30 +0100 To: artemis-users@sanger.ac.uk artemis-users@sanger.ac.uk Conversation: search by key in Artemis Subject: search by key in Artemis Hello, I would like to search all keys for something in a specific qualifier. Is this possible? It seems I need to pick only one key, and if I leave it blank, there are zero results found. Thank you, Jocelyne ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Viewing next gen sequence reads on artemis
Hi Tony If you look at the BamView website: http://bamview.sourceforge.net/ Under the 'Generating a BAM' tab there are examples there. This command should sort the BAM for you: samtools sort file.bam file.sort.bam This command will produce the index (.bai) file: samtools index file.sort.bam The index file needs to be in the same directory as the BAM file and you do need to be running Artemis with Java 1.6. Regards Tim On 2/3/10 1:34 AM, Tony Barbet abar...@nersp.nerdc.ufl.edu wrote: Tim, Re-this thread: We have generated a BAM file of 454 reads aligned with a reference sequence using the latest version of Mosaik software, but I am unclear on the exact Samtools commands that would convert this into a BAM file suitable for Artemis (sorted and indexed). Is there some info on this? Thank you for your help. Regards, Tony Barbet Tim Carver wrote: Hi Gowtham Have a look at BamView. http://bamview.sourceforge.net/ This is integrated into Artemis and can be found in the Artemis development version (which is available from the above link as well as the Artemis home page) and will be in the next release. Regards Tim On 1/26/10 8:07 PM, Gowthaman Ramasamy gowthaman.ramas...@sbri.org wrote: Hi Tim, I am trying to see if we can use artemis to display aligned illumina reads against a chromosome. I know we can make user plot and display coverage information. But wondering is there a way to display the reads themselves (nt seq). Gowtham ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Viewing next gen sequence reads on artemis
Hi Gowtham Have a look at BamView. http://bamview.sourceforge.net/ This is integrated into Artemis and can be found in the Artemis development version (which is available from the above link as well as the Artemis home page) and will be in the next release. Regards Tim On 1/26/10 8:07 PM, Gowthaman Ramasamy gowthaman.ramas...@sbri.org wrote: Hi Tim, I am trying to see if we can use artemis to display aligned illumina reads against a chromosome. I know we can make user plot and display coverage information. But wondering is there a way to display the reads themselves (nt seq). Gowtham ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT, transfer annotations
Hi Kajsa Unfortunately there is no tool in ACT to do this with flat files. With the database version of Artemis and ACT there is a transfer annotation tool: http://www.sanger.ac.uk/Software/Artemis/v11/chado/overview.shtml#TAT that can be used. I suspect what you are looking for is a bulk annotation transfer based on cut-offs which isn't available. Regards Tim On 1/21/10 3:12 PM, Kajsa Himmelstrand kajsa.himmelstr...@mykopat.slu.se wrote: Hello, I am a new ACT-user. Do any of you know if it is possible to transfer annotations from one sequence to the other comparing sequence in an easy way in ACT? Thank you/ Kajsa ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Command line option to load data file for ACT
Hi Gowtham, You can use something like this: act seq1.embl seq1_v_seq2.comparison seq2.embl for an additional comparison: act seq1.embl seq1_v_seq2.comparison seq2.embl \ seq2_v_seq3.comparison seq3.embl so you can keep adding seqeunce and comparisons files. You would need to combine the sequence and annotation files for each into one file. Regards Tim On Mon, 28 Dec 2009, Gowthaman Ramasamy wrote: Hi Tim, I have a question about loading the files into ACT on command line. Without using file browser. Here is what I am trying to do. I would like to compare 5 genomes each having 35+ chormosomes. Some has more contigs. When the user want to see a gene in a reference genome I want to fire up ACT, with all the 5 genomes and their comparison files. I have a perl script which finds out the syntenic chromosomes and does a tblastx to make ACT compatible blastout files for all the 5 genomes. Now wondering is there an command line option so that I can automate the loading of all the information in to ACT. To avoid user loading 5 genome files, 5 annotation files and 3 comparison files everytime. Thanks very much for the time Happy Holidays. Gowtham ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT is sluggish...
Hi Kenneth To increase the memory on MaxOSX, you edit this file in the ACT application directory: ACT.app/Contents/Info.plist Towards the bottom of this file there is a line that looks like: string-Xmx512m/string This is the memory limit that you can increase. Regards Tim On 8/7/09 10:49 AM, Kenneth Benex kbe...@gmail.com wrote: Hello, I'm using Artemis and ACT on MacOS X. When I run Artemis, it works just fine... However, when I run ACT (comparing a couple hundred genes to a 24 Mbp genome), it runs super sluggishly. Whether I zoom in or out, or I scroll, or even just clicking on something... it takes forever to respond. I've read in the FAQ about increasing the memory limit, but I can't figure out how to do so... Can you help me out for this? Thanks! Kenneth ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Configuring Blast with webstart Artemis
Hi Gowthaman It can be done. You would need to unwrap your jar file and edit the run scripts that are in that. Then jar the contents back up. Alternatively, in the Artemis cvs there is a Makefile that can be used to make the jar files with: gmake jar Regards Tim On Tue, 24 Mar 2009, Gowthaman Ramasamy wrote: Hi All, I am able to configure my local Artemis installation to work with blast and local database. But, wondering, Can the same thing be done with web start artemis also. I understand, the path for the database can be set with RUN menu set options. How can I make it see the blastp and run_blastp scripts.. Thanks very much in advance, Gowthaman SBRI On 3/18/09 3:35 AM, Tim Carver t...@sanger.ac.uk wrote: Hi Rob You can find documentation for setting up blast/fasta and the databases in the Readme.txt in the MacOSX distribution. You can then edit the run_blast* scripts in Artemis.app/Contents/artemis/etc and options file if required as per the documentation in the manual: http://www.sanger.ac.uk/Software/Artemis/v11/manual/runmenu.html Regards Tim On 3/17/09 9:25 PM, Rob Good rtg...@unimelb.edu.au wrote: Can someone please point me to a link that will tell me how to configure run_blast, etc options for Macosx artemis. Rob Good Ph. +61 3 8344 2347 Genetics Dept University of Melbourne PARKVILLE, Australia ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Configuring Blast with Mac Art 11
Hi Gowtham It sounds like it is trying to run searches via a SSH connection. In the options menu in the initial window that opens check that the option to send searches via ssh is unchecked. Regards Tim On Tue, 24 Mar 2009, Gowthaman Ramasamy wrote: That's Cool, Tim. Thanks. As mentioned in my earlier email I made blast to work under Linux Art11. Before I move to webstart and Jar files, I wanted to configure blast with Mac Art11. I did edit my run_blastp file under the etc directory and it works very well with command line. But, When I try to run it from main Artemis window, it is asking for login details (of what? The system?). But, it does not run blastall really. I don't see any output. Where am I going wrong? Any hints Tim?. I am attaching my run_blastp script hereonly change I made is for EXEC. For the database, I am giving the full path in the RUN-set menu option. That's how I did for my linux-Art11. Thanks once again for the reply, I really appreciate it. Gowtham SBRI (/run_blastp /Users/gramasamy/work/localartWD/blastp/blastp_file_of_filenames.4 /Applications/artemis/Artemis.app/Contents/blast-data/uniprot) Command line: works great, although complains as following..but does the JOB Error seen: Fatal server error: Server is already active for display 0 If this server is no longer running, remove /tmp/.X0-lock and start again. AbortDDX Quitting Xquartz... On 3/24/09 11:09 AM, Tim Carver t...@sanger.ac.uk wrote: Hi Gowthaman It can be done. You would need to unwrap your jar file and edit the run scripts that are in that. Then jar the contents back up. Alternatively, in the Artemis cvs there is a Makefile that can be used to make the jar files with: gmake jar Regards Tim On Tue, 24 Mar 2009, Gowthaman Ramasamy wrote: Hi All, I am able to configure my local Artemis installation to work with blast and local database. But, wondering, Can the same thing be done with web start artemis also. I understand, the path for the database can be set with RUN menu set options. How can I make it see the blastp and run_blastp scripts.. Thanks very much in advance, Gowthaman SBRI On 3/18/09 3:35 AM, Tim Carver t...@sanger.ac.uk wrote: Hi Rob You can find documentation for setting up blast/fasta and the databases in the Readme.txt in the MacOSX distribution. You can then edit the run_blast* scripts in Artemis.app/Contents/artemis/etc and options file if required as per the documentation in the manual: http://www.sanger.ac.uk/Software/Artemis/v11/manual/runmenu.html Regards Tim On 3/17/09 9:25 PM, Rob Good rtg...@unimelb.edu.au wrote: Can someone please point me to a link that will tell me how to configure run_blast, etc options for Macosx artemis. Rob Good Ph. +61 3 8344 2347 Genetics Dept University of Melbourne PARKVILLE, Australia ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Configuring options for blast, etc for v11 on macosx
Hi Rob You can find documentation for setting up blast/fasta and the databases in the Readme.txt in the MacOSX distribution. You can then edit the run_blast* scripts in Artemis.app/Contents/artemis/etc and options file if required as per the documentation in the manual: http://www.sanger.ac.uk/Software/Artemis/v11/manual/runmenu.html Regards Tim On 3/17/09 9:25 PM, Rob Good rtg...@unimelb.edu.au wrote: Can someone please point me to a link that will tell me how to configure run_blast, etc options for Macosx artemis. Rob Good Ph. +61 3 8344 2347 Genetics Dept University of Melbourne PARKVILLE, Australia ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Bug: crash when loading GFF3 containing multiple sequences
Hi Torsten Thanks for that. I have fixed that and I hope to get that in the development version in the next few days. However, there is still a problem that has been mentioned before on the list in that Artemis does not yet take into account column 1 in GFF3 (the ID of the landmark used to establish the coordinate system). This means feature positions that are not on the first sequence are wrong. I hope to get this fixed soon as well. Regards Tim On 3/11/09 12:28 AM, Torsten Seemann torsten.seem...@infotech.monash.edu.au wrote: I've been migrating most of my software/scripts over to GFF3, and have encountered a possible bug with Artemis (v11) on Linux x86_64. When the GFF3 has multiple sequences in the ##FASTA section, Artemis dies with: Exception in thread AWT-EventQueue-0 java.lang.ClassCastException: uk.ac.sanger.artemis.io.EmblStreamFeature at uk.ac.sanger.artemis.io.GFFDocumentEntry.combineGeneFeatures(GFFDocumentEntry. java:166) at uk.ac.sanger.artemis.io.GFFDocumentEntry.init(GFFDocumentEntry.java:75) However, if i REMOVE the region1 sequence so there is only the one Seq sequence, all is ok. The extra sequences in the ##FASTA section are commonly used to store CDS translations, or when the GFF covers lots of sequences eg. contigs in an assembly. I have attached a .GFF3 file which causes this (and inlined it below for completeness). ##gff-version 3 Seq vbc region 20 60 . + . ID=region1;product=Junk DNA ##FASTA Seq ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT GC region1 GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATG Thank you. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] vector graphic
Hi Daniel Under the File menu there is a Print option. From there you should be able to get it to print a postscript file. Regards Tim On 3/16/09 12:21 PM, Daniel Herlemann herle...@mpi-marburg.mpg.de wrote: Is there a possibility to export the screens as vector-graphic (pdf, ps, eps)? Best Daniel ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis can't read Chado database
Hi Björn
I have just added some documentation that describes loading in two examples
one of these is the one you have used (NC_008783):
http://www.sanger.ac.uk/Software/Artemis/v11/chado/dbloading.shtml
I did not experience the problem you seem to have with feature types.
