Re: [galaxy-user] question history
Hello Liesbeth, Hopefully you are no longer having this problem, but we wanted to follow-up. From our view of your account, all histories are accessible on the Main public Galaxy server at http://usegalaxy.org. Our sincere apologies for transient usage issues that occurred around the time of the outage. Best, Jen Galaxy team On 3/27/14 1:22 AM, Liesbeth Van Rompay wrote: Hi, Although I am occupying 91% of my space on the Galaxy platform, since Galaxy was out, I cannot access my history anymore. No error message appears. What can I do? Best regards, Liesbeth ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] question history
Hi, Although I am occupying 91% of my space on the Galaxy platform, since Galaxy was out, I cannot access my history anymore. No error message appears. What can I do? Best regards, Liesbeth ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question regarding storage space
I am using Deeptools at the main public server and was adding some files initially to test. Now I have removed all my files (hidden and unhidden) and history, but my usage is still at 38%. How can I remove all the files to have a 0%? My user name is alexandre.gaspar.m...@gmail.com Thanks. A ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question regarding storage space
Hello, Please check all histories and shared histories. All data must be permanently deleted, and no histories shared with you, to reach 0% usage. Find all in the in the history menu under: * Saved histories - Advanced search - status = all or deleted' * Histories shared with me Help is here in our wiki: * https://wiki.galaxyproject.org/Learn/ManagingDatasets * see: Delete vs Delete Permanently Hopefully this helps! This about always solves the problem, but of you still are having issues, let us know. Jen Galaxy team On 3/25/14 10:37 AM, Alexandre Maia wrote: I am using Deeptools at the main public server and was adding some files initially to test. Now I have removed all my files (hidden and unhidden) and history, but my usage is still at 38%. How can I remove all the files to have a 0%? My user name is alexandre.gaspar.m...@gmail.com mailto:alexandre.gaspar.m...@gmail.com Thanks. A ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question in converting gtf file for p_id
Hello Nancy, The attribute sounds as if it is the correct place in the reference annotation file (the 9th field), but perhaps there are other format/content problems with the file. Do you have a tss_id? Do you have exons labeled? This is the area of the manual that covers the formatting and usage of these attributes: http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff_input I am not sure if I understand what you mean by input/writing codes. But if you need more help after reviewing the manual, please let us know, Best, Jen Galaxy team On 1/18/14 9:06 AM, Yanxiang Shi wrote: Hi all, I've been trying to use the cufflinks-cuffmerge-cuffdiff flow to analyze my RNAseq data. However, cuffmerge lost my p_id. My p_id was originally from changing the protein_id to p_id by myself in the gtf file. The current p_id showed up in the same attributes column as gene_id in the gtf file. Does anyone know how to make it reachable by cuff? I'm using galaxy public platform. Apparently in the history people say solving the problem by writing an extra code. But I cannot find anywhere to input codes in galaxy. Do I have to run everything on my own computer? Thanks a lot! Nancy ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question in converting gtf file for p_id
Hi Jennifer, I did see tss_id in my results and also exon labels. The tss_id was assigned during the calculation, having the numbers tss1, tss2, etc. By saying writing codes I mean such as in the link you sent to me, there is: *Note: *If an arbitrary GTF/GFF3 file is used as input (instead of the *.combined.gtf* file produced by Cuffcompare), these attributes will not be present, but Cuffcompare can still be used to obtain these attributes with a command like this: cuffcompare -s /path/to/genome_seqs.fa -CG -r annotation.gtf annotation.gtf The resulting cuffcmp.combined.gtf file created by this command will have the tss_id and p_id attributes added to each record and this file can be used as input for cuffdiff. but where do I can I type in cuffcompare -s /path/to/genome_seqs.fa -CG -r annotation.gtf annotation.gtf in galaxy? I don't know where I can find the -s... Is there a command line anywhere? Thanks for your help! Nancy On Tue, Jan 21, 2014 at 9:46 AM, Jennifer Jackson j...@bx.psu.edu wrote: Hello Nancy, The attribute sounds as if it is the correct place in the reference annotation file (the 9th field), but perhaps there are other format/content problems with the file. Do you have a tss_id? Do you have exons labeled? This is the area of the manual that covers the formatting and usage of these attributes: http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff_input I am not sure if I understand what you mean by input/writing codes. But if you need more help after reviewing the manual, please let us know, Best, Jen Galaxy team On 1/18/14 9:06 AM, Yanxiang Shi wrote: Hi all, I've been trying to use the cufflinks-cuffmerge-cuffdiff flow to analyze my RNAseq data. However, cuffmerge lost my p_id. My p_id was originally from changing the protein_id to p_id by myself in the gtf file. The current p_id showed up in the same attributes column as gene_id in the gtf file. Does anyone know how to make it reachable by cuff? I'm using galaxy public platform. Apparently in the history people say solving the problem by writing an extra code. But I cannot find anywhere to input codes in galaxy. Do I have to run everything on my own computer? Thanks a lot! Nancy ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jacksonhttp://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question in converting gtf file for p_id
Hi Nancy, It is not quite clear in which steps you used the reference annotation or how these attributes were lost exactly. Cuffcompare is a tool in Galaxy - but before we go any further I think that examining the history would be the speedest path to a solution. Would you share a history with me? You can email me back the link direct to keep your data private. Please note the problematic dataset #, leaving all undeleted (or at least one complete analysis path). Here is how to share: https://wiki.galaxyproject.org/Support#Shared_and_Published_data Thanks! Jen Galaxy team On 1/21/14 5:29 PM, Yanxiang Shi wrote: Hi Jennifer, I did see tss_id in my results and also exon labels. The tss_id was assigned during the calculation, having the numbers tss1, tss2, etc. By saying writing codes I mean such as in the link you sent to me, there is: *Note: *If an arbitrary GTF/GFF3 file is used as input (instead of the/.combined.gtf/file produced by Cuffcompare), these attributes will not be present, but Cuffcompare can still be used to obtain these attributes with a command like this: cuffcompare -s /path/to/genome_seqs.fa -CG -r annotation.gtf annotation.gtf The resultingcuffcmp.combined.gtffile created by this command will have thetss_idandp_idattributes added to each record and this file can be used as input forcuffdiff. but where do I can I type in cuffcompare -s /path/to/genome_seqs.fa -CG -r annotation.gtf annotation.gtf in galaxy? I don't know where I can find the -s... Is there a command line anywhere? Thanks for your help! Nancy On Tue, Jan 21, 2014 at 9:46 AM, Jennifer Jackson j...@bx.psu.edu mailto:j...@bx.psu.edu wrote: Hello Nancy, The attribute sounds as if it is the correct place in the reference annotation file (the 9th field), but perhaps there are other format/content problems with the file. Do you have a tss_id? Do you have exons labeled? This is the area of the manual that covers the formatting and usage of these attributes: http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff_input I am not sure if I understand what you mean by input/writing codes. But if you need more help after reviewing the manual, please let us know, Best, Jen Galaxy team On 1/18/14 9:06 AM, Yanxiang Shi wrote: Hi all, I've been trying to use the cufflinks-cuffmerge-cuffdiff flow to analyze my RNAseq data. However, cuffmerge lost my p_id. My p_id was originally from changing the protein_id to p_id by myself in the gtf file. The current p_id showed up in the same attributes column as gene_id in the gtf file. Does anyone know how to make it reachable by cuff? I'm using galaxy public platform. Apparently in the history people say solving the problem by writing an extra code. But I cannot find anywhere to input codes in galaxy. Do I have to run everything on my own computer? Thanks a lot! Nancy ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server atusegalaxy.org http://usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question in converting gtf file for p_id
Hi all, I've been trying to use the cufflinks-cuffmerge-cuffdiff flow to analyze my RNAseq data. However, cuffmerge lost my p_id. My p_id was originally from changing the protein_id to p_id by myself in the gtf file. The current p_id showed up in the same attributes column as gene_id in the gtf file. Does anyone know how to make it reachable by cuff? I'm using galaxy public platform. Apparently in the history people say solving the problem by writing an extra code. But I cannot find anywhere to input codes in galaxy. Do I have to run everything on my own computer? Thanks a lot! Nancy ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question on uploading and use .bam files
Dear Sir or Madam, Recently I was trying to use Galaxy for my data analysis but ran into problems. Condition: I used galaxy server at PSU. I tried load local .bam file directly to galaxy, I also tried FTP, but both ways resulted into the same outcome. The .bam files I was using are pure .bam files with no index. Problems: 1.After I load them, the file was recognized as .txt file, and it is empty (But it did take long time to upload to FTP ~1GB), in the annotation window, it shows The uploaded binary file contains inappropriate content 2. I tried to convert the file to .bam format, it returns An error occurred setting the metadata for this dataset. You may be able to set it manually or retry auto-detection. Could you help me for this, I just uploaded a small file to the FTP, just in case you need it for a test. Username: yl...@mail.missouri.edu Great thanks~ YL ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question on uploading and use .bam files
