[ccp4bb] best strategy to establish stable expression in mammalian cells
Dear All; We are planning to establish stable CHO or 293 cell clones to express some receptors. I heard that it is time consuming to select high expression clones using pcDNA3.1 vectors. As our crystallographer are dealing with all kinds of proteins, can anyone recommend a best strategy for mammalian cell expression? Thank you so much and have a nice weekend, Jerry McCully
[ccp4bb] co-express two proteins in E.coli
Dear ALL, We are planning to co-express two proteins in E.coli. Could anyone suggest a good dual set plasmid or a proper insertion sequence between two genes, including the Shine-Dalgarno sequence? Thank you very much and have a nice summer. Jerry McCully
[ccp4bb] how to interpret DALI search results
Dear ALL; After we solved our structure by anomalous scattering, we did a DALI search. Here are the results but it is not easy to draw meaningful conclusions whether our structure represents a novel fold or is homologous to others. Basically the Z-score is between 2 and 6.4 since our structure only contains 130 residues. Sequence identity is between 5 to 15%. The RMSD of structural alignment is between 2.5 to 6 angstrom. Any suggests to interpret the DALI results? Many thanks, Jerry McCully
[ccp4bb] difference between PEG 4000 and polyacrylate 5100
Dear ALL; Both PEG and polyacrylate are polymers. Although their formulations are different, Could they be exchangeable in crystallization conditions? Thanks a lot, Jerry McCully
[ccp4bb] minimum protein concentration for NI-NTA column
Dear All; This is a sort of naive question about the NI-NTA affinity purification. Is the Ni-NTA column from GE health able to capture proteins at 0.2ug/ml to 0.5ug/ml? IF not, then it is necessary to concentrate the mammalian expression supernatant. Thanks a lot and best regards, Jerry McCully
[ccp4bb] weird--No protein expression using pET30a
Dear ALL; Recently, one of my colleagues cloned a gene (200aa) into pET30a vectors with either a N-ter or C-ter His6 tag. The correct reading frame was confirmed by sequencing. However, it is weird that there was no protein expression either in the soluble fraction or as inclusion bodies. Could anyone give some instruction? Thanks a lot and have a nice weekend, Jerry
[ccp4bb] endotoxin removal: Triton X-114 dissociates protein oligomers?
Dear ALL; Thanks a lot for all the instructive suggestions. As my first trial, I tried 0.1%Triton X-114 plus Ni-column binding buffer. However, the oligomer of my protein got dissociated in to monomers as indicated by gel-filtration. Does anyone know how to rescue the oligomer? Simply lower the concentration of Triton X-114 to 0.02-0.05%? Thanks again, Jerry
[ccp4bb] mammalian expression vector
Dear ALL; As an alternative strategy to avoid endotoxin, I plan to express the protein in mammalian cells. As suggested by others, the typical vector is pcDNA3.1(+). Does anyone have comments on this vector or recommend some other powerful vectors? I am new to mammalian expression. I designed a Kozak sequence followed by a BSA signal peptide in order to clone the target into pcDNA3.1(+). Is it right? Tentative Kozak sequence: GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT Thanks a lot, Jerry
[ccp4bb] FW: endotoxin removal
Dear All; We purified a His tag protein by Ni-NTA and gel-filtration from E.coli. We tried two endotoxin removal resins from Pierce. However, it is hard to remove the endotoxins in the purified protein because the protein bound to the resin as well. This protein contains quite a few aromatic residues and has a pI around 6. Any ideas to remove the endotoxins will be highly appreciated. best regards, Jerry McCully
[ccp4bb] scalepack--scale data in .sca format with original index
Dear ALL; I am sorry for this HKL2000 scalepack question. To confirm the scape group using Pointless, I processed the images using HKL2000 but kept the original index using No merge original index. Now Pointless gave the right space group, and I want to merge my data from the existing .sca file with the original index to report the scaling statistics. Can anyone help me to correct the following scripts? By the way, the orignal index format in Scalepack is (6i4, i6, 2i2, i3, 2f8.1). Thanks a lot and have a nice weekend, Jerry Format scalepack FILE 1 'no-merge-original-index.sca' @reject resolution 40 1.8 number of zones 20 estimated error 0.06 0.07 0.07 0.07 0.08 0.07 0.08 0.07 0.07 0.04 0.03 0.03 0.03 0.03 0.02 0.02 0.02 0.02 0.02 0.02 error scale factor 1.3 default scale 10 rejection probability 0.0001 scale restrain 0.01 B restrain 0.02 space group P2221 unit cell 70.19188.586 158.41690.000 90.00090.000 output file 'merge.sca' postrefine 20 merge
[ccp4bb] prescission protease cutting site
Dear ALL; We are going to use the prescission protease cutting site (LEVLFQ/GP ) in our cloning vector to remove the His6 tag. Do we need to insert some linkers between this cutting site and the target protein to improve the cleavage efficiency? Or we are over concerned. Thanks a lot and have a nice summer. Jerry McCully
Re: [ccp4bb] larger molecular weight shown by analytic ultracentrifugation
Dear Kushol, Chad and other folks; Thanks a lot for the comments. I am sorry for keeping silent because we are still repeating the SE experiment. However, here are some preliminary data. Did Jerry run SV or SE? 2. If the former, then did he see a nice, single boundary, or a big smear? We tried both SV and SE. SV showed an increasing Sw with decreasing concentrations (Sw varied from 6.9, 7.0, 7.2, 7.4 to 7.522). IN addition, the SV experiments showed a single boundary. However, the boundary was a little broader, between 6 and 8.5. SV peaks seem to overlay at lower concentrations with Sw ranging from 7.5 to 7.86. From SV experiments, the calculated Mw is ~125 KD with f/fo equal to 1.2. The monomer of my protein is ~20KD. I am not sure whether 7.86 S would be much faster than a tetramer (~80KD) could possibly sediment. In the meanwhile, light scattering on my sample showed a radius equal to a tetramer. 3. If the latter, how were the data analyzed to come to his conclusion? At present, we also want to measure the Vpar in order to better fit the SE data. Any suggestions here? The problem is that we only observed tetramers in the crystals which were grown from PEG, which probably would keep the protein’s native oligomerization state. How could we interpret the discrepancy? Thanks again and welcome more comments and suggestions. Jerry Date: Thu, 2 Jun 2011 11:37:57 -0700 From: cabrautc...@yahoo.com Subject: Re: [ccp4bb] larger molecular weight shown by analytic ultracentrifugation To: CCP4BB@JISCMAIL.AC.UK Dear Kushol Jerry, I have to take exception to Kushol's contention about SV. As long as the buffer and protein parameters are correct and the sample is well behaved (i.e. not undergoing dynamic rearrangement on the time scale of the SV experiment, not aggregated, homogeneous), one can derive very accurate molar masses from SV, and it is far superior in this respect than SEC. However, as you aptly point out, the problem may lie in the sample's behavior. If the protein is populating multiple oligomeric states, or if it is undergoing a fast interconversion of such states, or if it is not pure, spurious masses may be calculated. If such pathologies are observed, it's not clear to me that a sedimentation equilibrium experiment would help. For a complicated interaction model, SE data (and AUC data in general) can be difficult to analyze, and some model assumptions are almost always present. So, the questions are: 1. Did Jerry run SV or SE? 2. If the former, then did he see a nice, single boundary, or a big smear? 3. If the latter, how were the data analyzed to come to his conclusion? Hopefully he can comment on these aspects. Cheerio, Chad From: Kushol Gupta kushol.gu...