However I had to manually add 'processed_transcript' to the SO CvTerm.
I am not sure what feature types = 1 is in you case but Artemis currently
only looks at these types to build the database manager for features that
contain residues that can be launched:
%chromosome%
%sequence%
supercontig
ultra_scaffold
golden_path_region
contig
It may be better to try to fix the feature types problem you had and then
reloading.
Regards
Tim
On 2/24/09 5:41 PM, Björn Nystedt bjorn.nyst...@ebc.uu.se wrote:
Hi,
I am trying to set up a GMOD chado database to read/write using Artemis. I
admit not being a very experienced database user, so maybe I am missing
something obvious. Anyway.
I start Artemis using
art -Dchado=localhost:5432/annotation?bjorns
-Djdbc.drivers=org.postgresqlver -Dibatis
and feeds my database password.
This appear to work ok in the sense that there are no error messages. However,
in the database list at the top left, there is only an unnamed folder, and
clicking this folder nothing happens except an error appears in the terminal
'Exception in thread AWT-EventQueue-0 java.lang.NullPointerException
...'
*GMOD
The database I am using is a postgresql (v8.1.16, as I understand there was a
problem with gmod and v8.3?), setup with the GMOD schema (gmod-1.0, from
http://www.postgresql.org/download/):
perl Makefile.PL
make
sudo make install
make load_schema
make prepdb
make ontologies
This appear to work as far as I can decide.
* TEST DATASET
A test dataset was loaded into the database by first manually setting the
organism:
INSERT INTO organism (abbreviation, genus, species, common_name,
organism_id) VALUES ('B.bacilliformis', 'Bartonella', 'bacilliformis', 'BB',
8783);
then converting a genbank file to gff and load the gff data into the database
perl bp_genbank2gff3.pl NC_008783.gbk --noCDS -o .
gmod_bulk_load_gff3.pl --organism 'BB' --noexon --gfffile
NC_008783.gbk.gff --recreate_cache
After the upload the database does contain data that makes sense as far as I
can tell, and it is possible to backup the database. (There is for some reason
a problem with feature types in gmod_bulk_load_gff3.pl: for now I made an ugly
hardcoding to set all feature types = 1. line755)
Any idea on how to get Artemis to find the data in the database is
appreciated!
Best
Björn Nystedt
___
Artemis-users mailing list
Artemis-users@sanger.ac.uk
http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] multiple fasta sequence files and feature
Hi Malcolm I think the normal trick is to create a single fasta from Artemis by File-Write-All Bases-FASTA format. This then gets them on the correct coordinate system for your query. The GFF multiple contig thing is a problem. It only really copes with a single sequence. I haven't loaded GFFs into chado that have multiple contigs and tried it with Artemis. However we do plan on soon being able to handle that sort of situation and concatenate contigs together. Regards Tim On 2/26/09 3:58 PM, Cook, Malcolm m...@stowers.org wrote: I read in the artemis manual about the feature keys 'fasta_record' or 'contig' (which are) create when a multiple fasta sequence file is read in. Indeed this works - I am able to load such a fasta file holding multiple 300 contigs generated by an assembly. However, I find that when I load extenrally generated blast results where the subject (or query) sequences are the same contigs, the blast table (-m 8) when loaded into Artemis are not (re)interpreted with respect to the appropriate contig. Similarly, if I load externally generated GFF features (i.e. output from exonerate and fgenesh) that have the my same contig identifiers in column 1, they are not applied to the corresponding contig, but rather to what appears to be a single entry gained by linearizing/concatenatig the individual reads. Is there some way I should be using Artemis to allow loading multiple contigs and corresponding annotation of each contigs for simultaneous visualization? Perhaps I should rather be loading a Chado database and performing annotation against it? Andy advice in using Artemis toward my end of allowing manual curation of annotation of upwards of 300 contigs would be welcome. Thanks! Malcolm Cook Stowers Institute ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
[Artemis-users] Artemis and ACT new releases
The Pathogen Genomics Group at the Sanger Intitute are pleased to announce the next major software release of Artemis (version 11) and ACT (version 8). The new releases can be downloaded from their home pages: http://www.sanger.ac.uk/Software/Artemis/ http://www.sanger.ac.uk/Software/ACT/ Some of the more notable changes are described here with links to the documentation: http://www.sanger.ac.uk/Software/Artemis/v11/index.shtml#changes Regards Tim Carver ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis output and default options
Hi Santiago 1) Is it possible to save the textual summary at the bottom of main Artemis edit window as a text file with tab delimited fields? If you right click on the feature list at the bottom then you get a popup menu with the option Save List To File This will save a space delimited file. 2) How can the default Artemis options be modified in order to keep changes through different sessions? There are some options that can be set in the options file: http://www.sanger.ac.uk/Software/Artemis/v11/manual/options-chapt.html 3) I could never use the option at the main menu Create Feature from base range . After adding any qualifier from the popup menu the following message always shows up: Cannot apply changes because of a qualifier error: failed to read a qualifier name from this string This sounds like a problem on windows in an old development version. Can you try the latest version of Artemis? Regards Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] j2ssh.properties File on Windows
Hi Chris The easiest thing to do is unwrap the jar and replace it with the file in lib/j2ssh/j2ssh.properties. It is used here to tunnel from windows machines and set off BLAST searches. Regards Tim On 1/16/09 3:44 PM, Chris Friedline cfriedl...@vcu.edu wrote: Hello all, We would like to be able to submit our BLAST searches from remote clients running Artemis to shared Linux server over SSH. The configuration of the j2ssh.properties file on our Linux clients is straightforward enough, but how to we modify this properties file for the Windows clients? I assumed that by putting this file in the same directory as the Artemis_v10.jar file and manually setting the CLASSPATH via a batch file would do the trick, but the settings do not show up properly when starting Artemis on the Windows clients (as reflected by host name, port #, etc). Is what I want to do possible from a Windows client using the jar? Thanks, Chris ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Configure Run window
Hi Aparna To be able to run blast you need to download blast and set up and format your databases. You add the database to the Run menu by editing 'etc/options' and you need to edit the associated run_blastp/run_blastn script for your site. (This means that you need to running this on a UNIX platforrm.) There is documentation at: http://www.sanger.ac.uk/Software/Artemis/v10/manual/runmenu.html#RUNMENU-CONFIGURATION The best way to test the script is to intially run it from the command line as described. Regards Tim On Fri, 19 Dec 2008, Aparna Pallavajjala wrote: Hi Can any one give me a format to set the blast commands(run_program.sh files ) in 'Run' window? Thanks in advance, Aparna _ Send e-mail anywhere. No map, no compass. http://windowslive.com/oneline/hotmail?ocid=TXT_TAGLM_WL_hotmail_acq_anywhere_122008 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] opening a gff file - log4j issue
Hi Gareth Those are warnings that can be safely ignored. Have you tried increasing the maximum memory it can use? Look for the line beginning 'MEM=' in the art run script. Are there any message written to the terminal window? Regards Tim On 19/11/08 17:11, Gareth Bloomfield [EMAIL PROTECTED] wrote: Hi, I'm trying to open some gff files using release 10 (in linux), and getting the messages... log4j:WARN No appenders could be found for logger (uk.ac.sanger.artemis.io.GFFStreamFeature). log4j:WARN Please initialize the log4j system properly. ... then it hangs. I don't have anything about uk.ac.sanger.artemis.io.GFFStreamFeature in my artemis/etc/log4j.properties file - should I? Any hints would be very gratefully received. Thanks, Gareth ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] opening a gff file - log4j issue
Alternatively this may be a problem with it producing an extremely long dialog (if there are qualifiers/keys it doesn't recognise) that you cannot click away. This is a problem that is fixed in the development version that you can get from: http://www.sanger.ac.uk/Software/Artemis/#development Tim On 19/11/08 17:17, Tim Carver [EMAIL PROTECTED] wrote: Hi Gareth Those are warnings that can be safely ignored. Have you tried increasing the maximum memory it can use? Look for the line beginning 'MEM=' in the art run script. Are there any message written to the terminal window? Regards Tim On 19/11/08 17:11, Gareth Bloomfield [EMAIL PROTECTED] wrote: Hi, I'm trying to open some gff files using release 10 (in linux), and getting the messages... log4j:WARN No appenders could be found for logger (uk.ac.sanger.artemis.io.GFFStreamFeature). log4j:WARN Please initialize the log4j system properly. ... then it hangs. I don't have anything about uk.ac.sanger.artemis.io.GFFStreamFeature in my artemis/etc/log4j.properties file - should I? Any hints would be very gratefully received. Thanks, Gareth ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Possible EOL issue with user plots?