Hello L.Y., I just tested .bam upload using FTP (with the client FileZilla) and all went fine. Just to confirm, you are using the public Main Galaxy server at http://usegalaxy.org? Many of our services were down for several hours yesterday for maintenance related reasons - if you upload overlapped with that all (9am-6pm EST US), you will want to do the upload again now. In my test, I did not set the datatype when I moved the file into a history, but the file was named with a .bam extension. In another history, I happened to have a .bam file that had a metadata detection as you describe, and when I reset, the datatype was resolved. So, given these tests done right now - I think everything is OK on the server. First, when you uploaded the file via FTP - this was confirmed to be successful? This is reported by the client tools (and command-line if using that method). Double check, as this is important. Interrupted transfers can be resumed (next time) - leave the file in the holding area, connect to the server first, then start the resume. If you are not sure of the status, maybe try again and track this, it is an important first step. Personally, I would name the file with a .bam extension if doing over, as this is the datatype (anyway, not just Galaxy). Second, let me show you how to reset metadata since that may also solve the issue. When the message to reset metadata comes up in an expanded dataset, this is a link. Click on it, and in the center panel the Edit Attributes form will come up. On the first, default page, near the bottom, will be a button to detect metadata. Click on this and let the process run. If neither of these work, then you probably need to examine the contents of the .bam file to make sure it is really .bam (and only .bam). SAMTools on the line command is a good, simple choice for this. Are you able to run tools on the file? Converting to sam format will change the indexed format to one that is in plain text, if you find something off that you want to examine. You could also check with the source to see if they are aware of any problems. And not to make this overly confusing, but a transfer problem from the source to your computer could have occurred, corrupting the file. The option to upload via URL is possible if the source has the file available that way. The screencast linked from here shows all current options: http://wiki.galaxyproject.org/Support#Loading_data Please review and let us know if you continue to have problems, Jen Galaxy team On 12/4/13 8:15 AM, Lu, Yuan (MU-Student) wrote: Dear Sir or Madam, Recently I was trying to use Galaxy for my data analysis but ran into problems. Condition: I used galaxy server at PSU. I tried load local .bam file directly to galaxy, I also tried FTP, but both ways resulted into the same outcome. The .bam files I was using are pure .bam files with no index. Problems: 1.After I load them, the file was recognized as .txt file, and it is empty (But it did take long time to upload to FTP ~1GB), in the annotation window, it shows The uploaded binary file contains inappropriate content 2. I tried to convert the file to .bam format, it returns An error occurred setting the metadata for this dataset. You may be able to set it manually or retry auto-detection. Could you help me for this, I just uploaded a small file to the FTP, just in case you need it for a test. Username: yl...@mail.missouri.edu Great thanks~ YL ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] question about samtools in Galaxy
Hi, Can anyone tell me if the ability to randomly sample a sam or bam file (view -s) is available via Galaxy samtools? I can't find it but it might be an option that I am missing. sincerely, Robert Jackman rais...@gmail.com rjack...@bu.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] question about samtools in Galaxy
Hi Robert, This function is not wrapped into a tool yet by the dev team. I checked the Tool Shed as well and didn't see it there. But there is another option to get to the same result. The tool Text Manipulation - Select random lines from a file can be used with a SAM file. Don't not use the tool on a BAM file. Hopefully this helps! Jen Galaxy team On 10/1/13 12:13 PM, Robert Jackman wrote: Hi, Can anyone tell me if the ability to randomly sample a sam or bam file (view -s) is available via Galaxy samtools? I can't find it but it might be an option that I am missing. sincerely, Robert Jackman rais...@gmail.com rjack...@bu.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] question
On the FastUnifrac webside available at the begining of the year I was able to obtain p-values having “unifrac_env.txt”file, GreenGene Core as the reference tree and “Automatically generate category mapping file” option was previously available. Can I have access to the previous website, rather than the new galaxy? or how can i have the option of automatically generate catergory file ? Viorica (Ibi) Bondici PhD. Candidate Department of Food and Bioproduct Sciences College of Agriculture and Bioresources University of Saskatchewan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] question
Hello Vioricia, For this question, it would be best to contact the team that is hosting the public Galaxy site, as these are tools custom to their server. The contact information is on the bottom of the home page: http://unifrac.colorado.edu/ Best! Jen Galaxy team On 9/25/13 1:13 PM, Bondici, Ibi wrote: On the FastUnifrac webside available at the begining of the year I was able to obtain p-values having unifrac_env.txtfile, GreenGene Core as the reference tree and Automatically generate category mapping file option was previously available. Can I have access to the previous website, rather than the new galaxy? or how can i have the option of automatically generate catergory file ? Viorica (Ibi) Bondici PhD. Candidate Department of Food and Bioproduct Sciences College of Agriculture and Bioresources University of Saskatchewan ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question about expression in Galaxy tools
Hello everyone,
I found regular expression could be available in the tool (filter and sort)
-Filter. I wonder whether it could be the same in the tool (Text
Manipulation) -Compute. I have checked that the fuction len(c4.split('_'))
would return error. So, could anyone tell me if it was possible like this?
The file A:
chr11040NM_1234_exon_1
chr25070NM_1234_exon_2
Change the file A to the file B such as:
chr11040NM_1234
chr25070NM_1234
May it is useless in the example. But the way could solve problems I met.___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question about expression in Galaxy tools
Hello,
There are some tools in the group 'Text Manipulation' that do this sort
of manipulation directly. Combined, many basic unix functions can be
performed. Combine them to create custom tools using Workflows - even
place them in your tool menu for seamless access.
To move from file A to file B, use tools such as these as a rough example:
* Convert delimiters to TAB (convert all _ to tabs)
* Add column to an existing dataset (could include a single _ char,
to be merged later)
* Cut columns from a table (can be used to rearrange and leave behind
unwanted columns)
* Merge Columns together (merge the new _ back where you want it)
Compute and Select have some character filters on them for security
reasons. If you were running your own Galaxy and it wasn't public, these
could be removed of course. Also, a tool from the Tool Shed such as the
'Tool factory' could be used to turn pretty much any custom unix/shell
(or other!) script that acts on text data into a full fledged, single
tool - the tool that creates tools! That new tool could even be for a
publicly hosted server use if you wanted to do that (I'd recommend a
security test first though, as with any new tool!). And don't leave Tool
Factory active on a public server - bad things could happen.
I am positive others have come up with many more solutions in all sorts
of flavors. Discussions like this are good for the galaxy-...@bx.psu.edu
mailing list if you are interested in interacting with the development
community. More about the list is here, about joining, posting, and
following along:
http://wiki.galaxyproject.org/Support#Mailing_Lists
Thanks!
Jen
Galaxy team
On 8/29/13 9:38 AM, 师云 wrote:
Hello everyone,
I found regular expression could be available in the tool (filter and
sort) -Filter. I wonder whether it could be the same in the tool
(Text Manipulation) -Compute. I have checked that the fuction
len(c4.split('_')) would return error. So, could anyone tell me if
it was possible like this?
The file A:
chr11040NM_1234_exon_1
chr25070NM_1234_exon_2
Change the file A to the file B such as:
chr11040NM_1234
chr25070NM_1234
May it is useless in the example. But the way could solve problems I met.
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question about Extract intron sequences from [gtf file] + [genome FASTA file]
Dear Jen, I am not much of a Galaxy user yet. Some days ago I know something about Galaxy and found it a really wonderful tool. And I am confused by a simple question regarding how to extract intron sequences from [gtf file]; Here is a simple of a gtf file: 1 Cufflinks transcript322 1000 + . gene_id CUFF.26; transcript_id CUFF.26.1; 1 Cufflinks exon3221000+ . gene_id CUFF.26; transcript_id CUFF.26.1; exon_number 1; 1 Cufflinks transcript10401000 - . gene_id CUFF.204; transcript_id CUFF.204.1; 1 Cufflinks exon10151000 - . gene_id CUFF.204; transcript_id CUFF.204.1; exon_number 1; 1 Cufflinks exon30401000 - . gene_id CUFF.204; transcript_id CUFF.204.1; exon_number 1; I want to extract intron from the [gtf] file. I found 2 ways may solve the question but it is both useless; 1. I use (Filter and Sort) - Filter to cut the [gtf] file into 2 files such as the follows: File A ( contain transcript ): 1 Cufflinks transcript322 1000 + . gene_id CUFF.26; transcript_id CUFF.26.1; 1 Cufflinks transcript10401000 - . gene_id CUFF.204; transcript_id CUFF.204.1; File B ( contain exon): 1 Cufflinks exon3221000+ . gene_id CUFF.26; transcript_id CUFF.26.1; exon_number 1; 1 Cufflinks exon10151000 - . gene_id CUFF.204; transcript_id CUFF.204.1; exon_number 1; 1 Cufflinks exon30401000 - . gene_id CUFF.204; transcript_id CUFF.204.1; exon_number 1; Then I use (Operate on Genomic Intervals)-Subtract to subtract File B from File A Return Non-overlapping pieces of intervals. I thought it will return a file containing intron But the result is an empty file; 2. I convert [gtf] file to [Bed] file ,and use (Extract Features)-Gene BED To Exon/Intron/Codon BED, and it return the same result, an empty file. I think it must be something wrong with my thoughts. So I really need your help. Thank you very much. sincerely yours, John ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] question
Hello Larry,
The Manipulate Fastq tool only brings up the regular trimmer tools
again once sequence and trim are selected, so this will not work. And
a regular expression could be used as a filter, but that will not
actually trim the data.
If you choose to filter, this regular expression would find sequences
with variable length poly-G at the end. This one actually finds one or
more, so not really poly - this is for you to modify. Change the number
in the {} to make a minimum required length.
^.*[A|T|C|N]G{1}G*$
Are you trying to trim poly-A? If using a local instance, repeat masker
was just added to the Tool Shed and could be quicker. But if using the
public Main server, the adapter clip idea from Ido is very good -
certainly worth a try.
The other option is to just go ahead and align the data. If the region
is long for all sequences, or some subset (you could pull out those that
are very long), then do a blanket end length trim on all, put back
together any files you have split apart, and let the aligner deal with
the remaining trailing bases. Manipulate Fastq can be used to subset
the file - just run it twice (or as many times as needed to get all the
data uniquely into distinct files to merge later.
Best,
Jen
Galaxy team
On 7/28/13 11:44 AM, Larry Simpson wrote:
Hi
Is it possible to trim a variable number of a specific nucleotide from
the 3' ends of fastq RNA reads? The Manipulate Fastq utility in
Galaxy may have this ability but I do not know how to create a custom
inquiry.
Thanks in advance for any assistance.