@gmail.com To: CCP4BB@JISCMAIL.AC.UK Sent: Fri, May 27, 2011 9:51:04 AM Subject: Re: [ccp4bb] larger molecular weight shown by analytic ultracentrifugation Hi Jerry – By AUC, do you mean sedimentation velocity (SV)? Both gel filtration and SV are not terribly great ways to determine precise molecular mass, especially if the macromolecule of interest is anisotropic in shape. In your SV values, do you see a large f/fo, or a broad distribution? Can you run a sedimentation equilibrium experiment? If you run HYDROPRO on your prospective oligomer structure, do you arrive at theoretical S and Rs values that jive with your solution data? A nice crosscheck you could do with the data in hand (if your measurements from both approaches were performed in the same buffer at the same temperature) is calculate the mass using the Siegel and Monty equation (Siegel, L. M., and Monty, K. J. (1966) Biochim. Biophys. Acta 112, 346–362), where the mass of the particle is calculated from Rs (from gel filtration) and the S(t,b) value from sedimentation velocity. Hope this helps, Kushol Kushol Gupta, Ph.D. Research Associate Van Duyne Laboratory - HHMI/Univ. of Pennsylvania School of Medicine kgu...@mail.med.upenn.edu 215-573-7260 / 267-259-0082 From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Jerry McCully Sent: Friday, May 27, 2011 10:17 AM To: CCP4BB@JISCMAIL.AC.UK Subject: [ccp4bb] larger molecular weight shown by analytic ultracentrifugation Dear ALL; I am sorry for this off-topic question about analytic ultracentrifugation (AUC). We recently solved one structure from crystals grown out of PEG4000 plus buffer. Since the crystal was grown from PEG, we think the protein would maintain its native oligomerization state as in the solution. Indeed, the crystal packing clearly shows a tetramer of this protein. However, both the gel-filtration and AUC showed larger molecular weight, roughly around 6-mer or 7-mer. IN the crystal lattice, we could not find any 6-mer or 7-mer state
[ccp4bb] larger molecular weight shown by analytic ultracentrifugation
Dear ALL; I am sorry for this off-topic question about analytic ultracentrifugation (AUC). We recently solved one structure from crystals grown out of PEG4000 plus buffer. Since the crystal was grown from PEG, we think the protein would maintain its native oligomerization state as in the solution. Indeed, the crystal packing clearly shows a tetramer of this protein. However, both the gel-filtration and AUC showed larger molecular weight, roughly around 6-mer or 7-mer. IN the crystal lattice, we could not find any 6-mer or 7-mer state. Could anyone give some comments on this discrepancy? Thanks a lot and have a nice weekend! Jerry McCully
[ccp4bb] insert a cleavage site between scondary structures
Dear ALL; One of our proteins will gain activities after cleavage between secondary structures(probably at three sites). In the intact structure, the N-terminal and C-terminal domains beside this cleavage site have extensive contacts. So far we are stilling looking for the enzymes that cut this protein in human, probably at disease situation. However, when we made the truncates, both the N-ter and C-ter domains become soluble aggregates even during expression at 20 degree, whereas the whole enzyme can be solubly expressed in E.coli. Now we are trying to design an artificial cleavage site, say TEV or thrombin site, to at least prove the idea at the biochemistry level. There are some short loops between strands and helices. Can anyone suggest a good way of adding in the cleavage site without changing the native structures? Thanks a lot. Jerry McCully
[ccp4bb] E. coli mutant strains
Dear ALL: Recently I am expressing one protein in BL21(DE3) and the protein undergoes N-terminal degradation. I am trying to keep this crucial N-terminal tail on the protein, which has MRS at the first 3 positions. Digging in to the literatures, I found the N-end rule, which tell that the proteins bearing N-terminal Arg or lys have much shorter half life. I am not sure whether this is my problem. However, I want to found one E. coli mutant strain that lacks aat and is unable to degrade N-end rule substrates that bear N-terminal Arg or Lys. Does anybody know such strains? Thanks a lot and have a nice weekend, Jerry,
[ccp4bb] increase the solubility of proteins
Dear ALL; Recently I am purifying a cell surface receptor by refolding of its inclusion bodies. Actually I can purify some functional monomers of this protein. However, the protein precipitates during the concentration. Interestingly, the precipitates look like crystals but not heavy aggregates. I guess the problem is due to the missing of glycosylation. Does anyone have suggestions to increase the current solubility? Thanks a lot, Jerry McCully
[ccp4bb] update-MBP fusion protein
Dear ALL; A few weeks ago, I posted my problem with MBP fusion protein. Thank folks very much for the help. Here is my latest result. 1) Shortening the linker region would signifcantly reduce the cleavage of target proteins from MBP; 2) Adding a C-terminal tag would minimize the degradation of target proteins and facilitate the purification; 3) Low temperature induction(18 degree) would significantly reduce the soluble aggregates; However, all the optimization procedures resulted in a ~150KD-200KD oligomer of MBP fusion protein after gel-filtration. Only a very small portion of MBP fusion protein exsited as monomers even in the expression condition with low temperature and 0.1mM IPTG. Does anyone experience the oligomerization of MBP fusion protein? Thanks again and have a nice weekend! Jerry McCully
[ccp4bb] autobuster problem
Dear ALL; Recently we updated our CCP4 to 6.1.13 with CCP4Interface2.0.6. However, there is an error when we ran autobuster. The error messenge from Buster: a check of the input MTZ file (test.mtz) gave an error - even after we tried to fix it. For details see above and ./mtzchk.2.log. If you don't want to do these checks (and want to use the MTZ file as it is): please use the command-line option UseMtzchk=no. You'd be doing this at your own risk and don't recommend this! The information in mtzchk.2.log: CCP4 library signal ccp4_general:Cannot open environ.def (Error) raised in ccp4fyp mtzdump: Cannot open environ.def mtzdump: Cannot open environ.def How can we fix the problem? Thanks a lot, Jerry McCully
[ccp4bb] **Possible spam**cryoprotetant for 35% Dioxane
Dear All; We just got some crystals from 35% (v/v) Dioxane. We are going to collect some data soon. Does anyone have the experience with the cryoprotectant in this condition? Thanks a lot, Jerry McCully
[ccp4bb] update--degradation of MBP fusion protein
Dear ALL; Firstly I'd like to thank folks for the various suggestions to handle the degradation of MBP fusion protein. According to these suggestions, I have tried shortening the linker between MBP and target protein. We can get decent yield of the full-length protein now. We still have a little question about the expression. Using BL21(De3 ) star cells at 37 degree, we got good soluble expression of the MBP fusion protein. However, the majority of the proteins were existing as soluble aggregates and only a small protion of proteins was purified as monomers. Does anyone have the experience to increase the yield of the monomeric proteins? Thanks a lot, Jerry McCully
[ccp4bb] degradation of MBP fusion protein
Dear All: In my case, a 15KD protein without disufide bonds was expressed as inclusion bodies in E.coli but can be refolded as monomers with a very low solubility. Adding glycerol did not help so far. To increase the solubility, I fused my protein with maltose binding protein. After fusion, the protein can be solublly expressed but still in an aggregated form. There is also another problem. A large part of the MBP fusion protein was degraded somehow even at the condition of low temperature(18 degree) and low IPTG induction (0.1mM), which resulted in a truncated form of this protein, 30 out of 140 residues. However, this truncated form was monomeric. Based on this observation, I tried several short truncates as well, such as 80, 90, or 120 residues. But, after affinity purification, I got very similar results as mentioned above. I checked the sequence of my protein and there is no protease-sensitive site based on some protease-cutting-site-prediction servers. So, how can I deal with the degradation problem? and, how can I minimize the aggregation during expression? Any suggestions will be highly appreciated. Have a nice day! Jerry McCully By the way, thank folks for the answers of my another question about setting up view point in Pymol along axis in the unit cell.