Hi Nicole This may well be just Artemis running out of memory. It has to read in the entire file and it is likely that it may be running out of memory before it can display the data. I have changed the code so that it will warn you if this happens this will appear in the next release of Artemis. I would recommend you try increasing the memory allocated to Artemis on your machine. Have a look at FAQ no. 4 to on increasing memory: http://www.sanger.ac.uk/Software/Artemis/faqs.shtml#tips Regards Tim On 2/11/08 03:55, Nicole Cloonan [EMAIL PROTECTED] wrote: Hello, I have started using Artemis for the first time as a way to overlay next-gen sequencing data onto annotated bacterial genomes. It has the capability of doing everything that I need it to do, but I am having trouble with my own custom user plots. It is probably something that I am doing wrong, but I just can't seem to figure it out on my own! Any clues would be greatly appreciated. I am using Artemis 10 standard release, with Java 6 update 10, on Window XP professional SP 2, fully updated. Artemis appears to be working well. To confirm this I downloaded the supplementary data from http://www.biomedcentral.com/1471-2164/9/364, and I was successfully able to open and view the custom user plots on the provided gbk file. However, I am unable get my own custom user plots to be successfully opened in Artemis. I am creating these on a separate machine (running RHEL 5), copying the space delimited format seen in the above data set. I do not get any error messages, the plots just don't display. I think this might be an EOL/encoding issue because if I attempt to modify the user plots downloaded above (using either word, notepad, wordpad, or excel but saving as text), then these also fail to load. I have tried without success: * renaming the file * unix2dos before binary transfer to the windows box. * unix2dos before ascii transfer to the windows box. * opening the file using windows/word/notepad/excel and pasting/saving to a new text file. According to the file program on unix, the downloaded data and the post unix2dos custom data have the same encoding, so I don't really know where to go from here. I have been through Google, and through the archives for this mailing list without success - so either I am doing something completely moronic, or no one else in the world is having this issue! Any help/suggestions/flames (do people still say flame? =) ) would be greatly appreciated. I need to get this working on a Windows system, because that's what the end users of this data will be using. Cheers, Nicole. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Performance problem generating gene names
Thanks Keith. This is fixed now in the development version. Tim On 30/10/08 12:55, Keith James [EMAIL PROTECTED] wrote: I'm trying to add gene names using the automatically create gene names function under the edit menu. Here's the process: 1. Select 4550 CDS features using the feature selector and choose to view them. 2. In the view, select all and choose automatically create gene names from the Edit menu. Answer yes to everything, except to adding a 'c' to complementary features. 3. Wait... On release 9 this locked up Artemis (no component painting) for 30 minutes before I killed it. Release 10 is better in that the paint thread is still working, but after 30 minutes the job is not done. I attached a profiler and most of the time is being spent in autonaming and autosaving. I wonder is there is some sort of bad interaction between the automatic edits and the autosaver? Here's the two relevant chunks of profiler output: Method: uk.ac.sanger.artemis.components.EditMenu$27.actionPerformed(java.awt.event.Act ionEvent) Hits : 36 Total : 12273896.4ms Method: uk.ac.sanger.artemis.components.EditMenu.autoGeneName() Hits : 36 Total : 12273895.7ms Local : 0.0ms Method: uk.ac.sanger.artemis.components.EditMenu.autoGeneNameHelper(uk.ac.sanger.artem is.FeatureVector,java.lang.String,int,int,java.lang.String,boolean,int) Hits : 36 Total : 11734965.5ms Local : 0.0ms Method: uk.ac.sanger.artemis.Feature.addQualifierValues(uk.ac.sanger.artemis.io.Qualif ier) Hits : 1043 Total : 975571.2ms Local : 0.0ms Method: uk.ac.sanger.artemis.Feature.setQualifier(uk.ac.sanger.artemis.io.Qualifier) Hits : 1043 Total : 974744.6ms Local : 0.0ms ... Method: uk.ac.sanger.artemis.io.DocumentEntryAutosaveThread.run() Hits : 36 Total : 11733928.6ms Local : 0.0ms ... ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] resolution of Print Image Files
I did add this option to ACT as well. This is in the development version. This can be downloaded from the ACT home page under the Development section. Regards Tim On 5/9/08 11:37, Ariel Amadio [EMAIL PROTECTED] wrote: Is this implemented in ACT too? I´m preparing some figures for publication, and it would be really helpful. Cheers - Original Message Follows - From: Derek Gatherer [EMAIL PROTECTED] To: artemis-users@sanger.ac.uk Subject: Re: [Artemis-users] resolution of Print Image Files Date: Fri, 05 Sep 2008 08:32:59 +0100 Thanks Tim This should certainly be helpful. For the journal currently in question, I redid my figures so that I didn't need to add any extra stuff (eg. arrows, text etc that was going on after the initial image capture), and could just present the raw Artemis export as a figure. This seems to have got me through to the next stage of proof preparation at least! Cheers Derek At 14:57 03/09/2008, Tim Carver wrote: Hi Derek, I have added File-Print, so that you can create PostScript files now. (I did look at other options to improve dpi but I think this would require extra image I/O libraries.) I have updated the Development version on the Artemis home page to include this. Regards Tim On 25/8/08 09:53, Michael Nuhn [EMAIL PROTECTED] wrote: Hi, Derek! Does anybody have any tips/experience in preparing figures for publication from Artemis? I make screenshots from artemis and paste them into Photoshop. Then I can save them in any format I like. Once I tiled two screenshots from neighbouring regions together in Photoshop. It's lame but it works. HTH, Michael. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ³El contenido del presente e-mail y sus posibles adjuntos, pertenecen al INTA y puede contener información confidencial. Si usted no es el destinatario original de este mensaje y por este medio pudo acceder a dicha información, por favor solicitamos contactar al remitente y elimine el mensaje de inmediato. Se encuentra prohibida La divulgación, copia, distribución o cualquier otro uso de la información contenida en el presente e-mail por parte de personas distintas al destinatario.² This e-mail contents and its possible attachments belong to INTA and may contain confidential information. If this message was not originally addressed to you, but you have accessed to such information by this means, please contact the sender and eliminate this message immediately. Circulation, copy, distribution, or any other use of the information contained in this e-mail is not allowed on part of those different from the addressee. Antes de imprimir este mensaje, asegúrese de que es necesario. Proteger el medio ambiente está también en su mano. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] problem with zooming in/out in ACT
Hi Marcus It may help for larger sequences/comparisons to increase the memory you allow ACT to use. If you are using the 'act' script to run it the change the MEM line which will look something like this: MEM=-mx500m -ms20m Regards Tim On 17/7/08 12:31, Marcus Claesson [EMAIL PROTECTED] wrote: Hi there, I have a small but quite annoying problem with zooming in and out in the latest ACT (v7) version. Even when very carefully clicking on the up/down arrows on the scale-changing scrollbar to the right in the DNA view, the scale quickly shoots off, way further then I intended. To get the size/scale I want is almost impossible. I experienced this in earlier ACT versions as well and wonder if there is a remedy. Thanks in advance! Marcus ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT and more than two genomes
Hi Stefanie For 3 genomes you need 2 comparison files. In the file requestor window the more files...¹ button expands the window to allow more sequence and comparison files to be given as input: http://www.sanger.ac.uk/Software/ACT/v7/manual/launch-window.html Regards Tim On 23/6/08 08:06, Stefanie Lager [EMAIL PROTECTED] wrote: Hi, How do I use ACT with more than two genomes? In the ACT Examples and Screen shots, there are pictures of three genome comparisons. I can do two Blast searches against one reference genome and merge the tables. But how do I open three genomes? Regards, Stefanie ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] multiple contig reading problem
Hi Chris You need to use something like the EMBOSS application 'union'. Separate them into individual EMBL files and concatenate them into a single EMBL entry file (use the -feature option and -sformat embl). Regards Tim On 20/3/08 15:18, Chris Knight [EMAIL PROTECTED] wrote: I am having difficulties opening an EMBL file in Artemis: The file in question contains a single genome divided into several hundred contigs. These contigs are listed in the file I have as separate entries, each with a separate sequence (SQ) entry- I'd like to read them all in (and have them appear as separate contigs), however I can only persuade Artemis to read the first contig. The separation between the contigs at present is a line containing only two forward slashes between the end of the preceding contig's sequence entry (SQ section) and the beginning of the next contig (ID section). I've tried manipulating the file with Readseq v 2.1.26, which will happily output everything to fasta format, which allows me to read all the contigs into Artemis correctly. However, I then lose the annotation in the embl file. Readseq will separate out the annotation into a separate .fff file (by using -unpair=1), however, this file is in gff format v2 and it doesn't seem to read in as an entry into artemis which wants gff v3 (or rather the file reads, but appears as an empty entry). Apologies if I've missed something obvious, but any help much appreciated, Thanks, Chris I'm using Artemis release 10 on a Mac running OSX 10.5.2 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] v9