Larry
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
[galaxy-user] question
Hi Is it possible to trim a variable number of a specific nucleotide from the 3' ends of fastq RNA reads? The Manipulate Fastq utility in Galaxy may have this ability but I do not know how to create a custom inquiry. Thanks in advance for any assistance. Larry ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] question
You could use the adaptor clip with e.g. a custom poly-A 'adaptor' its in FASTX-Toolkit for FASTQ data best, ido On Jul 28, 2013, at 8:44 PM, Larry Simpson larrys3...@gmail.com wrote: Hi Is it possible to trim a variable number of a specific nucleotide from the 3' ends of fastq RNA reads? The Manipulate Fastq utility in Galaxy may have this ability but I do not know how to create a custom inquiry. Thanks in advance for any assistance. Larry ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question on megablast databases
Dear galaxy members, I have a question on the databases used in megablast module from galaxy. There are four db options to blast against with - 1. htgs 28-Jan-2013 2. nt 28-Jan-2013 3. wgs 28-Jan-2013 4. phiX174 Is there any further information to guide which database would be appropriate to use? In addition, how to find the genome information contained in each database? Many thanks, Kathryn ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question on megablast databases
Hi Kathryn, These first three are three different types of sequence databases available from GenBank The last is a genome assembly for the phiX174 genome. Information about all can be found here: http://www.ncbi.nlm.nih.gov/genbank/ There are many uses, one example is covered in our Metagenomics publication: https://main.g2.bx.psu.edu/u/aun1/p/windshield-splatter Thanks! Jen Galaxy team On 5/24/13 6:59 AM, Sun, Wenping [USA] wrote: Dear galaxy members, I have a question on the databases used in megablast module from galaxy. There are four db options to blast against with - 1.htgs 28-Jan-2013 2.nt 28-Jan-2013 3.wgs 28-Jan-2013 4.phiX174 Is there any further information to guide which database would be appropriate to use? In addition, how to find the genome information contained in each database? Many thanks, Kathryn ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question on galaxy data visualization
Hello Kathryn, Trackster is the primary data visualization tool and can be accessed by clicking on the mini graph icon within a dataset: or by going to "Visualization" in the upper menu bar and starting a new track browser. http://wiki.galaxyproject.org/Learn#Visualization If you are interested, for certain datasets, the icon will also offer other options: Circster and/or Scatterplot. The tool group "Graph/Display Data" has graphing tools and tools that prepare data to be visualized. The tool group "Motif Tools" has a sequence logo generator, and the groups " NGS: QC and manipulation" and " BEDTools" have more graphing tools. Hopefully this helps, Jen Galaxy team On 5/13/13 11:08 AM, Sun, Wenping [USA] wrote: Dear galaxy group, I have question on the data visualization from output of galaxy pipeline. Is there any ideogram tool inside of galaxy? Regards, Kathryn ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question about scripting
hello, My subject is at the border between Galaxy and Condor I'found method to use Galaxy with condor cluster solution. In fact I have wrote a script when Galaxy call clustalw2 , it calls in fact a script called clustalw2. All run exactly as I want excepting ... but Galaxy get in error and said there was a problem I turn my script to debug mode and it puts followings output + prog=/usr/bin/clustalw2 + err=0 + infile=-infile=/home/galaxy/galaxy-dist/database/files/000/dataset_11.dat + outfile=-outfile=/home/galaxy/galaxy-dist/database/job_working_directory/000/46/galaxy_dataset_80.dat + outorder=-OUTORDER=ALIGNED + seqnos=-SEQNOS=OFF + typeseq=-TYPE=DNA + var6= + var7= + var8= + var9= + echo ++ echo -infile=/home/galaxy/galaxy-dist/database/files/000/dataset_11.dat ++ sed -e s/-infile=// + infile2=/home/galaxy/galaxy-dist/database/files/000/dataset_11.dat ++ sed -e 's/galaxy_dataset_\(.*\)\.dat//' ++ sed -e s/-outfile=// ++ echo -outfile=/home/galaxy/galaxy-dist/database/job_working_directory/000/46/galaxy_dataset_80.dat + WorkingDir=/home/galaxy/galaxy-dist/database/job_working_directory/000/46/ + mkdir -p /home/galaxy/galaxy-dist/database/job_working_directory/000/46/ + mkdir -p /home/galaxy/galaxy-dist/database/job_working_directory/000/46/ + mkdir -p /home/galaxy/galaxy-dist/database/job_working_directory/000/46/ + [[ -n /usr/bin/clustalw2==clustalw2 ]] + echo 'universe= vanilla' + echo 'executable = /usr/bin/mpirun ' + echo 'arguments = -np 10 -hostfile /home/galaxy/hostfile /usr/bin/clustalw-mpi -infile=/home/galaxy/galaxy-dist/database/files/000/dataset_11.dat -outfile=/home/galaxy/galaxy-dist/database/job_working_directory/000/46/galaxy_dataset_80.dat -OUTORDER=ALIGNED -SEQNOS=OFF -TYPE=DNA ' + echo 'Getenv = True machine_count = 1 transfer_input_files= /home/galaxy/hostfile,/usr/bin/clustalw-mpi, /home/galaxy/galaxy-dist/database/files/000/dataset_11.dat should_transfer_files = yes Log = /home/galaxy/logs/normal.$(cluster).$(process).log Output = /home/galaxy/logs/normal.$(cluster).$(process).out Error = /home/galaxy/logs/normal.$(cluster).$(process).error notification= never queue 1' + /usr/bin/condor_submit /home/galaxy/submit Submitting job(s). 1 job(s) submitted to cluster 179. I suspect the method I use, doesn't return properly information to galaxy ... but I don't know what I can do ... Any Idea ... ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Question about tool
Hi Sandra, Galaxy can certainly be used to correlate a set of unknown genomic coordinates with another annotated set of genomic corrdinates, such as those available from UCSC, Biomart, etc. The tool set to look at is Operate on genomic intervals and an example of how these tools are used, in particular the Join tool, can be found in several tutorials. Among these are: https://main.g2.bx.psu.edu/u/galaxyproject/p/using-galaxy-2012 - Protocol1 shows a general overview of how to join two datasets and merge back any lost information - Protocol3 has datasets available for practice analysis: ChIP-seq result and a promoter dataset https://main.g2.bx.psu.edu/u/aun1/p/galaxy101 - Similar to Protocol1 (above) in many parts, but includes a workflow creation step that you may find helpful to know about. http://wiki.galaxyproject.org/Learn#Other_Tutorials - Analysis of ChIP-seq data in Galaxy for an exact example of filtering and interval comparison with RefSeq - Using the UCSC Genome Browser and Galaxy to study regulatory sequence evolution in Drosophila for an example of how to intersect data directly in the UCSC Table browser, then export to Galaxy. Any BED file in Galaxy can be sent to UCSC as a custom track. Best, Jen Galaxy team On 3/25/13 4:17 AM, Sandra Santos wrote: Hi My name is Sandra and I'm a curator of a database of transcriptional relationships in yeast. We are doing our annual update, and in one paper I found a number of ChIP-seq results. Unfortunately, the authors only included in the supplemental information the genome coordinates, but no information regarding what the binding position corresponds to (promoter, ORF...). When I asked the authors for this information, they told me to do it myself. I'm actually quite busy and don't have time to waste analysing their results, but decided to check if GALAXY has a tool where I can use this list of positions as an input and get the annotation of the region. Thanks for your help -- Sandra C. dos Santos, PhD Post-Doctoral fellow https://fenix.ist.utl.pt:443/homepage/ist146260 https://fenix.ist.utl.pt/homepage/ist146260 Biological Sciences Research Group Instituto Superior Técnico Portugal tel: +351 218417233 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Question about tool
Hi My name is Sandra and I'm a curator of a database of transcriptional relationships in yeast. We are doing our annual update, and in one paper I found a number of ChIP-seq results. Unfortunately, the authors only included in the supplemental information the genome coordinates, but no information regarding what the binding position corresponds to (promoter, ORF...). When I asked the authors for this information, they told me to do it myself. I'm actually quite busy and don't have time to waste analysing their results, but decided to check if GALAXY has a tool where I can use this list of positions as an input and get the annotation of the region. Thanks for your help -- Sandra C. dos Santos, PhD Post-Doctoral fellow https://fenix.ist.utl.pt:443/homepage/ist146260 Biological Sciences Research Group Instituto Superior Técnico Portugal tel: +351 218417233 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] question on galaxy reference genome window
Dear Galaxy members, I am new to galaxy and just installed galaxy on aws cloud. I am testing how it works and have the following question below: 1. I tried to test bowtie2 with the dataset I uploaded, however, the window for reference genome is very narrow and nothing from pull-down menu can be selected. When I omit that option to execute bowtie2, galaxy give error message for requesting reference genome. I am using hg19, should I upload myself? If so, how? 2. Same error happen for me to run fastqc --- the reference genome selection window is way too narrow and nothing can be selected Thank you very much for your inputs and helps! Kind regards, Kathryn ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about Unified genotyper
Hi Mathew, Regarding 1 you might want to read this thread: http://user.list.galaxyproject.org/Problem-with-Depth-of-Coverage-on-BAM-files-GATK-tools-td4654147.html All tools from GATK are limited to hg_g1k_v37 as far as I know. Best, Carlos On Mon, Aug 6, 2012 at 10:30 AM, Mathew Bunj mathewb...@yahoo.com wrote: I have been trying to use either Unified genotyper or Freebayes on one of the Bam file. Both are failing. 1. With Unified genotyper it give me message saying Sequences are not currently available for specified build. I have hg19 related data and using default settings (pick up hg_g1k_v37 no other option). I am not sure why it is giving me this error. 2. As an alternative I tried to run Freebayes with default setting and choosing hg19 - it i snot giving any specific message but undetr bug icon gives me -killed. Now in order to make sure my Bam is OK, I tested out side Galaxy mPile up and with in Galaxy pile up. Any suggestion why UNified genotyper is not working. If needed I can share my history. Thanks. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about Unified genotyper