[ccp4bb] pyMol--set up view through one axis of the unit cell
Dear All, It is a Pymol question. How can I set up the view through one axis of the unit cell? Thanks a lot and have a nice weekend, Jerry
[ccp4bb] autoBuster--Rfree_falg
Dear All: I am currently using autoBuster to refine my structure. I notice that autobuster generates a new column in the MTZ data file with the label of FreeR_flag. Because my MTZ file has already had the FreeRflag, I am wondering whether autoBuster generated a new set of Rfreeflags of just renamed the existing FreeRflags. Can anyone give some comments? Thanks a lot, Jerry
[ccp4bb] to what extent bacterial expression reveals the native oligomerization state of mammalian proteins.
Dear ALL: I am sorry for this stupid question. I guess bacterial expression system is still most popular in structural biology. If you get a very good soluble E.coli expression of a human protein without disulfide bonds, to what extent do you believe that the oligomerization state of this bacterial expression will reflect the real physiological state of this protein in humans? Can someone give comments or refer some literature? Thanks a lot, Jerry McCully _ Hotmail has tools for the New Busy. Search, chat and e-mail from your inbox. http://www.windowslive.com/campaign/thenewbusy?ocid=PID28326::T:WLMTAGL:ON:WL:en-US:WM_HMP:042010_1
Re: [ccp4bb] to what extent bacterial expression reveals the native oligomerization state of mammalian proteins.
A little update on my own project: It is a secreted protein without any modification reported. Size exclusion shows that it is an oligomer. CD spectrum shows well-defined secondary structure. It is stable and soluble. It may have different states in diseases' condition. Now I was trying to figure out the native state of this protein. As told by folks on CCP4bb, Most likely, the bacterial expression reveals its original state. Am I right? Thanks a lot, Jerry Date: Fri, 28 May 2010 11:40:31 -0700 From: for-crystallizai...@hotmail.com Subject: [ccp4bb] to what extent bacterial expression reveals the native oligomerization state of mammalian proteins. To: CCP4BB@JISCMAIL.AC.UK Dear ALL: I am sorry for this stupid question. I guess bacterial expression system is still most popular in structural biology. If you get a very good soluble E.coli expression of a human protein without disulfide bonds, to what extent do you believe that the oligomerization state of this bacterial expression will reflect the real physiological state of this protein in humans? Can someone give comments or refer some literature? Thanks a lot, Jerry McCully Hotmail has tools for the New Busy. Search, chat and e-mail from your inbox. Learn more. _ The New Busy is not the old busy. Search, chat and e-mail from your inbox. http://www.windowslive.com/campaign/thenewbusy?ocid=PID28326::T:WLMTAGL:ON:WL:en-US:WM_HMP:042010_3
[ccp4bb] how to make cholesterol solution
Dear ALL: Sorry for this kind of off-topic question. I am going to co-crystallize one protein with cholesterol. I read some papers saying that their protein can be pre-incubated with 1mM cholesterol in the presence of 5% (v/v) ethanol. TO do so, I first dissolved cholesterol in 100% ethanol at a concentration of 10mM. However, it is very difficult to make the dilution into 5% ethanol either just in water or some buffers. Does anyone have such experience to make cholesterol solution in normal buffers plus some ethanol? Thanks a lot, Jerry McCully _ The New Busy think 9 to 5 is a cute idea. Combine multiple calendars with Hotmail. http://www.windowslive.com/campaign/thenewbusy?tile=multicalendarocid=PID28326::T:WLMTAGL:ON:WL:en-US:WM_HMP:042010_5
[ccp4bb] crystallization of highly-glycosylated protein complex-avoid phase separation
Dear ALL: Recently we've been trying hard to crystallize a highly glycosylated protein complex ( 30% percent of carbohydrate in the total 120KD molecular weight). IT is a high affinity protein complex. One component can be crystallized in high salt condition and the other can be crystallized in PEG. Through screening, we happened to get some very ugly crystals in PEG condition using gel-fil purified complex sample. The problem is that it is very hard to repeat the screening condition. In contrast, it is very easy to get phase separation in the drop although we tried to optimize the protein and precipitant concentration. We tried to de-glycosylated using PNGase and EndoH but failed in non-denaturing condition. Hampton additive screen did not help either. We tried seeding several times but so far we have not got any better luck. Can anyone give some guidance here? Thanks a lot, Jerry McCully _ Hotmail: Powerful Free email with security by Microsoft. http://clk.atdmt.com/GBL/go/201469230/direct/01/
[ccp4bb] phenix refinement --set cif for sugar links
Dear folks:
I am currently using Phenix to refine a structure that has many
carbohydrate chains on it.
I created the cif file according to an old message from Dr.Ralf W like
the following:
refinement.pdb_interpretation {
apply_cif_link {
data_link = NAG-ASN
residue_selection_1 = chain A and resname NAG and resid 900
residue_selection_2 = chain A and resname ASN and resid 329
}
apply_cif_link {
data_link = NAG-NAG-b-D
residue_selection_1 = chain A and resname NAG and resid 901
residue_selection_2 = chain A and resname NAG and resid 900
}
apply_cif_link {
data_link = NAG-MAN-b-D
residue_selection_1 = chain A and resname MAN and resid 902
residue_selection_2 = chain A and resname NAG and resid 901
}
}
However, there was an error: Missing CIF link : data_link_NAG-NAG-b-D
please check for spelling errors or specify the file name with the link as an
additional argument.
How can I fix this problem? Thanks a lot and have a nice holiday season.
Jerry
_
Chat with Messenger straight from your Hotmail inbox.
http://www.microsoft.com/windows/windowslive/hotmail_bl1/hotmail_bl1.aspx?ocid=PID23879::T:WLMTAGL:ON:WL:en-ww:WM_IMHM_4:092009
[ccp4bb] Difficult molecular replacement in R32 with pseudo translation
Dear All: I got a problem with a data set in R32 space group with a resolution of 2.6. Pointless indicated that the space group was R32 and phenix triage showed that there was a pseudotranslation in the ASU. My protein is a hexamer and the matthew coeff. showed that there should just be two monomers in one ASU of R32. However, phaser in R32 and Molrep in R32 gave different solutions because Molrep used the pseudo-translation. I am not sure which one was correct because refinement of both solutions get stuck around 35% for Rfactor. I tried the molecular replacement in P1 and I got good solutions in Phaser. I think they are correct solutions because my protein was a hexamer and the crystal packing in P1 was formed by hexamers. How can I get correct solutions in R32 and finish the refinement? Many thanks in advance. Jerry McCully _ Your E-mail and More On-the-Go. Get Windows Live Hotmail Free. http://clk.atdmt.com/GBL/go/171222985/direct/01/
[ccp4bb] FW: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections.