Hi Melanie, The warning message you get is referring to running an external program to Artemis (rather than an external site). You can ignore it or change etc/log4j.properties¹ and remove the #¹ at the start of the line: log4j.logger.uk.ac.sanger.artemis.ExternalProgram=DEBUG, R To get error messages open the Show Log Window¹ in the Options¹ menu in the initial start up window in Artemis. It may prove easier to debug the script by running it from the command line, e.g.: etc/run_blastp blastp/blastp_file_of_filenames.18 %U For the control+V problem, I haven¹t seen that before. What flavour of UNIX are you using and what version of Java? You could try getting the latest Java if you haven¹t already. Regards Tim Carver On 20/2/08 08:57, Duffield Melanie L [EMAIL PROTECTED] wrote: Hi, I am trying to get Artemis v9 set up on a networked Unix computer (or at least co-ordinate with our IT people to do this). I have it running locally on a stand-alone but we want to make it more widely available. I now have Artemis runnng but still have some problems. Firstly, I get the messages log4j:WARN No appenders could be found for logger (uk.ac.sanger.artemis.ExternalProgram0. log4j:WARN Please initialize the log4j system properly. Due to our firewire, we can not set up the program to access any external sites so is there a way to remove this message? Secondly I am trying to get blast searches to run. We have local databases set up under a directory that runs the local windows version of blast and the blastall is located in the standalone program version. I have edited options and run_blastp to these two address. When I start a Blastp search, the sequence file is written out to the blastp directory and the message 'blastp process received signal: 2 Ok' comes up but there is no .out file and it seems that blastp doesn't actually run. Is there any way to see error messages (ie if it can't find or access the database or blastall). I have checked for typos and access problems and cant see anything obvious. Finally, when I use control V to view selected feature, the dialogue box is put behind the main Artemis window, can I change the default some where to open it at the front. Apologies that there are so many questions but maybe someone out there has seen something like this before and knows the fixes? Thanks in advance Melanie Duffield Team Leader - Advanced DNA and Protein Technologies Dstl Rm 201, Bld 7a Porton Down Wilts SP4 0JQ +44 (0) 1980 614364 The Information contained in this E-Mail and any subsequent correspondence is private and is intended solely for the intended recipient(s). For those other than the recipient any disclosure, copying, distribution, or any action taken or omitted to be taken in reliance on such information is prohibited and may be unlawful. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis display issues
Hi Filipe Thanks for your suggestions. Currently those are not possible, so I shall take a look. However, having separate files may not be possible at the moment. The flag for memory used in the PSU is usually set to: -mx1500m If you have this memory available to you, you could start with that. Regards Tim On 4/2/08 15:39, Filipe Garrett [EMAIL PROTECTED] wrote: Hi all, This new features seem just what I was looking for. However I still have some doubts: Is there a way to set the Frame Line Features... options at start-up (through the options file)? I've noticed that relating sequence with feature is only possible when the FASTA sequences are inside the GFF file. This is not so handy when your handling big files, such as entire genomes. Is it possible to relate both things when you add each entry separately? I also have some memory problems when loading an entire genome + GFF annotations. How much memory do you think it would be necessary for artemis to run? 2Gb? A minor change, when loading a multi-FASTA file, would also come in hand. Artemis, currently, interprets the whole '' string as the sequence ID. It would be nicer if it was just until the first SPACE (the standard behaviour). That way it is possible to add some description. thanks in adv, FG Tim Carver wrote: Hi Filipe It sounds like you are better off using the Frame Line Features... option. This allows you to define what features you want displayed on the frame lines. I think the other option is there for convenience and for when it is suitable. In the development version of Artemis you can have GFF3 with multiple sequences and the coordinates for the features relating to each (as below). E.g. ## gff-version 3 ## contig1 foo CDS 3 32 . - . ID=cds1;colour=8 contig1 foo3CDS 3 32 . + . ID=cds3;colour=8 contig2 foo2CDS 17 19 . + . ID=cds2;colour=2 ### ##FASTA contig1 gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga contig2 gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga Hope this helps. Regards Tim On 1/2/08 16:17, Filipe Garrett [EMAIL PROTECTED] wrote: Hi all, I've been trying to use Artemis with a recent Ensembl files from Anopheles (3.46). However, some things came to my atention. When I activate the All features On Frame Lines every feature is depicted on its correspondent lane. But why are exons also places on the frame lines? The exons don't have any frame! Shouldn't the frameless features be maintained on the central lines (or on a non-frame line)? The same thing happens when adding a multi-FASTA file. A concatenated sequence is loaded and several features, labelled fasta_record, are created. Again this features are placed as having frame! Is this a bug or am I forgetting something? Another thing that I've noticed is that there is no use for the seqname field in the GFF files. When placing features only the position and strand are taken into account, with all of them being placed in its positions but counting from the beginning of the concatenated sequence. Is there a way to link the seqname field with the fasta_record feature so that each feature is placed on the correct sequence? The idea would be to load a single GFF with the annotations for all the sequences present in a multi-FASTA. SEQ1 EMBL atg 103 105 . + 0 SEQ1 EMBL cds 103 171 . + 0 SEQ1 EMBL stop 172 174 . + . SEQ2 EMBL atg 173 175 . + . SEQ2 EMBL cds 173 258 . + . SEQ2 EMBL stop 259 261 . + 0 thanks in adv, FG ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis display issues
Hi Filipe It sounds like you are better off using the Frame Line Features... option. This allows you to define what features you want displayed on the frame lines. I think the other option is there for convenience and for when it is suitable. In the development version of Artemis you can have GFF3 with multiple sequences and the coordinates for the features relating to each (as below). E.g. ## gff-version 3 ## contig1 foo CDS 3 32 . - . ID=cds1;colour=8 contig1 foo3CDS 3 32 . + . ID=cds3;colour=8 contig2 foo2CDS 17 19 . + . ID=cds2;colour=2 ### ##FASTA contig1 gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga contig2 gatcccaactgctcctaccgtcattggatccagcggcgttccctcttccttctccaccgt tccttctagcagcggcgtcaagagctctaccaagactgcctcgaccgcaactgccaccga Hope this helps. Regards Tim On 1/2/08 16:17, Filipe Garrett [EMAIL PROTECTED] wrote: Hi all, I've been trying to use Artemis with a recent Ensembl files from Anopheles (3.46). However, some things came to my atention. When I activate the All features On Frame Lines every feature is depicted on its correspondent lane. But why are exons also places on the frame lines? The exons don't have any frame! Shouldn't the frameless features be maintained on the central lines (or on a non-frame line)? The same thing happens when adding a multi-FASTA file. A concatenated sequence is loaded and several features, labelled fasta_record, are created. Again this features are placed as having frame! Is this a bug or am I forgetting something? Another thing that I've noticed is that there is no use for the seqname field in the GFF files. When placing features only the position and strand are taken into account, with all of them being placed in its positions but counting from the beginning of the concatenated sequence. Is there a way to link the seqname field with the fasta_record feature so that each feature is placed on the correct sequence? The idea would be to load a single GFF with the annotations for all the sequences present in a multi-FASTA. SEQ1 EMBL atg 103 105 . + 0 SEQ1 EMBL cds 103 171 . + 0 SEQ1 EMBL stop 172 174 . + . SEQ2 EMBL atg 173 175 . + . SEQ2 EMBL cds 173 258 . + . SEQ2 EMBL stop 259 261 . + 0 thanks in adv, FG ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Intergenic region extraction
For those interested in doing this: I have added an option in Artemis under the Create menu to create features in the intergenic regions. If you want to try this new function it is in the development version. Look for the ³Development² section on the Artemis homepage and click on LAUNCH ARTEMIS or download it from: http://www.sanger.ac.uk/Software/Artemis/v9/v9_9/artemis_v9_9.jar (for windows) Or http://www.sanger.ac.uk/Software/Artemis/v9/v9_9/artemis_compiled_v9_9.tar.g z (for UNIX) -Tim On 12/12/07 09:39, Duffield Melanie L [EMAIL PROTECTED] wrote: Hello, I would like to extract all the non-coding region of sequence from my bacterial sequence and write this out to a file. Is there any way of doing this in Artemis? I can select all CDS or genes and I've tried toggle selection but this then selects any features not previously selected rather than DNA sequence not included. Thanks mel The Information contained in this E-Mail and any subsequent correspondence is private and is intended solely for the intended recipient(s). For those other than the recipient any disclosure, copying, distribution, or any action taken or omitted to be taken in reliance on such information is prohibited and may be unlawful. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Intergenic region extraction
Hi Mel You can use the Create Intron Features¹ option under the Create menu and then write those to file. Regards Tim On 12/12/07 09:39, Duffield Melanie L [EMAIL PROTECTED] wrote: Hello, I would like to extract all the non-coding region of sequence from my bacterial sequence and write this out to a file. Is there any way of doing this in Artemis? I can select all CDS or genes and I've tried toggle selection but this then selects any features not previously selected rather than DNA sequence not included. Thanks mel The Information contained in this E-Mail and any subsequent correspondence is private and is intended solely for the intended recipient(s). For those other than the recipient any disclosure, copying, distribution, or any action taken or omitted to be taken in reliance on such information is prohibited and may be unlawful. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Intergenic region extraction
Opps. I just realised that isn¹t exactly what you meant. I am not sure that there is a way of doing this in Artemis easily and you may need a script. Tim On 12/12/07 10:40, Tim Carver [EMAIL PROTECTED] wrote: Hi Mel You can use the Create Intron Features¹ option under the Create menu and then write those to file. Regards Tim On 12/12/07 09:39, Duffield Melanie L [EMAIL PROTECTED] wrote: Hello, I would like to extract all the non-coding region of sequence from my bacterial sequence and write this out to a file. Is there any way of doing this in Artemis? I can select all CDS or genes and I've tried toggle selection but this then selects any features not previously selected rather than DNA sequence not included. Thanks mel The Information contained in this E-Mail and any subsequent correspondence is private and is intended solely for the intended recipient(s). For those other than the recipient any disclosure, copying, distribution, or any action taken or omitted to be taken in reliance on such information is prohibited and may be unlawful. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis and Java WebStart