Hello Mathew, Carlos is correct the the tools in the group NGS: GATK Tools (beta) will require that the data is mapped/associated with the reference genome hg_g1k_v37. Belinda has offered to help with the details that go beyond Galaxy and that is great - the GATK forum is definitely the best resource for questions specific to that tools set once you know that the basic Galaxy datasets are correct. Freebayes, on the other, will work with hg19. Other users have perform an independent mapping run to avoid complex data manipulations/sorting. Please feel free to send in a bug report if problems persist. When submitted a bug report, send from the error dataset (just one is enough if all of the problems are in the same history) and put in the notes all of your concerns. Be sure to include this email address in the comments if your Galaxy account uses a different one. Also be sure to leave all input and error datasets that you would like feedback about in an undeleted state in your history. Undelete if necessary. Thanks! Jen Galaxy team On 8/6/12 7:30 AM, Mathew Bunj wrote: I have been trying to use either Unified genotyper or Freebayes on one of the Bam file. Both are failing. 1. With Unified genotyper it give me message saying Sequences are not currently available for specified build. I have hg19 related data and using default settings (pick up hg_g1k_v37 no other option). I am not sure why it is giving me this error. 2. As an alternative I tried to run Freebayes with default setting and choosing hg19 - it i snot giving any specific message but undetr bug icon gives me -killed. Now in order to make sure my Bam is OK, I tested out side Galaxy mPile up and with in Galaxy pile up. Any suggestion why UNified genotyper is not working. If needed I can share my history. Thanks. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about SICER out put
Hi Kanwar, I found that you also posted this question and another like to the Google group for SICER on 7/10 and received some help there: http://groups.google.com/group/sicer-users Glad that you were able to get the questions resolved. For others reading this post or interested in SICER details, follow the documentation links on Galaxy's SICER tool form to reach the primary documentation and tool author's direct help for how to interpret/understand the various outputs. There are no community contributed SICER tutorials/pages/workflows (that I am aware of, please correct me!), but if developed, I am sure this would be a welcomed addition to the Shared content on Galaxy Main or galaxyproject.org. Best, Jen Galaxy team On 7/10/12 3:52 PM, shamsher jagat wrote: I used SICR to call peaks and have following out put files: 1. test.1removed bed 2. control1 removed .bed 3. test w 200 graph 4. test w200 normalized graph 5. test w200-G600 FDR.05 island.bed 6. test w200-G600 FDR .05 island filtered.bed 7. test w200-G600 FDR .05 island filtered normalized.wig 8. test w200-G600 FDR.05 score island 9. test w200-G600 summary island Which of these files should be used. I think file 5 and 6 are the ones for visualization as well for annotating with genomic regions. I have read the original paper but it is not very clear what these out puts mean. Could some one please guide me what these files mean and what is useful and rest are intermediate files. My second question is authors of SICER has emphasized about teh importance of choosing gap size and window size. gap size they mention 1-3 -5 depending upon the peak distribution, but I see in Galaxy the default is 600 gap size do we need to change it to 1,2- 5 or I am missing something. Any advise please but I did my searching on net. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about SICER out put
I used SICR to call peaks and have following out put files: 1. test.1removed bed 2. control1 removed .bed 3. test w 200 graph 4. test w200 normalized graph 5. test w200-G600 FDR.05 island.bed 6. test w200-G600 FDR .05 island filtered.bed 7. test w200-G600 FDR .05 island filtered normalized.wig 8. test w200-G600 FDR.05 score island 9. test w200-G600 summary island Which of these files should be used. I think file 5 and 6 are the ones for visualization as well for annotating with genomic regions. I have read the original paper but it is not very clear what these out puts mean. Could some one please guide me what these files mean and what is useful and rest are intermediate files. My second question is authors of SICER has emphasized about teh importance of choosing gap size and window size. gap size they mention 1-3 -5 depending upon the peak distribution, but I see in Galaxy the default is 600 gap size do we need to change it to 1,2- 5 or I am missing something. Any advise please but I did my searching on net. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about Galaxy
Hi Qianli, It looks as if you are using the Extract DNA tool? GTF/GFF files have coordinates with a 1-based start position - and this was your input, but the output from this tool produces coordinates with a BED-style 0-based start position. The genome index files used by the tool are in .2bit format and the source is encoded into the full name. The sequence content of the reference genome is not altered by the tool. Perhaps the interpretation of the coordinates is the source of the difference or you are sourcing a different version? If you have a question about where we sourced a genome, please let us know. To see a quick description of both BED and GFF format together in the UI, click into the tool Convert Formats - GFF-to-BED converter. For more in-depth descriptions, please see our wiki: http://wiki.g2.bx.psu.edu/Learn/Datatypes Next time, please send questions directly to our mailing list, with the to address as galaxy-u...@bx.psu.edu. Best, Jen Galaxy team On 6/8/12 7:07 AM, Qianli Shen wrote: Hello I ran a preliminary analysis using test genome and gff file. But the results is confusing me. The fasta file is Gm06 ATAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTA AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAC CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT AAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC The gff3 file is ##gff-version 3 Gm06 GDB element 5 15 . + . ID=LEVEL1;Name=Glyma06g05000; The output is ?_Gm06_4_15_+ ACCCTAAACCC 1 From the gff3 file we can see the start and end position is 5 and 15, why the start and end coordinate is 4 and 15 in the output file, which is really confusing. 2 How does the galaxy treat the genome file, are all the characters except for ACGT are removed from the genome file? Because I use substr function in Perl to test the output of galaxy, somethimes, there is mismatch. I really appreciate all your help. qianli -- Qianli Shen Graduate Student Ohio State University Department of Horticulture and Crop Science Email: qianlipotent...@gmail.com mailto:qianlipotent...@gmail.com shen@buckeyemail.osu.edu http://goog_1606040974 http://goog_1606040974 -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about fetching sequence from genome
Hi I want to fetch sequence from soybean genome, according to a gff file. My gff3 file and genome file are attached to the email, because it is not easy to recongnize the format if I paste it in the email. And it keeps reporting the error: An error occurred running this job: Traceback (most recent call last): File /galaxy/home/g2main/galaxy_main/tools/extract/extract_genomic_dna.py, line 288, in module if __name__ == __main__: __main__() File /galaxy/home/g2main/galaxy_main/tools/extract/extract_genomic_dna.py Could you please tell me where is the problem? Best Qianli Galaxy11-[GENE_L1_3.gff3].gff3 Description: Binary data genome.fasta Description: Binary data ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about extracting information from CEAS run results
I have run a ChIPseq work flow in galaxy, At teh end I ran CEAS: Enrichment on chromosome and annotation (version 1.0.0) to annotate the peaks which gave me a pdf file shoiwng distribution of peaks across genome with pie chart as well as well as histogram. It shows that ~5% of my peaks in 5UTR regions and other 3 % in 3' UTR 63 % exon and so on. Is there a way that I can have list of genes/ refrence ids which arein 5'UTR /3'UTR. I tried all tools in Galaxy but could not find it. There should be some way to extract these summarized results in details. Any one has a suggestion please? Thanks Kanwar ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about megablast
I have a question about megablast, I want to megablast my seq: the databases mentioned include (against target databases): htgs27 nt27 wgs 09 phiX174 How can I find details about these databases and which one is human or mouse or may be best for my case. Thanks Vasu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about megablast
Hello Vasu, These databases contain sequences from all species in the divisions. The number indicates the release version. The actual source is: ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/ A description of each division's contents can be found at: http://www.ncbi.nlm.nih.gov/genbank The exception is this single-species genome: http://en.wikipedia.org/wiki/Phi_X_174 Hopefully this helps, Jen Galaxy team On 4/9/12 9:57 AM, shamsher jagat wrote: I have a question about megablast, I want to megablast my seq: the databases mentioned include (against target databases): htgs27 nt27 wgs 09 phiX174 How can I find details about these databases and which one is human or mouse or may be best for my case. Thanks Vasu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about plotting circos plot
Hello Shamsher, Another user posted that they have started a Galaxy wrapper for the Circos tool itself, but I wanted to let you know about the tool EMBOSS - cirdna: Draws circular maps of DNA constructs. The link on the tool's form points to all of the EMBOSS tools, including this specific page for the cirdna tool: http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/cirdna.html The version in Galaxy is 5.0.0 and is a simplified implementation compared to the command-line. The tool form accepts a dataset from the history as input and uses default options. Please see the cirdna.html documentation for instructions about how to format the input file (created outside of Galaxy and uploaded as a text file). There is an example in the documentation if you want to get an idea about what the resulting graphic will look like as implemented in Galaxy (versus the graphic in the documentation). Best, Jen Galaxy team On 3/6/12 8:32 PM, shamsher jagat wrote: I wonder if is it possible to visualize mutation data in circular plot termed as circos plot e.g @http://www.eurekalert.org/multimedia/pub/31019.php?from=181881 Any suggestion for an alternative tool will also be appreciated. Thanks Shamsher ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question from a new Galaxy user
If I may add, I believe galaxy will uncompress your files if zipped. Unzipping a 13 GB file, will take a while. Kev ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about aaChange tool.
Hello, Recently i have used galaxy to find corresponding amino acids to a list of SNPs that i have. i used aaChange tool from the tool panel for this purpose. After obtaining the result i checked the correctness of this results by searching dbSNP for randomly chosen SNPs. however, some of those SNPs mapped to incorrect amino acid, For example, The SNP( rs11549096), was mapped by Galaxy to the change ( Asp:Tyr/His, ) , Searching the dbSNP for this SNP Shows that the Change should be Asp :Asn and the link for this SNP in the dbSNP is : http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_searchtype=rsrs=rs11549096 So, the reference is correct in all cases i searched (more than a thousand), the position of change in the aa is correct, *but* the alternative aa is not correct in all cases. What causes this mistake, and how to solve this problem? Note: my list contains hundreds of thousands of SNPs, so, i can not check each one of them. prompt response is appreciated, Best Regards, Maha ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about aaChange tool.