Dear ALL: Thanks a lot for the valuable guidance. Here are some updates of my problem. The current model is 100% complete now. The two good molecules fit into the density very well. I am currently using P2221 space group. I split the data according to suggestions I got using mtzutils. Imean for K=2n : 885.3 SigImean: 30.1 Imean for K=2n+1: 82.1 Sigmean: 12.2 The weak refelections are about 10% intense of the strong ones. I ran Phaser with these two data sets and again there is a slight shift (1A) between the solutions. The initial rigid body refinement by Refmac shows the following statistics for all the four molecules in the ASU. strong data, k=2n, Rfactor28.05%, Rfree29.7% weak data, k=2n+1 Rfactor41.47%, Rfree41.04% If I use all my data, the Rfactor is around 35%. I tried to refine all the 4 molecules after transforming the two good ones to get the other two using the vector (0.0 0.5 0.0) revealed by native patterson. It was still stuck around 35%. It seems that the refinement can not give very accurate postions for the other two though more or less correct. How can I proceed? If I reduce the b axis half and reindex the data, I guess I will get very good refinement statistics. If I return to the larger unit cell, what will happen? Can the refinement in reduced unit cell give accurate positions of the other two? Thanks again for your suggestions. Jerry Date: Mon, 7 Sep 2009 11:22:33 +0100 From: c...@ysbl.york.ac.uk Subject: Re: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections. To: CCP4BB@JISCMAIL.AC.UK Ben Ammar Youssef wrote: Hi all, I just want to ask another question related to this topic: Based on the example given by Jerry McCully and if the data has alternate strong and weak reflections, how can we split it into two different files; one containing the weak reflections and the other containing the strong reflections? Youssef mtzutils keyword RZONE 0 1 0 2 0 ~ # gives reflections with k = 2n RZONE 0 1 0 2 1 # gives reflections with k = 2n+1 Eleanor _ Hotmail® is up to 70% faster. Now good news travels really fast. http://windowslive.com/online/hotmail?ocid=PID23391::T:WLMTAGL:ON:WL:en-US:WM_HYGN_faster:082009
Re: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections.
From: for-crystallizai...@hotmail.com To: yous...@ri.ncvc.go.jp Subject: RE: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections. Date: Fri, 4 Sep 2009 07:36:34 -0700 Dear ALL; I am sorry for being silent because I went out of town for a meeting. According to Eleanor's suggestion, I checked the native patterson. Actually it turns out that there is a translation along b axis (0.0 0.5 0.0), which is slightly different from Phaser solution(0.02 0.5 0.0). Then I translated my two good ones using this vector. However, it did not help dramatically although I have not finished the refinement. So, what I should do now to further lower the R factors? Thanks a lot, Jerry Date: Fri, 4 Sep 2009 21:54:47 +0900 From: yous...@ri.ncvc.go.jp Subject: Re: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections. To: CCP4BB@JISCMAIL.AC.UK One paper in Acta. Cryst. (2006) D62, 1369-1374 described the same problem of pseudo-symmetry. To lower the Rfactor they used (h+k+l=2n+1) odd reflections for rigid body refinement and (h+k+l=2n) even reflections for restrained refinement. By this way they could decrease R/Rfree from (0.425/0.434) to (0.235/0.311). Youssef Anastassis Perrakis wrote: On Sep 4, 2009, at 11:04, Ben Ammar Youssef wrote: Hi all, I just want to ask another question related to this topic: Based on the example given by Jerry McCully and if the data has alternate strong and weak reflections, how can we split it into two different files; one containing the weak reflections and the other containing the strong reflections? I guess what you mean is to separate different layers along a reciprocal direction in two files? (and not simply strong vs weak reflections ...) These are be possible to do in sftools with a bit of playing and rtfm, but I am not sure where it would lead you. Tassos Youssef *P** **please don't print this e-mail unless you really need to* Anastassis (Tassos) Perrakis, Principal Investigator / Staff Member Department of Biochemistry (B8) Netherlands Cancer Institute, Dept. B8, 1066 CX Amsterdam, The Netherlands Tel: +31 20 512 1951 Fax: +31 20 512 1954 Mobile / SMS: +31 6 28 597791 Get back to school stuff for them and cashback for you. Try Bing now. _ Windows Live: Keep your friends up to date with what you do online. http://windowslive.com/Campaign/SocialNetworking?ocid=PID23285::T:WLMTAGL:ON:WL:en-US:SI_SB_online:082009
Re: [ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections
Dear all: Thanks a lot for the valuable suggestions I've got so far. I will try TLS refinement, anisotropy and super lattice check and then get back to you all with more information. Thanks again and best regards, Jerry _ With Windows Live, you can organize, edit, and share your photos. http://www.windowslive.com/Desktop/PhotoGallery
[ccp4bb] Rfactor got stuck with a data having alternate strong and weak reflections.