Hi Michael You probably just need to add '+' to the second argument. This should then reproduce how it is run on the command line, i.e.: art URL1 + URL2 Regards Tim On 8/8/07 14:06, Michael Nuhn [EMAIL PROTECTED] wrote: Hi! I am trying to let our users start Artemis with Java WebStart. I have noticed that it is possible to open a file on startup by giving it in the jnlp file like this: ... application-desc main-class=uk.ac.sanger.artemis.components.ArtemisMain argument[% Url to sequence here %]/argument /application-desc ... Now I would like Artemis to start with a sequence in fasta format an load one or more feature tables for this sequence. How do I do this? The following won't work: ... application-desc main-class=uk.ac.sanger.artemis.components.ArtemisMain argument[% Url to sequence in fasta format here %]/argument argument[% Url to an EMBL feature table %]/argument /application-desc ... I get the error: read failed: [% Url to EMBL feature table %] contains no sequence. I can load the feature table into Artemis as a file the usual way so it is not a problem with the file. Any idea? Thanks in advance, Michael. -- --- Dipl.-Inform. Michael Nuhn Bioinformatik Zentrum für Nanostrukturtechnologie und Molekularbiologische Technologie +49 (0)631 - 205 4334 [EMAIL PROTECTED] http://nbc3.biologie.uni-kl.de/ --- ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Loading mRNA sequence in GenBank format from Entrez Gene
Hi Rupert You are right it looks like PRIMARY is a new keyword in RefSeq. I have added this to the code and the changes have been committed. I have also updated the development version that can be found on the Artemis home page. Regards Tim On 6/8/07 22:17, Rupert Millard [EMAIL PROTECTED] wrote: Hi, I am a great fan of Artemis, having used it since I started working in a lab in May. I think I may have discovered a bug though (in version 9) - Artemis is not properly loading some mRNA transcripts in GenBank format from Entrez Gene such as the one at http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001353.5 The opened sequence begins 'nrnmarynrnnsnnnsnannnrnmaryn'. After removing the following section from the GenBank entry, the file opens properly: PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPANCOMP 1-623 BC040210.1 660-1282 624-628 CB119749.1 440-444 629-1179BC040210.1 1288-1838 1180-1384 M86609.1 1003-1207 There is something about this first line which makes Artemis to try to treat it as bases - I noticed the following correspondence between the section I removed and the gobbledegook: PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN : : : : :: : : ::: : : :: nrnmarynrnnsnnnsnannnrnmarynndnntrnnrnmarynsnan I hope someone can fix this. I looked at the source code, but don't know where to begin! Best wishes, Rupert Millard ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] out-of-range error in ACT
Hi Derek I haven't heard reports of this. I *think* DoubleACT may just be expecting fasta format. A quick solution to this is to use the WebACT version and right click in the middle over the comparison part of the window. This should give you a popup menu with an option to save out the comparison file. Regards Tim On 26/7/07 11:08, Derek Gatherer [EMAIL PROTECTED] wrote: Dear Artemis/ACT users I have an odd error in ACT: comparison file read failed: out of range error: match goes off end of subject sequence: 251970 The two short genomes I am comparing are: NC_002512 at 230138 residues, and NC_004065 at 230278 residues. I have checked both of the GenBank files. Neither are corrupt in any way and both open normally in Artemis. I generated the comparison file using DoubleACT. When I looked at it, sure enough there is the offending line with the out of range position: 42 100.00 163340 163356 2_5_blastdb_rcmv.seq.00150001.out 251970 251986 1_blastdb I tried deleting it, but there are others that keep cropping up. Has anybody seen this before? If this query is more appropriate for the DoubleACT authors, can anybody point me towards them? I tried WebACT and it doesn't seem to have this problem. However, there are several reasons why I would prefer to use DoubleACT and open ACT locally - for instance WebACT launches ACT Release 5 rather than 6, it also saves the comparison data as a jnlp file and not as text, etc. Cheers Derek ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] changing the orientation
Hi Jane Have a look at: http://www.sanger.ac.uk/Software/Artemis/v9/manual/editmenu.html#EDITMENU-RE VERSE-AND-COMPLEMENT-CONTIG This allows contigs to be reverse complemented and there is also the option of contig re-ordering. Regards Tim On 30/6/07 22:02, Christiane Nerz [EMAIL PROTECTED] wrote: Dear all! I¹m a newbie to Artemis, untill now I only used it as a ³genome viewer² to have quick informations about gene order and up- and downstream regions nearby interesting genes. So maybe my question has a simple answer: If a genome is read into Artemis, is it possible, to re-arrange afterwards parts of that genome? For instance to change the orientation of a part of the genome? A part of our newly sequenced genome is orientated opposite to those of close related species. For better depiction of the homology, we want to change the orientation of the part in question before comparing it with Artemis Comparison Tool. We want only a picture of homology independent from the correct order of the genes. Best regards Jane ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Question / Feature request: ORFs that do not run over contig borders
Hi Jack, Scott, This does look to be the best solution at the moment and appears that may have been a quick solution here in the past. I will look at implementing this for the next release. This may take the form of an extra check box on the ³minimum open reading frame² window, so that Artemis knows to use the ends of the sequences in multiple fasta files. Regards Tim On 25/6/07 17:02, Scott Beatson [EMAIL PROTECTED] wrote: Hi Jack, A quick solution is to insert a short sequence containing stop codons in all six reading frames in between every contig sequence in your fasta file. I agree it would be nice to have this as an artemis feature. Cheers Scott On 26/06/2007, at 1:03 AM, Jack van de Vossenberg wrote: Dear all, I am not sure if this came up already, but I have a question. If it cannot be done I'll make it a feature request. We have a 454 genome sequence, which is fragmented into many contigs. We used a fasta file of all contigs to start genome annotation. Artemis was used to determine ORFs. Unfortunately some ORFs cross the contig border to the next (random position) contig. This makes annotation, especially automated blasts, more difficult, and sometimes we miss info. Is there a way to tell Artemis not to cross contig borders while defining ORFs? If it is not possible I request an option for this for future releases ;) I think that more and more people will have fragmented genome data for quick/early screening. Cheers, Jack ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users --- Scott Beatson PhD NHMRC Howard Florey Research Fellow School of Molecular and Microbial Sciences University of Queensland Brisbane QLD 4072 Australia Tel: +61 7 33654863 Fax: +61 7 33654699 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] short_name?
Hi Michael On Tue, 8 May 2007, Michael Herron wrote: On a mac I would like to set the min and max window for a User Plot as described in the Options For Plots and Graphs section. What is the short name for a User Plot? Ther is no short name. Bigger question is can I set options at all on the mac? This is wrapped in the application jar. You can override it by adding a '.artemis_options' file to your home directory, as described here: http://www.sanger.ac.uk/Software/Artemis/v9/manual/options-chapt.html#OPTIONS-INTRO Regards Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Compile Artemis V9
Hi Oliver
The best thing to do is get the CVS version as described on the Artemis
home page (under the Development section). This contains a Makefile and a
build.xml file.
So you can compile using make:
e.g.
make clean
make
Or use the build.xml there to compile with ant.
Regards
Tim
On Tue, 1 May 2007, Oliver Krieg wrote:
Hello,
I'm trying to compile Artemis V9 via ant. This is my buildfile.xml:
project name=Artemis default=build basedir=.
descriptionArtemis V9/description
property name=srcdir location=${basedir} /
property name=jardir location=${basedir}/lib /
property name=apidir location=${basedir}/api /
property name=package value=uk.ac.sanger /
property name=main value=$
{package}.artemis.components.ArtemisMain /
path id=buildClassPath
pathelement location=${jardir}/biojava.jar /
pathelement location=${jardir}/chado-14-interface.jar /
pathelement location=${jardir}/jakarta-regexp-1.2.jar /
pathelement location=${jardir}/jemAlign.jar /
pathelement location=${jardir}/jobcontrol.jar /
pathelement location=${jardir}/macos.jar /
pathelement location=${jardir}/
postgresql-8.1-407.jdbc2ee.jar /
pathelement location=${jardir}/retrotranslator-
runtime-1.1.0.jar /
pathelement location=${jardir}/j2ssh/commons-logging.jar /
pathelement location=${jardir}/j2ssh/j2ssh-artemis-
plugin.jar /
pathelement location=${jardir}/j2ssh/j2ssh-core.jar /
pathelement location=${jardir}/ibatis/cglib-
nodep-2.2_beta1.jar /
pathelement location=${jardir}/ibatis/ibatis-2.3.0.677.jar /
pathelement location=${jardir}/ibatis/log4j-1.2.14.jar /
/path
target name=build description=Compiles the code
javac srcdir=${srcdir}
classpathref=buildClassPath /
/target
/project
But it won't compile. I always get the following errors:
build:
[javac] Compiling 290 source files
[javac] /Users/oliver/Documents/workspaceUVIC/ArtemisSource/
artemis/uk/ac/sanger/artemis/ExternalProgramUtils.java:69: cannot
access uk.ac.sanger.util.AbstractPropertyChangeable
[javac] file uk/ac/sanger/util/AbstractPropertyChangeable.class
not found
[javac] new
uk.ac.sanger.jcon.job.JobBatchImpl (administrator.getExecutableById
(1));
[javac] ^
[javac] /Users/oliver/Documents/workspaceUVIC/ArtemisSource/
artemis/uk/ac/sanger/artemis/ExternalProgramUtils.java:83: cannot
access uk.ac.sanger.sql.MutableNestedSetTreeNode
[javac] file uk/ac/sanger/sql/MutableNestedSetTreeNode.class not
found
[javac]new
uk.ac.sanger.jcon.job.JobBatchImpl (executable);
[javac]^
[javac] /Users/oliver/Documents/workspaceUVIC/ArtemisSource/
artemis/uk/ac/sanger/artemis/ExternalProgramUtils.java:85: cannot
access uk.ac.sanger.util.PropertyChangeable
[javac] file uk/ac/sanger/util/PropertyChangeable.class not found
[javac] job.setStatus
(status_dao.readStatusById ( uk.ac.sanger.jcon.job.Status.WAITING));
[javac] ^
[javac] /Users/oliver/Documents/workspaceUVIC/ArtemisSource/
artemis/uk/ac/sanger/artemis/ExternalProgramUtils.java:88:
incompatible types
[javac] found : java.lang.Object
[javac] required: java.lang.String
[javac] final String input_file_name =
sequence_file_names.elementAt (i);
[javac]
^
[javac] Note: Some input files use or override a deprecated API.