Hello Maha, This does sound very strange. Would you please share a link to your history so that we can examine the data and determine where the problem originates? Please note which dataset contains this particular problem if there are several runs from this same tool. Use Options - Share of Publish, generate the share link with the top button, copy the URL, and paste it into a reply email sent back to me directly. Thank you! Jen Galaxy team On 3/9/12 8:28 AM, Maha Al Kahtani wrote: Hello, Recently i have used galaxy to find corresponding amino acids to a list of SNPs that i have. i used aaChange tool from the tool panel for this purpose. After obtaining the result i checked the correctness of this results by searching dbSNP for randomly chosen SNPs. however, some of those SNPs mapped to incorrect amino acid, For example, The SNP( rs11549096), was mapped by Galaxy to the change ( Asp:Tyr/His, ) , Searching the dbSNP for this SNP Shows that the Change should be Asp :Asn and the link for this SNP in the dbSNP is : http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_searchtype=rsrs=rs11549096 http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_searchtype=rsrs=rs11549096 So, the reference is correct in all cases i searched (more than a thousand), the position of change in the aa is correct, _*but*_ the alternative aa is not correct in all cases. What causes this mistake, and how to solve this problem? Note: my list contains hundreds of thousands of SNPs, so, i can not check each one of them. prompt response is appreciated, Best Regards, Maha ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about plotting circos plot
Hi Shamsher. We have a small initial wrapper for circos. Its not complete yet and we are not sure if its even possible to wrap such a complex tool in a good galaxy UI. But if you are interested i can share our code. Cheers, Bjoern I wonder if is it possible to visualize mutation data in circular plot termed as circos plot e.g @http://www.eurekalert.org/multimedia/pub/31019.php?from=181881 Any suggestion for an alternative tool will also be appreciated. Thanks Shamsher ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Björn Grüning Albert-Ludwigs-Universität Freiburg Institute of Pharmaceutical Sciences Pharmaceutical Bioinformatics Hermann-Herder-Strasse 9 D-79104 Freiburg i. Br. Tel.: +49 761 203-4872 Fax.: +49 761 203-97769 E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de Web: http://www.pharmaceutical-bioinformatics.org/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about plotting circos plot
I wonder if is it possible to visualize mutation data in circular plot termed as circos plot e.g @http://www.eurekalert.org/multimedia/pub/31019.php?from=181881 Any suggestion for an alternative tool will also be appreciated. Thanks Shamsher ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about uploading custom index for bowtie
I recently tried to upload a custom made index for bowtie using Filezilla as my FTP source, but I got an error message, I think due to the autodetect for file type not recognizing this file type. Is there something special that I should do to upload my six .ebwt files for my reference? ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about uploading custom index for bowtie
Hello William, To use a custom reference genome, all you need to upload is the single fasta file for the genome. Galaxy will do the rest and create indexes as appropriate. Hopefully this helps! Thanks, Jen Galaxy team On 2/6/12 11:51 AM, William Light wrote: I recently tried to upload a custom made index for bowtie using Filezilla as my FTP source, but I got an error message, I think due to the autodetect for file type not recognizing this file type. Is there something special that I should do to upload my six .ebwt files for my reference? ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question re: Quota not re-setting after data deletion
Hello, I'm using the Galaxy Main --I was trying to groom data that I had uploaded at about 11 AM EST and Galaxy informed me that I had met my quota. Indeed it said that my quota was 98% full, but my history (my only one) said that I had about 13 Gb-- I deleted everything in my history in order to start fresh, but it still keeps saying my disk is 98% full every though my history has 0 bytes. At the moment, I have nothing in my history, but it is still saying my disk is 98% full. How do I reset the quota to 0 if not by deleting data? Michael R. McGowen, Ph.D. Postdoctoral Research Fellow Molecular Evolution Laboratory Center for Molecular Medicine and Genetics Wayne State University School of Medicine 3240 Scott Hall 540 E. Canfield St. Detroit, MI 48201 USA 313-577-0086 mmcgo...@med.wayne.edu http://homopan.wayne.edu/people/mmcgowen.html ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question re: Quota not re-setting after data deletion
Hello Michael, Data will count towards the disk quota when not permanently deleted. Also, once permanently deleted, it will take a bit of time (less than an hour to several hours) for the disk counts in the UI to update. Perhaps this has already been resolved, but if not, hopefully the rest of the advice in this email will help. For details about delete vs delete permanently (and remove from disk), please see: http://galaxyproject.org/wiki/Learn/Managing%20Datasets#Delete_vs_Delete_Permanently Some things to double check: 1 - Look under Options - Saved Histories to view all histories. Click on Advanced Search, then status: all. Any histories with status active or deleted (in the far right column) may contain data that counts towards the disk quota. Histories with status permanently deleted do not contain any data that counts towards the disk quota. The actual disk usage is in the column Size on Disk. 2 - Look under Options - Histories Shared with Me. Any history shared with you counts towards the disk quota. Copy any data needed and ask for the histories to be unshared. 3 - Check for hidden or deleted (but not permanently deleted) datasets in active histories. Links within each dataset box give the option to permanently delete, which removes them from the disk quota. To do this, from each history, use Options - Show Deleted Datasets and then Options - Show Hidden Datasets to view these. Going through these checks should be quick and it is not uncommon to discover unexpected deleted (but not permanently deleted), hidden, or shared histories data. If after checking you are still having problems, please let us know, Best, Jen Galaxy team On 12/6/11 1:29 PM, Mcgowen, Michael wrote: Hello, I'm using the Galaxy Main --I was trying to groom data that I had uploaded at about 11 AM EST and Galaxy informed me that I had met my quota. Indeed it said that my quota was 98% full, but my history (my only one) said that I had about 13 Gb-- I deleted everything in my history in order to start fresh, but it still keeps saying my disk is 98% full every though my history has 0 bytes. At the moment, I have nothing in my history, but it is still saying my disk is 98% full. How do I reset the quota to 0 if not by deleting data? Michael R. McGowen, Ph.D. Postdoctoral Research Fellow Molecular Evolution Laboratory Center for Molecular Medicine and Genetics Wayne State University School of Medicine 3240 Scott Hall 540 E. Canfield St. Detroit, MI 48201 USA 313-577-0086 mmcgo...@med.wayne.edu http://homopan.wayne.edu/people/mmcgowen.html ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question regarding: FASTQ Quality Trimmer
Hi Rahul, This is the maximum number of bases which can have their score not included when calculating the result of the selected aggregation function. For example, if you had a 5 base window with scores of 5,5,2,5 and 5, set aggregation to min score with a specified value of 4, with the action of =: 0, for maximum number of bases to exclude, would trim 1, for maximum number of bases to exclude, would not trim Thanks for using Galaxy, Dan On Nov 23, 2011, at 11:27 PM, Rahul Kanwar wrote: Hello, I am running Galaxy locally and it has been performing flawlessly! I wanted to get more insight about this flag in the FASTQ Quality Trimmer program: Maximum number of bases to exclude from the window during aggregation Does it mean the number of 5' bases to exclude while the doing the trimming step [i.e. the sliding window starts this many bp after the read start] ? I would really appreciate if someone could shed more light on this. Thanks. regards, Rahul ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question regarding: FASTQ Quality Trimmer
Hello, I am running Galaxy locally and it has been performing flawlessly! I wanted to get more insight about this flag in the FASTQ Quality Trimmer program: Maximum number of bases to exclude from the window during aggregation Does it mean the number of 5' bases to exclude while the doing the trimming step [i.e. the sliding window starts this many bp after the read start] ? I would really appreciate if someone could shed more light on this. Thanks. regards, Rahul ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about building a reference genome index using Bowtie
I am trying to compare two genetically different strains that I have sequenced using SOLiD. I was trying to ask where these two strains are different, either in terms of deletions or polymorphisms, and one idea I had was to use Bowtie to create an index from one of these strains and then to map my reads for the other strain using this index. Is this a reasonable strategy? - Will Light Northwestern University ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about file formats
Hi, I uploaded a bed file to Galaxy and did some text manipulations. I want to download the new file as a bed format that I can then open up in excel or a text editor. However, when I save the data, it is a .tabular format that I cannot open with these programs. What should I do? Thanks, Rena ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about file formats