Dear all: I am currently refining a structure solved by MAD and somehow the R factor got stuck around 30% with 2.2 resolution. There are four molecules in one ASU. Two had very good density map and the other two were not equally good. I tried using NCS during refinement but it did not help much. Then I checked my data. Actually I found that there are alternate layers of strong and weak reflections. THe crystal is in a thin-plate shape with orthorombic space group. Then I looked at my molecular replacement solution from Phaser using my native data. Actually phaser gave two sets of solutions, which showed slightly different positions. You can also see that there is a translation inside the same set of solution. SOLU SET RFZ=12.8 TFZ=21.4 PAK=0 LLG=452 RFZ=10.7 TFZ=47.9 PAK=0 LLG=1693 RFZ=13.0 TFZ=47.6 PAK=0 LLG=2791 RFZ=10.7 TFZ=46.1 PAK=0 LLG=4045 SOLU 6DIM ENSE ensemble1 EULER 184.0520.185 175.770 FRAC -0.49889 -0.00218 -0.0 SOLU 6DIM ENSE ensemble1 EULER 225.1160.167 134.696 FRAC -0.47056 0.49706 0.00051 SOLU 6DIM ENSE ensemble1 EULER 359.333 31.677 180.633 FRAC 0.75769 -0.71475 -0.14004 SOLU 6DIM ENSE ensemble1 EULER 359.373 31.969 180.711 FRAC 0.73074 -0.21423 -0.14108 SOLU SET RFZ=12.8 TFZ=21.4 PAK=0 LLG=452 RFZ=10.7 TFZ=47.9 PAK=0 LLG=1693 RFZ=13.0 TFZ=47.6 PAK=0 LLG=2791 RFZ=10.7 TFZ=47.3 PAK=0 LLG=4042 SOLU 6DIM ENSE ensemble1 EULER 213.1150.173 146.741 FRAC -0.49931 -0.00269 0.00045 SOLU 6DIM ENSE ensemble1 EULER 248.1730.254 111.665 FRAC -0.47091 0.49661 0.00101 SOLU 6DIM ENSE ensemble1 EULER 359.399 31.602 180.578 FRAC 0.75808 -0.71455 -0.13980 SOLU 6DIM ENSE ensemble1 EULER 359.378 31.255 180.361 FRAC 0.78370 -0.21555 -0.13830 I remember there is a discussion in CCP4bb about the same topic with the focus of pseudo-symmetry or translational pseudo-symmetry. Can anybody give some troubleshooting about my issue? Thanks a lot and have a nice weekend, Jerry McCully _ Windows Live: Keep your friends up to date with what you do online. http://windowslive.com/Campaign/SocialNetworking?ocid=PID23285::T:WLMTAGL:ON:WL:en-US:SI_SB_online:082009
[ccp4bb] model completion after MR with partial model
Dear ALL: Thanks a lot for the input about EPMR statistics. After struggling for several days, I finally got a promising solution from Phaser with a partial poly-Ala model with 50% completeness. two molecules in one ASU: solu set RFZ=4.2 TFZ=5.9 PAK=0 LLG=23 RFZ 3.8 TFZ=19.0 PAK=3 LLG=110 LLG=123 After some initial refinement, some side chains have been assigned with R-factor 50% and R-free 52%. In addition, there are some extra density at two termini. We tried NCS averaging to improve the map but it did not help that much. Now we are trying to build more residues in with 2.6A data. Any suggestions will be highly appreciated. Jerry McCully _ Windows Live™ Hotmail®: Celebrate the moment with your favorite sports pics. Check it out. http://www.windowslive.com/Online/Hotmail/Campaign/QuickAdd?ocid=TXT_TAGLM_WL_QA_HM_sports_photos_072009cat=sports
[ccp4bb] EPMR statistics
Dear ALL: We are trying to do a molecular replacement using EPMR. IT is weird that we got high CC(0.56) but with high R factor about 0.89 as well. How can we optimize our EPMR trials to get a definitive correct solutions? Thanks a lot for the help. Have a nice weekend! Jerry McCully _ Lauren found her dream laptop. Find the PC that’s right for you. http://www.microsoft.com/windows/choosepc/?ocid=ftp_val_wl_290
[ccp4bb] FW: EPMR statistics
Dear ALL: We are trying to do a molecular replacement using EPMR. IT is weird that we got high CC(0.58) but with high R factor about 0.89 as well. The second tier of solutions have cc about 0.54 and R factor about 0.95. How can we optimize our EPMR trials to get a definitive correct solutions? Thanks a lot for the help. Have a nice weekend! Jerry McCully Lauren found her dream laptop. Find the PC that’s right for you. _ Lauren found her dream laptop. Find the PC that’s right for you. http://www.microsoft.com/windows/choosepc/?ocid=ftp_val_wl_290
Re: [ccp4bb] EPMR statistics
= 0.505 R= 0.972 Soln 61 Rot= 160.22 73.76 134.66 Trn= 49.73 11.16 80.93 CC= 0.514 R= 0.954 Soln 62 Rot= 326.12 30.59 322.96 Trn= 17.17 29.49 124.50 CC= 0.517 R= 0.968 Soln 63 Rot= 325.51 114.10 237.26 Trn= -0.05 22.88 39.52 CC= 0.544 R= 0.954 Soln 64 Rot= 347.56 59.67 144.34 Trn= -7.90 63.37 43.06 CC= 0.504 R= 0.986 Soln 65 Rot= 332.84 51.90 178.31 Trn= -0.47 12.68 33.40 CC= 0.553 R= 0.932 Soln 66 Rot= 123.20 18.17 288.10 Trn= -10.09 53.83 49.89 CC= 0.536 R= 0.922 Soln 67 Rot= 150.99 123.64 239.32 Trn= 57.30 34.26 10.19 CC= 0.555 R= 0.946 Soln 68 Rot= 145.64 117.44 230.02 Trn= 57.11 36.41 10.73 CC= 0.547 R= 0.945 Soln 69 Rot= 174.45 106.99 71.67 Trn= 28.12 10.61 81.88 CC= 0.530 R= 0.972 Soln 70 Rot= 348.09 72.76 122.17 Trn= 8.09 35.25 121.08 CC= 0.543 R= 0.956 Soln 71 Rot= 19.70 39.36 341.98 Trn= 59.17 48.15 80.93 CC= 0.505 R= 0.965 Soln 72 Rot= 112.93 87.39 140.76 Trn= -18.28 52.09 53.80 CC= 0.520 R= 0.935 Soln 73 Rot= 325.94 115.01 14.38 Trn= 26.64 80.82 112.90 CC= 0.496 R= 0.999 Soln 74 Rot= 295.27 162.24 121.66 Trn= 4.54 45.62 124.07 CC= 0.536 R= 0.918 Soln 75 Rot= 325.74 103.24 220.82 Trn= 27.37 27.74 75.14 CC= 0.545 R= 0.938 Soln 76 Rot= 311.21 78.27 167.47 Trn= 20.26 61.75 43.16 CC= 0.528 R= 0.957 Soln 77 Rot= 344.95 84.35 242.92 Trn= -19.42 74.37 45.33 CC= 0.521 R= 0.961 Soln 78 Rot= 328.15 106.52 359.28 Trn= 47.27 48.55 72.53 CC= 0.516 R= 0.960 Soln 79 Rot= 332.49 49.11 304.20 Trn= 8.05 23.32 14.71 CC= 0.524 R= 0.963 Soln 80 Rot= 325.35 113.94 357.59 Trn= -27.00 69.82 39.56 CC= 0.544 R= 0.954 Soln 81 Rot= 331.75 98.98 99.36 Trn= -16.69 41.91 126.29 CC= 0.520 R= 0.969 Soln 82 Rot= 333.69 98.05 119.24 Trn= 30.23 79.72 92.38 CC= 0.531 R= 0.943 Soln 83 Rot= 138.62 111.17 226.71 Trn= 47.49 64.93 115.99 CC= 0.508 R= 0.959 Soln 84 Rot= 326.14 107.62 353.07 Trn= 37.82 0.17 1.65 CC= 0.534 R= 0.978 Soln 85 Rot= 340.41 63.67 12.05 Trn= 16.28 64.65 51.04 CC= 0.539 R= 0.949 Soln 86 Rot= 343.34 77.77 238.53 Trn= 26.52 34.59 129.27 CC= 0.584 R= 0.888 Soln 87 Rot= 342.78 98.22 164.40 Trn= 12.43 43.05 38.46 CC= 0.510 R= 0.974 Soln 88 Rot= 167.35 105.70 302.94 Trn= 25.05 76.73 96.06 CC= 0.547 R= 0.961 Soln 89 Rot= 288.16 104.18 0.96 Trn= 55.58 50.82 12.16 CC= 0.502 R= 0.958 Soln 90 Rot= 164.01 113.60 62.68 Trn= -10.46 44.75 0.60 CC= 0.520 R= 0.962 Soln 91 Rot= 166.00 111.67 63.17 Trn= 70.94 17.37 97.57 CC= 0.542 R= 0.971 Soln 92 Rot= 321.79 67.76 78.97 Trn= 67.19 0.14 37.18 CC= 0.527 R= 0.946 Soln 93 Rot= 300.64 74.42 26.24 Trn= 73.71 0.29 33.57 CC= 0.514 R= 0.967 Soln 94 Rot= 144.86 68.80 303.85 Trn= 46.47 57.94 91.04 CC= 0.544 R= 0.952 Soln 95 Rot= 167.74 99.32 54.48 Trn= 5.67 76.04 2.07 CC= 0.548 R= 0.948 Soln 96 Rot= 327.22 104.42 342.85 Trn= 9.89 16.47 31.50 CC= 0.546 R= 0.941 Soln 97 Rot= 290.59 90.78 145.21 Trn= 10.49 17.05 33.35 CC= 0.523 R= 0.961 Soln 98 Rot= 295.07 125.26 327.26 Trn= -26.47 64.07 32.22 CC= 0.531 R= 0.954 Soln 99 Rot= 150.61 76.41 323.25 Trn= 43.58 6.38 4.41 CC= 0.520 R= 0.969 Soln 100 Rot= 350.86 72.88 229.34 Trn= 25.41 29.56 78.19 CC= 0.529 R= 0.958 From: b...@ruppweb.org To: for-crystallizai...@hotmail.com Subject: RE: [ccp4bb] EPMR statistics Date: Fri, 17 Jul 2009 13:43:23 -0700 How’s the solution landscape look? Discriminate or flat? The R is scaling dependent in contrast to CC, so for incomplete models it can be nonsensical. BR From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of Jerry McCully Sent: Friday, July 17, 2009 10:46 AM To: CCP4BB@JISCMAIL.AC.UK Subject: [ccp4bb] EPMR statistics Dear ALL: We are trying to do a molecular replacement using EPMR. IT is weird that we got high CC(0.56) but with high R factor about 0.89 as well. How can we optimize our EPMR trials to get a definitive correct solutions? Thanks a lot for the help. Have a nice weekend! Jerry McCully Lauren found her dream laptop. Find the PC that’s right for you. _ Lauren found her dream laptop. Find the PC that’s right for you. http://www.microsoft.com/windows/choosepc/?ocid=ftp_val_wl_290