[javac] Note: Recompile with -Xlint:deprecation for details.
[javac] Note: Some input files use unchecked or unsafe operations.
[javac] Note: Recompile with -Xlint:unchecked for details.
[javac] 4 errors
BUILD FAILED
I already searched for the class
uk.ac.sanger.util.AbstractPropertyChangeable, but I didn't find it in
the source or in one of the jar-files ...
What I'm doing wrong? Can anyone help me?
Cheers
Oliver
The Wellcome Trust Sanger Institute
Wellcome Trust Genome Campus, Hinxton,
Cambridge, CB10 1SA, UK
___
Artemis-users mailing list
Artemis-users@sanger.ac.uk
http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Fw: [Sanger #29341] SANGER website feedback
Hi Andrea What you get in the FASTA header are: systematic name Label Product (if any) Location You should be able to alter what it takes as the first 2 (systematic name and label) in version 9 of Artemis by going to File - Preferences and changing the defaults for Feature Display Labels and Systematic Name Labels. You can add qualifiers from these lists by editing the drop down list on the right and clicking the ADD button. You can also delete qualifiers from the list. It then takes the first qualifier in each list to be the 'systematic name' and 'label' in the output. I'm not sure this does covers everything you want written out but I hope this helps. Regards Tim On 27/4/07 15:42, Andrea Azcarate [EMAIL PROTECTED] wrote: Good morning, I could not find the answer to my problem in the forum. Below is a copy of my question: Hello, I am using Artemis to annotate a microbial sequence, and I need to select all the CDS containing an specific feature (SignalP) and write them into a file. The problem is that when I select signalP and write the selected features, Artemis only writes the feature and the location in the genome, but the CDS information (ORF number, complete aa seq, other features). Is there a way to do this? Thank you very much in advance, Andrea Azcarate --- M. Andrea Azcarate Peril, Ph. D. Research Scientist Food Science Department North Carolina State University Box 7624 Raleigh, NC 27695 Ph 919 515 3552 The greatness of a nation and its moral progress can be judged by the way its animals are treated - Mahatma Ghandi - Original Message - From: Paul Bevan via RT [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Friday, April 27, 2007 3:26 AM Subject: [Sanger #29341] Resolved: SANGER website feedback According to our records, your request has been resolved. If you have any further questions or concerns, you can re-open this case simply by responding to this message. Otherwise, please do not respond to this message. Resolution: Thank you for your correspondence ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Artemis Plugin
Hi Olivier It depends on what you are trying to do. If you are integrating another application I would suggest having a look at configuring the run menu for this: http://www.sanger.ac.uk/Software/Artemis/v9/manual/runmenu.html#RUNMENU-CONF IGURATION If it is another Java application then I would suggest you start by getting the code downloaded from CVS. If you want further pointers from then let me know and it would be useful to know more about what you plan. Regards Tim Carver On 23/4/07 17:57, Oliver Krieg [EMAIL PROTECTED] wrote: Hi, I wan't to extend the functionality of Artemis. What I want to do, is to write some kind of a plugin for Artemis. Does anybody have any experience with writing plugins for Artemis? Do you have hints, where I should start? I've just started the project and thought, it might be useful to talk to someone, who already wrote a plugin for Artemis. Best regards, Oliver Krieg ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] problems with large sequences
Hi Nydia You are right it does look like Double ACT has either moved or no longer exists. For WebACT, the best thing to do is to use their 'Contact Us' link to report the problem. Regards Tim On 4/4/07 16:16, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote: Hi, I've been trying to run a comparison of three sequences using WebACT. These are sequences containing gene clusters. When I submit the sequences it goes to next page and the gives an error message indicating: Internal Server Error. This does not happen when I submit single gene sequences. I appears there is a problem with with large sequences. In addition I've tried opening the other version of this program, DoubleAct and the link: http://193.129.245.227/pise/double_act.html does not seem to be working. Is there anything I can do to get around these problems? Thank you very much, Nydia Morales University of Wisconsin-Milwaukee ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] artemis on ubuntu
Hi Stefano I think you can probably just copy 'etc/run_blastp' from version 7 to version 8 then. Regards Tim On 30/1/07 16:16, Stefano Ghignone [EMAIL PROTECTED] wrote: Dear all, ok...I need an help! I have an artemis v.7 working on a FedoraCore3 machine, perfectly integrated with the blast-2.2.15, so that the blast programs listed in the run menu are working fine using swissprot, nr, nt, and so on... Now, I'm trying to work with artemis v.8 on a Ubuntu machine, but I didn't succed with its integration with blast-2.2.15 (note that the stand alone blast and the artemis itself are working!) On this machine I have copied the same configuration (blast, artemis, artemis/etc in my PATH and BLASTDB environment variable) but the run_ commands from the run menu are still not working Usually, for e.g., I get this error: ERROR running blastx: = [blastall] ERROR: No argument given for database I get the same error even if I run the run_ script from the terminal. I also tried to specify the database location in the artemis/etc/option : feature_dna_programs = \ tblastx /usr/BioSW/blast-2.2.15/db \ blastn /usr/BioSW/blast-2.2.15/db \ blastx /usr/BioSW/blast-2.2.15/db \ fastx %uniprot \ clustalx DNA but with no success again... It's days I'm working on it..What's wrong? Cheers Stefano ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] artemis on ubuntu
Hi Stefano No it looks like the script is not getting the database name for some reason or is loosing it. The line above the error you have should be: seq1-out using database swissprot i.e. should provide the name of the database you are using. Attached is a run_blastx script that works for me. As you know you need to define BLATMAT, BLASTDB and the path to blast. Regards Tim On 30/1/07 17:35, Stefano Ghignone [EMAIL PROTECTED] wrote: Hi Tim, thanks for your ready reply. I tried your suggestion, but it doesn't work...(I think I also tried before...) Well, runnning the old run_ script from terminal I get (same as v.8): [EMAIL PROTECTED]:~/artemis$ run_blastx -onefile seq1.txt seq1-out.txt swissprot about to start blastall with input from seq1.txt and output to seq1-out.txt using database [blastall] ERROR: No argument given for Database so I think the problem is that the script doesn't find the database swissprot! ...even if I create a DATABASE environment variable with the same value as BLASTDB... Any other idea? Stefano Tim Carver wrote: Hi Stefano I think you can probably just copy 'etc/run_blastp' from version 7 to version 8 then. Regards Tim On 30/1/07 16:16, Stefano Ghignone [EMAIL PROTECTED] wrote: Dear all, ok...I need an help! I have an artemis v.7 working on a FedoraCore3 machine, perfectly integrated with the blast-2.2.15, so that the blast programs listed in the run menu are working fine using swissprot, nr, nt, and so on... Now, I'm trying to work with artemis v.8 on a Ubuntu machine, but I didn't succed with its integration with blast-2.2.15 (note that the stand alone blast and the artemis itself are working!) On this machine I have copied the same configuration (blast, artemis, artemis/etc in my PATH and BLASTDB environment variable) but the run_ commands from the run menu are still not working Usually, for e.g., I get this error: ERROR running blastx: = [blastall] ERROR: No argument given for database I get the same error even if I run the run_ script from the terminal. I also tried to specify the database location in the artemis/etc/option : feature_dna_programs = \ tblastx /usr/BioSW/blast-2.2.15/db \ blastn /usr/BioSW/blast-2.2.15/db \ blastx /usr/BioSW/blast-2.2.15/db \ fastx %uniprot \ clustalx DNA but with no success again... It's days I'm working on it..What's wrong? Cheers Stefano run_blastx Description: Binary data ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Import ORFS
Hi You can write out the ORFs from Artemis. If you select all the ORF's by going to the Select menu : Select - By key Then create a multiple fasta file by going to Write - Bases of Selection - FASTA format Regards Tim On 24/1/07 15:17, Mekhala Acharya [EMAIL PROTECTED] wrote: Hi, I have a list of ORFS imported from ARTEMIS. Is there a way to import the corresponding bases as well. Essentially I need to blast all the ORFS against the nr database of NCBI? Besides writing a script to do this, is there another route? Thanks. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] color tag
Hi Andrew For the MacOSX the options file (like the windows distribution) is wrapped in the artemis.jar file. You can unwrap this, edit the options file and create a new jar file. Alternatively as you mention you can use the options flag or one of the other option locations described here: http://www.sanger.ac.uk/Software/Artemis/v8/manual/options-chapt.html#OPTION S-INTRO The format is identical. Regards Tim On 6/12/06 16:22, Andrew Stewart [EMAIL PROTECTED] wrote: Hey Tim, thanks for the reply. What about for the Mac OSX distribution, where the options file appears to be located within the application package itself (though within there I can't seem to find it)? Can the -options argument passed at the command line still specify a set of options to override the default ones? If so, would the format of this new options file be similar to that found in the options file of, say, a unix distribution of Artemis? Thanks, Andrew On Dec 6, 2006, at 3:09 AM, Tim Carver wrote: Hi Andrew The colours and the default colours for features are defined in the etc/options¹ file in the distribution. This gives you some more on this: http://www.sanger.ac.uk/Software/Artemis/v8/manual/concepts.html#CONCEPTS-COL OUR Regards Tim On 5/12/06 22:47, Andrew Stewart [EMAIL PROTECTED] wrote: Some features are drawn in Artemis with a certain color, presumably determined by the primary_tag or other attribute, while other features can override the color drawn (or include one if none appears by default) by setting the color tag on the given feature. Is there some table that determines the default colors associated with a given feature/attribute, and is this table accessible (either through the Artemis interface or through some configuration file) or is it more or less hard coded into the Artemis source code? Thanks! -Andrew -- Andrew Stewart Research Assistant, Genomics Team Navy Medical Research Center (NMRC) Biological Defense Research Directorate (BDRD) BDRD Annex 12300 Washington Avenue, 2nd Floor Rockville, MD 20852 email: [EMAIL PROTECTED] phone: 301-231-6700 Ext 270 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users -- Andrew Stewart Research Assistant, Genomics Team Navy Medical Research Center (NMRC) Biological Defense Research Directorate (BDRD) BDRD Annex 12300 Washington Avenue, 2nd Floor Rockville, MD 20852 email: [EMAIL PROTECTED] phone: 301-231-6700 Ext 270 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] database entry connection failed (mysql problem)