On Thu, Nov 10, 2011 at 6:10 PM, Rena Zheng rzh...@mail.med.upenn.edu wrote: Hi, I uploaded a bed file to Galaxy and did some text manipulations. I want to download the new file as a bed format that I can then open up in excel or a text editor. However, when I save the data, it is a .tabular format that I cannot open with these programs. What should I do? Thanks, Rena Try renaming the file to end with .tsv or .txt and Excel or your text editor should be happy. Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about uploading data through URL method
Hello Xaingmimg, When you uncompress the archive locally, does it contain a single file with more than 5000 reads? The consistent results and even number of reads (5000) may mean that the archive contains more than one file. Currently, Galaxy will only load the first file in an archive. Hopefully this helps or you have already found the solution, Take care, Jen Galaxy team On 11/7/11 10:35 PM, Xiangming Ding wrote: Hi the file name is spr097786.fastq.bz2.After upload it showed spr097786.fastq. It showed it only contain around 5000 sequence reads. I also tried to upload through FTP. so i download the file to my computer and then upload to FTP in galaxy. the totlal 800M file was uploaded to the FTP successfully. But when i transfered the file to the history i met the same problem. only 5000 sequence reads was moved to history. I donnot whether it is because of the bz2 file extension. or i should try other compressed file extension. xaingmimg Quoting Jennifer Jackson j...@bx.psu.edu: Hello Xiangmimg, Data files can be loaded using a URL on the Get Data = Upload form. FTP and HTTP connections are supported. This is briefly described on that form. If you are still having issues, there may be a problem with file compression or the connection. Downloading locally then using Galaxy's FTP upload function is certainly an option. http://wiki.g2.bx.psu.edu/Learn/Upload%20via%20FTP Best, Jen Galaxy team On 11/6/11 8:54 PM, Xiangming Ding wrote: Hi galaxy I am a new user of galaxy. i met a problem and didnot find similar question in FAQ. I wanted to upload the data from DDBJ DRA dataset to galaxy through UTL method. The file is around 800M. However after uploading, the FASTQ file was just around 2M. So I wanted know whether it is possible to upload a large file to galaxy through URL method? or I should download the file to my pc and then uploading to galaxy through FTP method. Thanks xiangmimg ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about uploading data through URL method
You can download DRA files directly by FTP to Galaxy . . Just paste the FTP address directly in the file box when using upload from my computer Best Simon On 7 November 2011 04:54, Xiangming Ding din...@ucla.edu wrote: Hi galaxy I am a new user of galaxy. i met a problem and didnot find similar question in FAQ. I wanted to upload the data from DDBJ DRA dataset to galaxy through UTL method. The file is around 800M. However after uploading, the FASTQ file was just around 2M. So I wanted know whether it is possible to upload a large file to galaxy through URL method? or I should download the file to my pc and then uploading to galaxy through FTP method. Thanks xiangmimg __**_ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/**listinfo/galaxy-devhttp://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about uploading data through URL method
Hello Xiangmimg, Data files can be loaded using a URL on the Get Data = Upload form. FTP and HTTP connections are supported. This is briefly described on that form. If you are still having issues, there may be a problem with file compression or the connection. Downloading locally then using Galaxy's FTP upload function is certainly an option. http://wiki.g2.bx.psu.edu/Learn/Upload%20via%20FTP Best, Jen Galaxy team On 11/6/11 8:54 PM, Xiangming Ding wrote: Hi galaxy I am a new user of galaxy. i met a problem and didnot find similar question in FAQ. I wanted to upload the data from DDBJ DRA dataset to galaxy through UTL method. The file is around 800M. However after uploading, the FASTQ file was just around 2M. So I wanted know whether it is possible to upload a large file to galaxy through URL method? or I should download the file to my pc and then uploading to galaxy through FTP method. Thanks xiangmimg ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about uploading data through URL method
Hi the file name is spr097786.fastq.bz2.After upload it showed spr097786.fastq. It showed it only contain around 5000 sequence reads. I also tried to upload through FTP. so i download the file to my computer and then upload to FTP in galaxy. the totlal 800M file was uploaded to the FTP successfully. But when i transfered the file to the history i met the same problem. only 5000 sequence reads was moved to history. I donnot whether it is because of the bz2 file extension. or i should try other compressed file extension. xaingmimg Quoting Jennifer Jackson j...@bx.psu.edu: Hello Xiangmimg, Data files can be loaded using a URL on the Get Data = Upload form. FTP and HTTP connections are supported. This is briefly described on that form. If you are still having issues, there may be a problem with file compression or the connection. Downloading locally then using Galaxy's FTP upload function is certainly an option. http://wiki.g2.bx.psu.edu/Learn/Upload%20via%20FTP Best, Jen Galaxy team On 11/6/11 8:54 PM, Xiangming Ding wrote: Hi galaxy I am a new user of galaxy. i met a problem and didnot find similar question in FAQ. I wanted to upload the data from DDBJ DRA dataset to galaxy through UTL method. The file is around 800M. However after uploading, the FASTQ file was just around 2M. So I wanted know whether it is possible to upload a large file to galaxy through URL method? or I should download the file to my pc and then uploading to galaxy through FTP method. Thanks xiangmimg ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] question about sorting barcoded sequences
Hi, I have an Illumina HiSeq lane of sequences, in which I input multiple samples with 5-prime 6 bp barcodes. The barcodes were added in a way so that the barcodes are the first 6 bp in the reads. What I need to do is to sort my reads according to the barcodes, then clip off the barcodes and use the remaining to do mapping. Could anybody advise how I could sort my reads based on the barcodes (e.g. the first 6 base pairs) in Galaxy? Thanks a lot! Tracy ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about formattung mouse (mm9) GTF
I have read in the mailing list that you have a workflow which can modify the human GTF file so that it will be compatible with Top Hat. Will it also work with Ensembl mm9 GTF or there is a different work flow. Thanks ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] QUESTION
Hello, For tools that allow a custom genome, the form will include an option to use a Dataset from the history (or similar). Then a sub-menu will pop up where the reference genome can be selected. Other basics: For the query sequences, Fastq or fasta format may be required. After upload, make certain the datatype is a fastq version and then run Fastq Groomer. Most alignment tools require a groomed file. For the target genome, fasta format is required. After upload, this can be assigned if needed on the Edit Attributes form (click on pencil icon). Hopefully this helps, Best, Jen Galaxy team On 10/6/11 8:57 AM, dtr...@ira.cinvestav.mx wrote: I WANT TO ALIGNMENT MILLIONS OF SEQUENCES FROM A sRNA LIBRARY WITH A SMALL GENOME (2600 BASES). HOW CAN I DO THIS ALIGNMENT IN GALAXY?. I HAVE TRIED WITH MULTIPLE ALIGNMENTS FROM TOOLS, BUT I CAN NOT SELECT BOTH FILES. THANKS FOR YOUR HELP DIANA TREJO -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question
Hello Diana, For the main public Galaxy server, an input sequence file of this size should not be a problem when analyzed through the standard tools. Hard quotas are not set at this time, but will be announced soon. Current guidelines can be found at: http://galaxyproject.org/wiki/Main Hopefully this helps, Best, Jen Galaxy team On 9/23/11 12:26 PM, dtr...@ira.cinvestav.mx wrote: Hi, mi name is Diana Trejo and I am working with galaxy for first time. I would like to analyze millions of sequences in galaxy but I don´t know if it is possible because my file is 330 MB. Are there any MB restriction for using galaxy? Thanks for your help Diana Trejo -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question
On 09/23/2011 09:26 PM, dtr...@ira.cinvestav.mx wrote: Hi, mi name is Diana Trejo and I am working with galaxy for first time. I would like to analyze millions of sequences in galaxy but I don´t know if it is possible because my file is 330 MB. Are there any MB restriction for using galaxy? Thanks for your help Diana Trejo Hi, In short, the limits are dependent on the site installation. The people responsible for running the servers are the right people to ask the question. I can tell you that in local installations, we have much larger file uploads than the ones you mention. Whatever the limit on the website, it is also possible to upload your data manually via FTP/SecureFTP. Once your data are uploaded, they should be accessible via the web interface. PS:Note that the National Bioinformatics Node of Mexico (Centro De Ciencias Genomicas) will discuss Galaxy during the National Bioinformatics Week. I do not know if the formal announcement has been made yet, but it should be during the last week of January 2012 or the week before that. Best regards, GM -- -- George Magklaras PhD RHCE no: 805008309135525 Senior Systems Engineer/IT Manager Biotek Center, University of Oslo EMBnet TMPC Chair http://folk.uio.no/georgios Tel: +47 22840535 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question
Hi, mi name is Diana Trejo and I am working with galaxy for first time. I would like to analyze millions of sequences in galaxy but I don´t know if it is possible because my file is 330 MB. Are there any MB restriction for using galaxy? Thanks for your help Diana Trejo -- This message has been scanned for viruses and dangerous content by MailScanner, and is believed to be clean. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] question about the GATK tools