[ccp4bb] MAD wavelength
Dear All: Next week we are going to try some seleno-Met labeled crystals. We checked the literature to try to find out the peak wavelength that has been used for SAD or MAD data collection. But they are slightly different ( may be 50 ev) in different papers. I guess this is due to the discrepancy between the fluorescence scanning and the theoretical vaules of f' and f''. When we collect the data, which wavelength should we use? Should we trust the scanning results? Thanks a lot for your comments. All the best, Jerry McCully _ Insert movie times and more without leaving Hotmail®. http://windowslive.com/Tutorial/Hotmail/QuickAdd?ocid=TXT_TAGLM_WL_HM_Tutorial_QuickAdd_062009
[ccp4bb] space group R32: H settings
Dear All: I think this is an old topic. But I could not find the previous discussion about it. Therefore, I am asking for your help again here. My data were processed as primitive rhombohedral R32 using HKL2000. If I am not wrong, each (h, k, l ) in the .sca file was indexed in the H settings, revealed by the .x file of each images. The cell dimensions given in the head of .sca file were a little interesting: 1 -985 60.01 60.01 120.34 90 90 120 r32 I read the HKL2000 manual. It is indeed the R32 space group given in H settings(space group number 155). However, when I imported .sca file into ccp4, here came a failure: error in space group or cell dimensions. Then I checked the symop.ilb file in ccp4-6.0.2. The primitive rhombohedral in H setting was defined as H32 with 18 symmetric points. I can let the scalepack2MTZ work just by typing the space group as H32. I am not sure whether this is a correct way to import the data because when I was running ShelxC/D/E in ccp4 directly using data in scalepack format, the symmetry was not right in the logfile. Can somebody give some guidance here? Thanks a million. Jerry McCully _ Hotmail® has ever-growing storage! Don’t worry about storage limits. http://windowslive.com/Tutorial/Hotmail/Storage?ocid=TXT_TAGLM_WL_HM_Tutorial_Storage_062009
[ccp4bb] deglycosylation of proteins expressed in mammalian cells at room temperature or lower
Dear All: Recent we expressed one protein using mammalian cells but this protein was highly glycosylated (30% of the total molecular weight). We want to remove some carbohydrate by enzymatic digestion for the convenience of crystallization. However, this protein tends to aggregate at 37 degree. I am not sure whether EndoH and PNGase can work at 4 degree. Can anyone give some suggestion? Thanks a lot, Jerry McCully _ Hotmail® has ever-growing storage! Don’t worry about storage limits. http://windowslive.com/Tutorial/Hotmail/Storage?ocid=TXT_TAGLM_WL_HM_Tutorial_Storage_062009
[ccp4bb] how to optimize crystal without sharp boundary
Dear All: Recently we got some crystals from ammonium sulfate and PEG400. They look like hexagonal single crystals but without sharp boundary. They did not diffract well. This protein can also be crystallized from PEG6000 in star shape. We tried hampton additive screen but can not turn them into single crystals. Can anyone give some suggestions to optimize such crystals? Thanks a lot, Jerry _ Hotmail® goes with you. http://windowslive.com/Tutorial/Hotmail/Mobile?ocid=TXT_TAGLM_WL_HM_Tutorial_Mobile1_052009
[ccp4bb] how to purify protein in its native form
Hi, All: Although it is off-topic, definitely I think I can get some help here because we crystallographers are dealing with protein purification almost every day. My protein was expressed in E.coli as a soluble octamer with or without his-tag revealed by gel-filtration. For the his-tagged protein, the final product is an octamer after Ni-column and gel-fil. However, purification of the non-tagged protein results in a tetramer because of a partially denatured condition. When I tested the enzymatic activity , it turns out the tetramer was active although both of them can be crystallized. Now I am wonderring whether its native form in human is an octamer or tetramer. I am planning to purify a little protein from human cells to verify its native form. Can anybody recommend some protocols? Thanks a million, Jerry McCully _ Rediscover Hotmail®: Now available on your iPhone or BlackBerry http://windowslive.com/RediscoverHotmail?ocid=TXT_TAGLM_WL_HM_Rediscover_Mobile1_042009
[ccp4bb] Pymol movie ration along any axis
Hi , all: Sorry for this off-topic question. When you make movies, Pymol usually allows you rotate molecules along x, y, or z axis. The view point is always from Z axis. Does anyone have this experience of rotating molecules along any other specified axis and keeping the same view point as usual? Thanks a lot. Jerry _ Use video conversation to talk face-to-face with Windows Live Messenger. http://www.windowslive.com/messenger/connect_your_way.html?ocid=TXT_TAGLM_WL_Refresh_messenger_video_072008
Re: [ccp4bb] protein-protein docking programs
Hi, All: Thanks a lot for the prompt reply from all of you. Probably I have another problem. My complex was mediated by two separated interfaces between the receptor and two subunits of the ligand. I tried HEX and the ClusPro server to dock the homologous ligand. however, the docking results were focused on one subunit. How can I restrict the docking around these two interfaces? Or I just superimpose the ligands and do some local minimization to get kind of detailed binding model of the receptor. Thanks a lot again, Jerry From: [EMAIL PROTECTED] To: [EMAIL PROTECTED] Subject: Re: [ccp4bb] protein-protein docking programs Date: Fri, 2 May 2008 18:11:57 +0200 Try HADDOCK. I think the way to use it will be obvious when you read the doc/papers, but do not hesitate to ask me if I can help more.I think its kind of ideal for your case. A. On May 2, 2008, at 17:18, Jerry McCully wrote:Hi, All: Recently we solved a complex structure between two proteins, which indicated the interaction was kind of rigid. Therefore we want to test the binding mode of the receptor with another homologous ligand(very similar structure, RMSD 2.4 angstrom). Can somebody recommend a sophisticated docking program to do this? Thanks a lot. Jerry McCully With Windows Live for mobile, your contacts travel with you. Connect on the go. _ With Windows Live for mobile, your contacts travel with you. http://www.windowslive.com/mobile/overview.html?ocid=TXT_TAGLM_WL_Refresh_mobile_052008
[ccp4bb] protein-protein docking programs
Hi, All: Recently we solved a complex structure between two proteins, which indicated the interaction was kind of rigid. Therefore we want to test the binding mode of the receptor with another homologous ligand(very similar structure, RMSD 2.4 angstrom). Can somebody recommend a sophisticated docking program to do this? Thanks a lot. Jerry McCully _ With Windows Live for mobile, your contacts travel with you. http://www.windowslive.com/mobile/overview.html?ocid=TXT_TAGLM_WL_Refresh_mobile_052008
Re: [ccp4bb] FW: [ccp4bb] salt sensitive complex