Hi Andrew Yes, Artemis will be supporting chado. It will not be limited to postgres but will be using a chado schema. There are currently no plans to support a Bio::DB::GFF database. Regards Tim On 1/12/06 21:50, Andrew Stewart [EMAIL PROTECTED] wrote: I open Artemis Release 8, then proceed to File Database Entry, with the following values... Server: somehost Port: 3306 (for mysql) Database: test1 (the name of my mysql database) User: myuser Pass: mypass And get an SQL error that simply reports SQL Problems When returning to the Database Entry window within the same session, I notice that there are now a new set of values in place for each of the fields... Server : jdbc Port: postgresql: Database: /somehost:3306/test1 User: user=myuser Password: (blank) This has me scratching my head. Is postgresql the only supported rdb? Is chado the only support schema? Are there any plans to support mysql with a Bio::DB::GFF database? Thanks, Andrew -- Andrew Stewart Research Assistant, Genomics Team Navy Medical Research Center (NMRC) Biological Defense Research Directorate (BDRD) BDRD Annex 12300 Washington Avenue, 2nd Floor Rockville, MD 20852 email: [EMAIL PROTECTED] phone: 301-231-6700 Ext 270 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Re: Can ACT do a protein comparison?
Title: Re: [Artemis-users] Re: Can ACT do a protein comparison? Hi Peter So for tblastx you can just change the program name option and use something like this: blastall -d Seq1_fasta -i Seq2_fasta -p tblastx -m 8 -o $outputfile Regards Tim On 7/11/06 23:30, Peter Reeves [EMAIL PROTECTED] wrote: Dear Tim, I was about to try tBLASTx . could you tell me the command lines to use. what I use for current script using dna for the blast is: seqret -auto -filter -osf fasta $sequence_1 Seq1_fasta seqret -auto -filter -osf fasta $sequence_2 Seq2_fasta formatdb -i Seq1_fasta -p f blastall -d Seq1_fasta -i Seq2_fasta -p blastn -m 8 -o $outputfile where the input files $sequence_1 $sequence_2 are genbank file or genbank/embl generated by artemis Regards Peter At 2:04 PM + 7/11/06, Tim Carver wrote: I should add that you can of course use tBLASTx to generate the comarison data. Regards Tim On 7/11/06 13:41, Tim Carver [EMAIL PROTECTED] wrote: Hi Bala No, this is only for DNA sequence comparisons. Regards Tim On 7/11/06 12:02, BALASUBRAMANIAN GANESAN [EMAIL PROTECTED] wrote: Dear Tim/Julian/users Is it also possible to use protein sequence comparisons using this same approach? Regards BALA. = Original Message From Julian Parkhill [EMAIL PROTECTED] = Bala, ACT cannot reconstruct the positional information for the separate sequences within a multiple FASTA file; BLAST reports only the local coordinates for the matches. What you need to do is: 1) Concatenate all the mFASTA sequences into a single sequence for each genome (you can do this from Artemis, using the Write; all bases menu) 2) Do the blast comparison with the concatenated sequences 3) Load the original multiple FASTA files into ACT, but use the comparison file from the concatenated sequences. You should see the contigs represented by alternating dark/light brown features, plus the matches for the whole sequences. For the other problem; the set cutoffs only remain for as long as the dialog window is open. Closing the dialog window resets the cutoffs. yours, Julian. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Re: Can ACT do a protein comparison?
I should add that you can of course use tBLASTx to generate the comarison data. Regards Tim On 7/11/06 13:41, Tim Carver [EMAIL PROTECTED] wrote: Hi Bala No, this is only for DNA sequence comparisons. Regards Tim On 7/11/06 12:02, BALASUBRAMANIAN GANESAN [EMAIL PROTECTED] wrote: Dear Tim/Julian/users Is it also possible to use protein sequence comparisons using this same approach? Regards BALA. = Original Message From Julian Parkhill [EMAIL PROTECTED] = Bala, ACT cannot reconstruct the positional information for the separate sequences within a multiple FASTA file; BLAST reports only the local coordinates for the matches. What you need to do is: 1) Concatenate all the mFASTA sequences into a single sequence for each genome (you can do this from Artemis, using the Write; all bases menu) 2) Do the blast comparison with the concatenated sequences 3) Load the original multiple FASTA files into ACT, but use the comparison file from the concatenated sequences. You should see the contigs represented by alternating dark/light brown features, plus the matches for the whole sequences. For the other problem; the set cutoffs only remain for as long as the dialog window is open. Closing the dialog window resets the cutoffs. yours, Julian. ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] ACT v5 for mac - can only see small part of comparison
Hi Balasubramanian On 5/11/06 08:23, BALASUBRAMANIAN GANESAN [EMAIL PROTECTED] wrote: Hello I am using ACT v5 for the Mac to look at a two-genome comparison to start off with. Many features seem to not work such as score cutoff, percent ID cutoff are never apllied or saved after setting them. These don't get saved between sessions anyway. The sequence lock works totally at random. But my main problem is that the comparison view shows only the comparisons for the first 5-6k bases for 2.5 Mb genomes. Why is this the case? This does sound strange. This should be fine as long as you use the output of BLAST version 2.2.2 or better. The blastall command must be run with the -m 8 flag which generates one line of information per HSP. You could try on of the on-line versions for generating the comparison files, e.g. webact: http://www.webact.org/WebACT/home Also make sure you are using java1.4.2 or higher (from apple http://www.apple.com/macosx/features/java/). Regards Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Preparing Artemis annotation for Sequin submission
Title: Re: [Artemis-users] Preparing Artemis annotation for Sequin submission Hi Jay This web service may be of some use to you: http://nbc11.biologie.uni-kl.de/framed/left/menu/auto/right/sequin/index_sequin.shtml ? Regards Tim Carver On 20/10/06 19:48, Jay McCarren [EMAIL PROTECTED] wrote: Hello, I'm in the process of submitting a number of fosmid sequences and associated annotation to Genbank using the NCBI Sequin submission software. I'm having difficulty porting my annotation into Sequin. So far I've only been partially successful by writing a file with the amino acids of all the CDSs and then importing this file in the Proteins tab during the sequin submission. This locates the CDS on my nucleotide sequence but I lose all the other important annotation. Is there a better way to go about this? Is there some way to generate a feature table? If so, how is this then imported in Sequin? It seems like there must be a more automated way about this than the cut and paste operation I'm about to embark on. Thanks for the help, Jay __ Jay McCarren Postdoctoral Associate Massachusetts Institute of Technology Room 48-336 15 Vassar St. Cambridge, MA 02139 Lab: (617) 258-7407 Fax: (617) 253-7475 ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] CHADO connectivity
Hi Preethi This is still work in progress. However, I have Artemis reading and writing to a test CHADO database (using either iBatis or straight JDBC) and we have been working on the java interface to do this. This is top priority on my list of things to do over the next few months. If you want to try out what it currently supports you can get the development version and I can provide more information on how to get it talking to a database. Regards Tim On 19/9/06 19:38, PIRA (Preethi Ramaiya) [EMAIL PROTECTED] wrote: Hi I am following up on a post I made in Jan 2006. I am currently trying to use Artemis8 and GFF3. We are planning on using the CHADO schema from GMOD and also, Gbrowse. We have the CHADO/Gbrowse part working with some test GFF3 data that we have adapted from the Artemis GFF3 dump. Is there any plan to get CHADO connectivity in Artemis soon..? :-) That might save us an Artemis-Apollo migration. We like the user interface in Artemis (bacterial genomes) and would like to have a straight pipe into CHADO. Thank you! Regards Preethi - Hi Preethi I plan to get a Artemis/ACT release out in the next couple of months (hopefully sooner than later). To get it talking to CHADO it has become more GFF3 compliant which is what we are working towards but this has not been used in anger yet. Regards Tim ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] query on Parallelization --- ACT
Title: Re: [Artemis-users] query on Parallelization --- ACT Hi Mangala ACT is a Java application. As a GUI application it does use multi-threading to spawn separate applications. The main standards and technologies are Java. However there are other technologies it uses, e.g. j2ssh to provide SSH connections. Please let me know if you have other specific questions or want to know more. It may also be good to know where your interests are with ACT. Regards Tim Carver On 1/9/06 12:12, Mangala [EMAIL PROTECTED] wrote: Hi, Plz anyone clarify me the following questions: 1. Is the ACT app parallelized? If so, please summarize (in a sentence or two). If the app uses a DRM, which one - Grid Engine? Something from , DataSynapse? or Platform? 2. Whar are the Standards or Technologies used (For example, RMI, MPI, DRMMA, etc.) ? Thanx in advance, Mangala.k ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] problem importing ensembl export view flat files into Artemis