Hi, I just uploaded the BAM file for an exome sequencing sample and was trying to use the GATK tools. In the first step, realigner Target creator, I can see my uploaded file but I can't see any options under the using reference genome and the following choices so I can't click execute. Did I do anything wrong? Thanks! Xiaojing Hong University of Iowa ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about Cuffdiff
Hello Luciano, This was a bug, fixed in galaxy-central yesterday: changeset 4212f675f95b . You can either pull the changeset into your local instance or wait for it to be incorporated into the next distribution (within the next few weeks). Next time, it would be great if you would send questions like this directly to the mailing lists: - galaxy-u...@bx.psu.edu for data/tool questions like this one - galaxy-...@bx.psu.edu local install/technical questions Thanks! Jen Galaxy team On 8/3/11 4:16 PM, Luciano Cosme wrote: Hi Jeni, I am sorry to bother you again. I am also running galaxy locally and I solved all the problems so far. Now I am running cuffdiff and when I select my data input at SAM or BAM file of aligned RNA-Seq reads: I get a red message telling me to choose the genome build for that data set Unspecified genome build, click the pencil icon in the history item to set the genome build. The problem is that used a custom index since AaegL1 is not available locally. Any thoughts how to go around it. I will attach a ss. Thank you . Luciano -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about using bowtie
Hello William, The tools in NGS: QC and manipulation, especially those in the sub-section AB-SOLiD data can do the manipulations needed before mapping. It may be helpful to view the screencast at http://usegalaxy.org, center pane, quickie #9. Hopefully this helps to get you started, Best, Jen Galaxy team On 7/28/11 2:29 PM, William Light wrote: I am trying to use bowtie to assign reads to the s. Cerevisiae genome. I have data from paired end SOLiD sequencing with two unique six base pair barcodes. Can I use bowtie to make csfasta and qual files from my mixed original data split by bar code? I know I can use the trim option to remove the barcode, but how do I specify one only? ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] question about using bowtie
I am trying to use bowtie to assign reads to the s. Cerevisiae genome. I have data from paired end SOLiD sequencing with two unique six base pair barcodes. Can I use bowtie to make csfasta and qual files from my mixed original data split by bar code? I know I can use the trim option to remove the barcode, but how do I specify one only? ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question regarding quality filtering of 454 amplicons
Hi Jackie, The screencasts under Metagenomic Analyses with Galaxy specifically use 454 data and would likely be helpful, maybe even if you have already resolved your prior issue. http://main.g2.bx.psu.edu/screencast Apologies for the delay in reply, we were a bit backed up with questions in March and a few slipped through. Take care, Jen Galaxy team On 3/10/11 8:14 AM, Jackie Lighten wrote: Hi, I have a question for you guys regarding quality filtering. I have a data set of double MID tagged 454 amplicons, from which I wish to select high quality sequences above Q20. The 454 quality filtering system seems to work differently from that given for the Illumina sequencing i.e. 454 filtering takes high quality segments, while Illumina (FASTQ) can select high quality full reads based on certain parameters. OK, so I know that the total length of my amplicon, including primers and barcodes is around 260bp. If I then set the 454 quality filtering tool to extract contiguous high quality sequence of 260, it gives me back around 45% of my raw data as hitting this criterion i.e. All 260bp are above Q20. I don’t necessarily need this high stringency as most bases may not be informative. But if I convert my 454 data to FASTQ format and then run the Illumina filtering system which also allows me to set the number of bases allowed to deviate from the Q20 criteria, I get back over 90% of my data (allowing 10bp to deviate from Q20). I then need to go ahead and convert back to 454 format. Can you tell me if this is OK? Will I loose /confuse information somewhere along these conversions? It seems that if I do this, my barcodes are removed, as amplicons do not sort properly when I parse them through my barcode filtering program. Does anyone know of a program to filter 454 data based on average sequence quality score, which doesn’t involve Linux and the Roche off instrument program (I have no experience in Linux! ) Thanks! -- Jack Lighten, Ph.D. Candidate, Bentzen Lab, Room 6078, Department of Biology, Dalhousie University, Halifax, NS, B3H 4J1 Canada Office:(902) 494-1398 Email: _jackie.ligh...@dal.ca _Profile: www.marinebiodiversity.ca/CHONe/Members/lightenj/profile/bio ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org/ http://galaxyproject.org/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question on cufflinks output
Hi galaxy-users When trying to display a set of chip microarray data in UCSC main, , we encounter this error: Error(s): Error line 38879 of http://main.g2.bx.psu.edu/root/display_as?id=3221463display_app=ucscauthz_method=display_at: chromEnd larger than chrom chr21_random size (1679928 1679693) Can anybody help for this? Best, Yongde On Sat, Jun 25, 2011 at 11:13 AM, Jeremy Goecks jeremy.goe...@emory.edu wrote: Hello Wen, It's not necessary to send multiple emails to the mailing list; we track incoming emails to ensure that we respond to all of them. Your FPKM values do look high, but keep in mind that coverage is only part of the FPKM calculation; it's also dependent on transcript length and the total number of reads in your sample. Your transcript lengths look very short, so that may be skewing your FPKM values. For the record, Cufflinks is using scientific/E notation, so e denotes powers of 10 in the FPKM output. A good place to ask followup questions about cufflinks output is the cufflinks help email address: tophat.cuffli...@gmail.com Good luck, J. On Jun 24, 2011, at 10:35 AM, Wen Huang wrote: Dear Galaxy team and users, I have a question on the output by cufflinks on Galaxy. I started with about 28M paired-end reads and mapped them to the reference genome using Tophat on Galaxy. The aligned fragments were assembled by cufflinks, again on Galaxy and I got an output with the first few lines on the bottom of this email. I was wondering how could cufflinks possibly estimate FPKM on the order of e+07 when the coverage is between 8-50 fragments per base and the total mapped fragments smaller than 28M. Assuming that 20M fragments were mapped, the FPKM should be something around coverage/28. Was the e in the output the Euler's number or 10? I appreciate your help. Thanks, Wen Huang tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coveragestatus FPKMFPKM_conf_loFPKM_conf_hi CUFF.2.1 - - CUFF.2 - - chr1:90301-90706 405 21.1837 OK 1.84527e+07 1.10716e+07 2.58338e+07 CUFF.1.1 - - CUFF.1 - - chr1:65419-65692 273 30.9833 OK 2.31848e+07 8.52143e+06 3.78481e+07 CUFF.3.1 - - CUFF.3 - - chr1:135255-135896 641 8.61389 OK 6.31907e+06 3.41968e+06 9.21846e+06 CUFF.4.1 - - CUFF.4 - - chr1:155808-156529 721 7.26147 OK 5.32695e+06 2.88278e+06 7.77112e+06 CUFF.5.1 - - CUFF.5 - - chr1:160421-160729 308 17.6004 OK 1.77483e+07 7.50132e+06 2.79953e+07 CUFF.6.1 - - CUFF.6 - - chr1:170695-171212 517 9.16414 OK 8.41605e+06 4.44869e+06 1.23834e+07 CUFF.7.1 - - CUFF.7 - - chr1:180885-181188 303 30.5702 OK 2.6515e+07 1.36533e+07 3.93767e+07 CUFF.8.1 - - CUFF.8 - - chr1:184397-184702 305 26.712 OK 2.13696e+07 9.94707e+06 3.27921e+07 CUFF.10.1 - - CUFF.10 - - chr1:233237-234095 858 3.71208 OK 3.31435e+06 1.60283e+06 5.02588e+06 CUFF.9.1 - - CUFF.9 - - chr1:203688-204070 382 41.6301 OK 5.36082e+07 4.02061e+07 6.70102e+07 CUFF.11.1 - - CUFF.11 - - chr1:239126-239664 538 19.5995 OK 2.0562e+07 1.45634e+07 2.65605e+07 CUFF.12.1 - - CUFF.12 - - chr1:243903-244327 424 10.3509 OK 1.07542e+07 5.37709e+06 1.61313e+07 CUFF.15.1 - - CUFF.15 - - chr1:240487-240995 508 15.8596 OK 1.83065e+07 1.23671e+07 2.42459e+07 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists,
Re: [galaxy-user] question on cufflinks output
Hello, The error is indicating that the end of your dataset is larger than the chromosome it is aligned to for this line (at least). This is expected when attempting display of certain data types at UCSC. This is a known issue. You can either remove these lines from your dataset with tools in Text Manipulation, download the data trim coordinates using unix tools you design or obtain from UCSC, or best: view in Trackster (Visualization). Hopefully one of these solution will work for you, Best, Jen Galaxy team ps: For next time, it would be very helpful for us if you would start over in a completely fresh/new thread email when starting another discussion topic, to help us track and answer the most effectively. Thanks! On 6/27/11 9:48 AM, YBao wrote: Hi galaxy-users When trying to display a set of chip microarray data in UCSC main, , we encounter this error: Error(s): Error line 38879 of http://main.g2.bx.psu.edu/root/display_as?id=3221463display_app=ucscauthz_method=display_at: chromEnd larger than chrom chr21_random size (1679928 1679693) Can anybody help for this? Best, Yongde On Sat, Jun 25, 2011 at 11:13 AM, Jeremy Goecksjeremy.goe...@emory.edu wrote: Hello Wen, It's not necessary to send multiple emails to the mailing list; we track incoming emails to ensure that we respond to all of them. Your FPKM values do look high, but keep in mind that coverage is only part of the FPKM calculation; it's also dependent on transcript length and the total number of reads in your sample. Your transcript lengths look very short, so that may be skewing your FPKM values. For the record, Cufflinks is using scientific/E notation, so e denotes powers of 10 in the FPKM output. A good place to ask followup questions about cufflinks output is the cufflinks help email address: tophat.cuffli...