Dear All: I am sorry that I did not know the policy. And thanks a lot for the kind reminder. Jerry CC: CCP4BB@JISCMAIL.AC.UK From: [EMAIL PROTECTED] Subject: Re: [ccp4bb] FW: [ccp4bb] salt sensitive complex Date: Thu, 31 Jan 2008 09:37:01 +0100 To: [EMAIL PROTECTED] Dear all -Sorry to intervene on a 'book keeping' issue, but indeed over the last few months an increasing number of people (Jerry is not the first, so Jerry please do not take it personally) attach pictures etc. I think in a bb standard practice dictates to only use text - if illustrations are needed to explain the problem, you can put them in eg a web site.Some text like that was in the 'code of conduct' off ccp4bb in the past, but I could no longer find it.Thus apologies if I am wrong and policies have changed, but maybe the ccp4 crowd could tell us what is the suggested policy.And, if you really want to send an image please do bother to make it small. The initial posting had a 630k image, which it took me 1 min to make 20k and it still makes the point (attached so I can also violate the rules i am suggesting - I love inconsistency).Thanks, Tassos _ Connect and share in new ways with Windows Live. http://www.windowslive.com/share.html?ocid=TXT_TAGHM_Wave2_sharelife_012008
Re: [ccp4bb] salt sensitive complex
Dear All: Firstly I would like to thank many folks here for giving me great ideas several days ago. The following are some updates for this question. I did ITC experiments again using 25mMTris(pH8), 60mM NaCl(low salt condition). But things still turn out to be a little weird. I increased the concentration of both proteins(60uM in the cell and 1200uM in the syringe). At the end of the ITC, I saw a little of precipitation of both the proteins. Fortunately I can roughly fit the curve this time. However, the heat was still low, around 1Kcal/mole of per injectant. I am not sure about the fitting statistics. N 1.10 ±0.17 K 1.49E5 ±1.5E5 DH -893.5 ±213 DS 20.7Was the enthalpy was offset by the ionization of Tris buffer?Can I use Hepes buffer around pH8 to do ITC? Welcome any comments about the statistics and suggestions on how to improve the ITC experiments.have a nice weekend. Jerry Jerry McCully wrote: Dear All: Recently I am pursuing the crystallziation of a complex formd by two individual proteins and I met several interesting problems though they are kind of off-topic. Any suggestions for these problems will be highly appreciated. BIAcore showed about submicromolar affinity(both Kinetic and steady-state fitting) for these two proteins in the complex. However, precipitates immediately appeared when these two proteins were mixed together even at 10uM(0.3mg/ml) concentration in the condition of low salt(less than 20mM NaCl). By the way, these two proteins completely precipitated when the molar ratio is 1:1 in this condition. THerefore, I increased the salt concentraion step by step and finally I can keep both of them soluble in the solution with 25mM Tris(pH8) and 60mM NaCl(the minimum of salt concentration). Wierd thing happened when ITC experiments were carried out to confirm the binding affinity. 20uM in the sample cell and 200uM in the syringe could not give enough heat for a good curve fitting. The optimistic estimation of the affinity is lower than 5uM, which is much lower than the affinity given by BIAcore in the same buffer(25mM Tris plus 150mM NaCl). Now I am suspecting the capability of the interaction between these two proteins. However, I can not explain why these two guys precipitated stoichiometrically if they do not interact with each other. Is the complex salt-sensitive therefore there was just minor binding in the high-salt condition revealed by ITC? I am planning to do the ITC again in the condition of 25mMTris and 60mM NaCl. What if the affinity given by ITC is still much lower than that by BIAcore. Which one should I choose to believe? Are there some better ways that I can validate the binding affinity? Thanks again for your great ideas. Jerry McCully Need to know the score, the latest news, or you need your Hotmail®-get your fix. Check it out. http://www.msnmobilefix.com/Default.aspx -- Edwin Pozharski, PhD, Assistant Professor University of Maryland, Baltimore -- When the Way is forgotten duty and justice appear; Then knowledge and wisdom are born along with hypocrisy. When harmonious relationships dissolve then respect and devotion arise; When a nation falls to chaos then loyalty and patriotism are born. -- / Lao Tse / _ Connect and share in new ways with Windows Live. http://www.windowslive.com/share.html?ocid=TXT_TAGHM_Wave2_sharelife_012008
[ccp4bb] salt sensitive complex
Dear All: Recently I am pursuing the crystallziation of a complex formd by two individual proteins and I met several interesting problems though they are kind of off-topic. Any suggestions for these problems will be highly appreciated. BIAcore showed about submicromolar affinity(both Kinetic and steady-state fitting) for these two proteins in the complex. However, precipitates immediately appeared when these two proteins were mixed together even at 10uM(0.3mg/ml) concentration in the condition of low salt(less than 20mM NaCl). By the way, these two proteins completely precipitated when the molar ratio is 1:1 in this condition. THerefore, I increased the salt concentraion step by step and finally I can keep both of them soluble in the solution with 25mM Tris(pH8) and 60mM NaCl(the minimum of salt concentration). Wierd thing happened when ITC experiments were carried out to confirm the binding affinity. 20uM in the sample cell and 200uM in the syringe could not give enough heat for a good curve fitting. The optimistic estimation of the affinity is lower than 5uM, which is much lower than the affinity given by BIAcore in the same buffer(25mM Tris plus 150mM NaCl). Now I am suspecting the capability of the interaction between these two proteins. However, I can not explain why these two guys precipitated stoichiometrically if they do not interact with each other. Is the complex salt-sensitive therefore there was just minor binding in the high-salt condition revealed by ITC? I am planning to do the ITC again in the condition of 25mMTris and 60mM NaCl. What if the affinity given by ITC is still much lower than that by BIAcore. Which one should I choose to believe? Are there some better ways that I can validate the binding affinity? Thanks again for your great ideas. Jerry McCully _ Need to know the score, the latest news, or you need your Hotmail®-get your fix. http://www.msnmobilefix.com/Default.aspx
[ccp4bb] protein precipitated when they formed a complex
Dear All, Recently I posted a question about protein induced protein precipitation. Firstly I'd like to thank many folks for their good ideas. Later on I did a titration experiment with one protein concentration fixed at 0.4mg/ml(about 10uM). Now it is clear that these two proteins stoichiometrically precipitated when they formed a 1:1 complex. The excess of individual proteins was just soluble in the buffer. How come these two proteins co-precipitated when they formed a complex? Does anyone know some methods to keep the complex soluble enough for crystallization? By the way, there is some additional information about the individual components. One has a pI of 6.5, and the other has a pI of 10. Any suggestions will be highly appreciated. Jerry McCully _ Get the power of Windows + Web with the new Windows Live. http://www.windowslive.com?ocid=TXT_TAGHM_Wave2_powerofwindows_122007
[ccp4bb] protein induced precipitation of proteins?