Title: Re: [Artemis-users] problem importing ensembl export view flat files into Artemis Hi Lesley Actually I think Artemis doesnt like the location references to another entry, e.g.: FT gene complement(AC012146.25.1.171309:6053..52695) Regards Tim On 22/6/06 17:21, Lesley Nicolson [EMAIL PROTECTED] wrote: Hi I would really appreciate help with a problem importing files from ensembl export view (http://www.ensembl.org/Homo_sapiens/exportview). Ive exported human chromosomal sequence (500Mb) from ensembl export view, with gene, vega and genscan features, as a flat file (saved as text file). In notepad this looks comparable to files that I can open in artemis (apart from the XX blank lines but it makes no difference removing these): example: ID 17 standard; DNA; HTG; 50 BP. XX AC chromosome:NCBI36:17:10050467:10550466:1 XX SV chromosome:NCBI36:17:10050467:10550466:1 XX DT 21-JUN-2006 XX DE Homo sapiens chromosome 17 NCBI36 partial sequence 10050467..10550466 DE annotated by Ensembl XX KW . XX OS Homo sapiens (human) OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; On opening the file in artemis, the file is accessed (since I get a base count and reports of trans splicing features) but the sequence does not appear on the artemis screen. I can successfully import sequence into Artemis if I export it as fasta from export view but this means I lose annotation. I have tried saving the feature component of the original file as *.tab file and reading this in once the fasta sequence is loaded but this does not import features into the sequence (annotations are at least partially accessed as I get trans splicing messages but no sequence annotations appear in the sequence screen of artemis). I have also tried importing into vectorNTI and exporting as embl file (whereupon the sequence is accessed but I get a final error message regarding vntifkey not being suitable identifier for source and no sequence appears in Artemis (I also get the message vntifkey on readable files prior to sequence appearing in Artemis screen so I dont think this is related to the loading problem)). I have tried a sequence a colleague can import into artemis (with success) and he has tried my sequence (and similarly failed) so it does not seem to be a problem peculiar to my installation of artemis/PC environment. Does anyone have any tricks/workaround/tips I might try ? Many thanks. Regards, Lesley Nicolson Glasgow Veterinary School Div II, Level 4 Sir Henry Wellcome Building ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] open several files with several entries at once
Hi Marie-Pierre The easiest solution is to make use of the 'art' script and supply the names of the files on the command line: http://www.sanger.ac.uk/Software/Artemis/v8/manual/start.html#RUNNINGUNIX You could then wrap that in a script or define an alias for the command. Regards Tim On Fri, 2 Jun 2006, Marie-Pierre Oudot-Le Secq wrote: Hi, I would like to know if there is a way to make possible the opening of several files with several entries at once. I'm comparing genomes and I always need to work with at least 3 files, with several entries for each of them. It always takes quite a time every morning to open every thing one at the time :-) I work on a Mac, with OSX 10.4.6 and Artemis 8. I tried to make up something with Applescript, but I was not abble to reach my goal with a Tell application block. Then, I tried with the Unix version of Artemis, and a do shell script, still in Applescript. It's a little bit more successful, but I can open just one file and the corresponding entries. And then, I don't know how to make Applescript get out of the do shell when the windows I wanted are launched and how to make it open several of them. Any suggestion in one or another direction? Thank you, Marie-Pierre --- Dr. Marie-Pierre Oudot-Le Secq Photosynthesis group (Dr. Beverley GREEN's group) Dept. of Botany, University of British Columbia, #3529-6270 University Boulevard, Vancouver, B.C., Canada, V6T 1Z4 Phone: 1-604-822-3613 Fax: 1-604-822-6089 E-mail: [EMAIL PROTECTED] (or my permanent e-mail: [EMAIL PROTECTED]) ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users The Wellcome Trust Sanger Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] database
Hi Brad Just to let you know that we are currently developing Artemis to be able to talk to a database (CHADO). Currently we have it reading from an internal test database. This is not available yet but will start to become part of the next few Artemis releases as it gets implemented. Regards Tim On 26/1/06 14:50, biarshin [EMAIL PROTECTED] wrote: I would like to set up a database for a small community studying a model organism. We would we like to have a small database running on our server that the community could access using Artemis. Users would use Artemis for doing gene annotations and browsing the genome. Ideally the users would have the option of either connecting to the online database or using a cached copy of the database residing on their local computer (which could be in flat file format since it would be a single user environment). My question is has anybody set up such as system using Artemis, and where might I get information on how to set it up. Specifically is there information available on how to set up a a centralized database for our genomic information that the users could browse with Artemis? Thanks, Brad ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] printing gene lists
Hi Peter When you get the list of the features, you can right click on the window to get a pop up menu. One of the options on the menu is 'Save List To File'. Regards Tim Tim Carver The Wellcome Trust Sanger Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK On 21/11/05 22:30, Peter Reeves [EMAIL PROTECTED] wrote: I'm sure I was once told how to print the list I get when I Show CDS Genes and Products under view. I want to print the list to PDF, or cut and paste to word, so that I can search it. Peter Reeves ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Copy and paste
Hi Yung-Yao What you can do is highlight the bases you want by dragging over the feature display with the left hand mouse button held down. The when you have selected the bases you want, go to the 'Write' menu and select 'Bases of Selection' and write them to a file of your chosen format. Regards Tim On 22/11/05 12:52, Yung-Yao Lin [EMAIL PROTECTED] wrote: Hi there, Does anyone know if I can select and copy sequences (DNA or aa) in Artemis, and then paste these bases into other applications? Thank you so much for help. Regards, Yung-Yao -Original Message- From: Chris Peacock Sent: 22 November 2005 08:29 To: Peter Reeves Cc: artemis-users@sanger.ac.uk Subject: Re: [Artemis-users] printing gene lists Hi, Either you can use the windows copy paste commands to paste into a word document or you can right mouse click on the list and save list to file, the choice is yours. Cheers Chris On 21 Nov 2005, at 22:30, Peter Reeves wrote: I'm sure I was once told how to print the list I get when I Show CDS Genes and Products under view. I want to print the list to PDF, or cut and paste to word, so that I can search it. Peter Reeves -- Peter Reeves Phone 61-2-93512536 Professor of Microbiology, School of Molecular and Microbial Biosciences (G08) The University of Sydney NSW 2006, Australia ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
Re: [Artemis-users] Comparison View Menu, Set Percent ID cutoffs
Hi Virginia ACT is using the percentage identities, score, match/alignment length reported by BLAST. So I guess you question is more a BLAST question but I will try and answer from an ACT point of view. If you set the minimum % identity cut-off to zero then artemis will display all the results, i.e. nothing is filtered out. If you set the minimum size cut-off of 70 bp then only the matches with that number of base pairs or higher will be displayed. So you can use a combination of score, % identity and alignment size to define what you want to display and what may be meaningful for you to display. In very coarse terms the higher the % identity the more meaningful that hit may be. As the score comes from using a scoring matrix this cut-off takes into account the similarity as well and so you can also use this when filtering what is being displayed. Best Regards Tim Tim Carver The Wellcome Trust Sanger Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK On 19/7/05 12:22 am, Virginia Isabel Rich [EMAIL PROTECTED] wrote: hello there, many of us around our labs use Artemis and ACT with moderate frequency, however I'm up against an Artemis weirdness that no one around here can explain to me; so I'm helping you folks can! In the Comparison View Pop-up Menu, it is possible to Set the Percent ID cutoffs. This slides from 0% to 100%, and the default view is 0%. If I have my match-size set at, say, 70 bp, what does it mean for the % identity to be 0?? Logically, there's a 1-in-4 chance that a single base would match another base, so it seems like for anything 4bp or longer the true default identity cutoff would be, say, 25%. Or if the cutoff is 50%, does that really mean that what I'm seeing represented in Comparison View is 70-mers that share at least 35bp with their matches? The more I think about this the more I think it's merely a BLAST-weirdness, not an Artemis one. What this % identity is really letting the user select is just the % identity within whatever *aligned* sequences are present in the BLAST match between the two genomes, and thus is not a particularly meaningful way to look, for example, at 80% IDENTICAL 70-MERS ACROSS TWO GENOMES (this really being my goal). This is likely better achieved by determining what the e-value for such a match across a 70-mer would be given these two genomes, and using that to Set the Score Cutoff. Would you folks agree with this interpretation, and/or would you have any suggestions for a better way to visualize genome comparisons via 70mers with varying percents of identity? Thanks a lot! Virginia Rich ~~~ Virginia Rich [EMAIL PROTECTED] DeLong Lab MIT ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users ___ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users