Dear All, Recently I was trying to crystallize a complex of two proteins(40kD vs 20kD). TO my surprise, precipitates immediately appeared in the solution even when I mixed these two proteins at about 1mg/ml. However, the individual proteins were just soluble and stable in the same buffer. From the binding studies I knew that the affinity between them was lower than 1uM therefore I could not purify the complex by gel-filtration. I checked the precipitates by SDS-gel. The majority of the precipitates were the bigger protein. I'd like to mention that the smaller one was a protein with the pI above 10. Did the smaller protein induce the precipitation of the bigger one? Does anybody know some tricks to avoid the precipitation so that the protein complex could be concentrated enough for the crystallization trials? Many thanks in advance. Jerry McCully _ Your smile counts. The more smiles you share, the more we donate. Join in. www.windowslive.com/smile?ocid=TXT_TAGLM_Wave2_oprsmilewlhmtagline
[ccp4bb] FW: protein induced precipitation of proteins?
sorry for the repeats. Jerry From: [EMAIL PROTECTED] To: [EMAIL PROTECTED] Subject: protein induced precipitation of proteins? Date: Mon, 3 Dec 2007 09:25:51 -0800 Dear All, Recently I was trying to crystallize a complex of two proteins(40kD vs 20kD). TO my surprise, precipitates immediately appeared in the solution even when I mixed these two proteins at about 1mg/ml. However, the individual proteins were just soluble and stable in the same buffer. From the binding studies I knew that the affinity between them was lower than 1uM therefore I could not purify the complex by gel-filtration. I checked the precipitates by SDS-gel. The majority of the precipitates were the bigger protein. I'd like to mention that the smaller one was a protein with the pI above 10. Did the smaller protein induce the precipitation of the bigger one? Does anybody know some tricks to avoid the precipitation so that the protein complex could be concentrated enough for the crystallization trials? Many thanks in advance. Jerry McCully Your smile counts. The more smiles you share, the more we donate. Join in! _ Share life as it happens with the new Windows Live.Download today it's FREE! http://www.windowslive.com/share.html?ocid=TXT_TAGLM_Wave2_sharelife_112007
Re: [ccp4bb] FW: protein induced precipitation of proteins?
Dear All: Thanks a lot for the prompt replies. The following are the good ideas I have got so far besides some details that I forgot to mention earlier. I tried 10 buffers from pH5 to pH9.0 at 5mM with a final protein concentration of 0.5mg/ml to 1mg/ml. And I also tried to add 0.1M NaCl at pH7.0 or pH7.5. I still can see the precipitates. Actually I got one clear mixture at pH4.6 but I am not sure whether these two proteins will interact with each other at this point. Welcome new ideas. Jerry 1) Anastassis Perrakis Try mixing at lower conentrations (100 times or so) and concentrate them afterwards 2) Juergen BoschWhat was your buffer and how much ? What protein concentrations in mM did you add ? Did you have salts present ? They could shield the high pI protein or they could be removed from your other protein and attracted to the high pI protein, which then crashes out ? 3) Stephen GrahamI had the same problem once. It was a simple matter of screening a number of different buffers (at different pHs) until I found one where proteins were stable in complex. In my particular case I had to drop the pH below 6 then the proteins were eminently happy together. You can easily screen a multitude of buffers by adding a small amount of the two concentrated proteins to a larger volume of buffer, waiting 10 min, spinning down the sample and then looking for a drop in [protein] (using the A280, bradford assay, etc). 4) Pius Padayatti you ca try changing the buffer to another if you know under what conditions you could determine the binding affinity. Also try adding DTT etc in fresh to prevent any unwanted reactions. Just a simple suggestion hope it helps 5) Jeremy Tame There was a nice piece in Nature about 10 years ago showing that if many polystyrene balls of two sizes were mixed and allowed to diffuse around the surface of water, beyond a given concnetration the larger ones become close packed at the sides to allow the smaller ones more room. It's a pure entropy effect. In your case I suspect the pI may be playing a role, though you don't mention the pH of your buffer. I would try expressing the two proteins as a single polypeptide. That way they aren't going to let go easily! From: [EMAIL PROTECTED] Subject: Re: [ccp4bb] FW: protein induced precipitation of proteins? Date: Tue, 4 Dec 2007 10:38:36 +0900 To: [EMAIL PROTECTED] Hi Jerry There was a nice piece in Nature about 10 years ago showing that if many polystyrene balls of two sizes were mixed and allowed to diffuse around the surface of water, beyond a given concnetration the larger ones become close packed at the sides to allow the smaller ones more room. It's a pure entropy effect. In your case I suspect the pI may be playing a role, though you don't mention the pH of your buffer. I would try expressing the two proteins as a single polypeptide. That way they aren't going to let go easily! good luck Jeremy Tame On Dec 4, 2007, at 2:28 AM, Jerry McCully wrote: sorry for the repeats. Jerry From: [EMAIL PROTECTED] To: [EMAIL PROTECTED] Subject: protein induced precipitation of proteins? Date: Mon, 3 Dec 2007 09:25:51 -0800 Dear All, Recently I was trying to crystallize a complex of two proteins(40kD vs 20kD). TO my surprise, precipitates immediately appeared in the solution even when I mixed these two proteins at about 1mg/ml. However, the individual proteins were just soluble and stable in the same buffer. From the binding studies I knew that the affinity between them was lower than 1uM therefore I could not purify the complex by gel-filtration. I checked the precipitates by SDS-gel. The majority of the precipitates were the bigger protein. I'd like to mention that the smaller one was a protein with the pI above 10. Did the smaller protein induce the precipitation of the bigger one? Does anybody know some tricks to avoid the precipitation so that the protein complex could be concentrated enough for the crystallization trials? Many thanks in advance. Jerry McCully Your smile counts. The more smiles you share, the more we donate. Join in! Share life as it happens with the new Windows Live. Share now! _ Share life as it happens with the new Windows Live.Download today it's FREE! http://www.windowslive.com/share.html?ocid=TXT_TAGLM_Wave2_sharelife_112007