@gmail.com Good luck, J. On Jun 24, 2011, at 10:35 AM, Wen Huang wrote: Dear Galaxy team and users, I have a question on the output by cufflinks on Galaxy. I started with about 28M paired-end reads and mapped them to the reference genome using Tophat on Galaxy. The aligned fragments were assembled by cufflinks, again on Galaxy and I got an output with the first few lines on the bottom of this email. I was wondering how could cufflinks possibly estimate FPKM on the order of e+07 when the coverage is between 8-50 fragments per base and the total mapped fragments smaller than 28M. Assuming that 20M fragments were mapped, the FPKM should be something around coverage/28. Was the e in the output the Euler's number or 10? I appreciate your help. Thanks, Wen Huang tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coveragestatus FPKMFPKM_conf_loFPKM_conf_hi CUFF.2.1- - CUFF.2 - - chr1:90301-90706 405 21.1837 OK 1.84527e+07 1.10716e+07 2.58338e+07 CUFF.1.1- - CUFF.1 - - chr1:65419-65692 273 30.9833 OK 2.31848e+07 8.52143e+06 3.78481e+07 CUFF.3.1- - CUFF.3 - - chr1:135255-135896 641 8.61389 OK 6.31907e+06 3.41968e+06 9.21846e+06 CUFF.4.1- - CUFF.4 - - chr1:155808-156529 721 7.26147 OK 5.32695e+06 2.88278e+06 7.77112e+06 CUFF.5.1- - CUFF.5 - - chr1:160421-160729 308 17.6004 OK 1.77483e+07 7.50132e+06 2.79953e+07 CUFF.6.1- - CUFF.6 - - chr1:170695-171212 517 9.16414 OK 8.41605e+06 4.44869e+06 1.23834e+07 CUFF.7.1- - CUFF.7 - - chr1:180885-181188 303 30.5702 OK 2.6515e+07 1.36533e+07 3.93767e+07 CUFF.8.1- - CUFF.8 - - chr1:184397-184702 305 26.712 OK 2.13696e+07 9.94707e+06 3.27921e+07 CUFF.10.1 - - CUFF.10 - - chr1:233237-234095 858 3.71208 OK 3.31435e+06 1.60283e+06 5.02588e+06 CUFF.9.1- - CUFF.9 - - chr1:203688-204070 382 41.6301 OK 5.36082e+07 4.02061e+07 6.70102e+07 CUFF.11.1 - - CUFF.11 - - chr1:239126-239664 538 19.5995 OK 2.0562e+07 1.45634e+07 2.65605e+07 CUFF.12.1 - - CUFF.12 - - chr1:243903-244327 424 10.3509 OK 1.07542e+07 5.37709e+06 1.61313e+07 CUFF.15.1 - - CUFF.15 - - chr1:240487-240995 508 15.8596 OK 1.83065e+07 1.23671e+07 2.42459e+07 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy
Re: [galaxy-user] question on cufflinks output
Hello Wen, It's not necessary to send multiple emails to the mailing list; we track incoming emails to ensure that we respond to all of them. Your FPKM values do look high, but keep in mind that coverage is only part of the FPKM calculation; it's also dependent on transcript length and the total number of reads in your sample. Your transcript lengths look very short, so that may be skewing your FPKM values. For the record, Cufflinks is using scientific/E notation, so e denotes powers of 10 in the FPKM output. A good place to ask followup questions about cufflinks output is the cufflinks help email address: tophat.cuffli...@gmail.com Good luck, J. On Jun 24, 2011, at 10:35 AM, Wen Huang wrote: Dear Galaxy team and users, I have a question on the output by cufflinks on Galaxy. I started with about 28M paired-end reads and mapped them to the reference genome using Tophat on Galaxy. The aligned fragments were assembled by cufflinks, again on Galaxy and I got an output with the first few lines on the bottom of this email. I was wondering how could cufflinks possibly estimate FPKM on the order of e+07 when the coverage is between 8-50 fragments per base and the total mapped fragments smaller than 28M. Assuming that 20M fragments were mapped, the FPKM should be something around coverage/28. Was the e in the output the Euler's number or 10? I appreciate your help. Thanks, Wen Huang tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coveragestatus FPKMFPKM_conf_loFPKM_conf_hi CUFF.2.1 - - CUFF.2 - - chr1:90301-90706 405 21.1837 OK 1.84527e+07 1.10716e+07 2.58338e+07 CUFF.1.1 - - CUFF.1 - - chr1:65419-65692 273 30.9833 OK 2.31848e+07 8.52143e+06 3.78481e+07 CUFF.3.1 - - CUFF.3 - - chr1:135255-135896 641 8.61389 OK 6.31907e+06 3.41968e+06 9.21846e+06 CUFF.4.1 - - CUFF.4 - - chr1:155808-156529 721 7.26147 OK 5.32695e+06 2.88278e+06 7.77112e+06 CUFF.5.1 - - CUFF.5 - - chr1:160421-160729 308 17.6004 OK 1.77483e+07 7.50132e+06 2.79953e+07 CUFF.6.1 - - CUFF.6 - - chr1:170695-171212 517 9.16414 OK 8.41605e+06 4.44869e+06 1.23834e+07 CUFF.7.1 - - CUFF.7 - - chr1:180885-181188 303 30.5702 OK 2.6515e+07 1.36533e+07 3.93767e+07 CUFF.8.1 - - CUFF.8 - - chr1:184397-184702 305 26.712 OK 2.13696e+07 9.94707e+06 3.27921e+07 CUFF.10.1 - - CUFF.10 - - chr1:233237-234095 858 3.71208 OK 3.31435e+06 1.60283e+06 5.02588e+06 CUFF.9.1 - - CUFF.9 - - chr1:203688-204070 382 41.6301 OK 5.36082e+07 4.02061e+07 6.70102e+07 CUFF.11.1 - - CUFF.11 - - chr1:239126-239664 538 19.5995 OK 2.0562e+07 1.45634e+07 2.65605e+07 CUFF.12.1 - - CUFF.12 - - chr1:243903-244327 424 10.3509 OK 1.07542e+07 5.37709e+06 1.61313e+07 CUFF.15.1 - - CUFF.15 - - chr1:240487-240995 508 15.8596 OK 1.83065e+07 1.23671e+07 2.42459e+07 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] question on cufflinks output
Dear Galaxy team and users, I have a question on the output by cufflinks on Galaxy. I started with about 28M paired-end reads and mapped them to the reference genome using Tophat on Galaxy. The aligned fragments were assembled by cufflinks, again on Galaxy and I got an output with the first few lines on the bottom of this email. I was wondering how could cufflinks possibly estimate FPKM on the order of e+07 when the coverage is between 8-50 fragments per base and the total mapped fragments smaller than 28M. Assuming that 20M fragments were mapped, the FPKM should be something around coverage/28. Was the e in the output the Euler's number or 10? I appreciate your help. Thanks, Wen Huang tracking_id class_code nearest_ref_id gene_id gene_short_name tss_id locus length coveragestatus FPKMFPKM_conf_loFPKM_conf_hi CUFF.2.1- - CUFF.2 - - chr1:90301-90706 405 21.1837 OK 1.84527e+07 1.10716e+07 2.58338e+07 CUFF.1.1- - CUFF.1 - - chr1:65419-65692 273 30.9833 OK 2.31848e+07 8.52143e+06 3.78481e+07 CUFF.3.1- - CUFF.3 - - chr1:135255-135896 641 8.61389 OK 6.31907e+06 3.41968e+06 9.21846e+06 CUFF.4.1- - CUFF.4 - - chr1:155808-156529 721 7.26147 OK 5.32695e+06 2.88278e+06 7.77112e+06 CUFF.5.1- - CUFF.5 - - chr1:160421-160729 308 17.6004 OK 1.77483e+07 7.50132e+06 2.79953e+07 CUFF.6.1- - CUFF.6 - - chr1:170695-171212 517 9.16414 OK 8.41605e+06 4.44869e+06 1.23834e+07 CUFF.7.1- - CUFF.7 - - chr1:180885-181188 303 30.5702 OK 2.6515e+07 1.36533e+07 3.93767e+07 CUFF.8.1- - CUFF.8 - - chr1:184397-184702 305 26.712 OK 2.13696e+07 9.94707e+06 3.27921e+07 CUFF.10.1 - - CUFF.10 - - chr1:233237-234095 858 3.71208 OK 3.31435e+06 1.60283e+06 5.02588e+06 CUFF.9.1- - CUFF.9 - - chr1:203688-204070 382 41.6301 OK 5.36082e+07 4.02061e+07 6.70102e+07 CUFF.11.1 - - CUFF.11 - - chr1:239126-239664 538 19.5995 OK 2.0562e+07 1.45634e+07 2.65605e+07 CUFF.12.1 - - CUFF.12 - - chr1:243903-244327 424 10.3509 OK 1.07542e+07 5.37709e+06 1.61313e+07 CUFF.15.1 - - CUFF.15 - - chr1:240487-240995 508 15.8596 OK 1.83065e+07 1.23671e+07 2.42459e+07 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question please -manhattan plots
Dear sir, I was looking through your Galaxy Wiki, but could not find an answer to my question. I would most appreciate any help regarding the following issue: I'm conducting a GWAS study in horses. Up until now I've been using PLINK for my association analysis, and now I wish to generate a Manhattan plot. I've been looking through your online version of Galaxy-Tool under SNP/WGA: QC; LD; Plots http://main.g2.bx.psu.edu/root/tool_menu# -- Manhattan/QQ:http://main.g2.bx.psu.edu/tool_runner?tool_id=rgManQQ1 link, and I've read all the instructions. I think I have an appropriate file ready to run this on your online version, but I was hoping you can send me an example file of how exactly the data should look like (and not just brief explanations about the syntax), and in what format exactly should I upload it? If you have a tutorial about this, even better. Many thanks! Sincerely, Sagi Polani Molecular Evolution Lab Koret School of Veterinary Medicine The Hebrew University of Jerusalem Israel ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question about output CuffDiff SplicingDiff
Hi there, Looking at the output of the SplicingDiff files of CuffDiff, me and my colleagues are preplexed about the output of the p_values and q_values. We've tried different inputs of different samples to compare but never seem to manage to get p_values smaller than 0.50 and we keep getting higher than 1 q_values (also smaller which we expect) which we think is strange too. The input files we use for the CuffDiff are the CuffCompare of a combined CuffCompare of a dataset, or the CuffCompare of just the two samples we want to analyse. For the samples input files we use the TopHat files respectively. Could you please help us get meaningful results for the SplicingDiff files or help us understand the data? The top 5 rows of our typical SplicingDiff file: test_id gene_id genelocus sample_1 sample_2 1583 TSS11905 XLOC_028193- chr5:134910259-134914719 q1 q2 2385 TSS12870 XLOC_030892- chr7:29976178-30008608 q1 q2 8005 TSS6887 XLOC_016656- chr18:47803031-47807892 q1 q2 10214 TSS9761 XLOC_022527- chr20:43128822-43138649 q1 q2 2818 TSS13383 XLOC_032450- chr8:100899717-100905900 q1 q2 status value_1 value_2sqrt.JS. test_stat p_value q_value 1583 OK 0 0 0.000771867 0.797878 0.501645 164.5400 2385 OK 0 0 0.001548470 0.797809 0.505482 82.8991 8005 OK 0 0 0.003288510 0.797717 0.508184 55.5615 10214 OK 0 0 0.001414180 0.797620 0.510277 41.8427 2818 OK 0 0 0.007112780 0.797416 0.513678 33.6973 Thanks in advance for your most appreciated help, Felix Mayr ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about output CuffDiff SplicingDiff
Felix, You seem to be providing the correct inputs to Cuffdiff and it appears to be producing valid output. More information about setting parameter values and interpreting Cuffdiff can be found in manual: http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff Good luck, J. On Jun 16, 2011, at 8:13 AM, Felix Mayr wrote: Hi there, Looking at the output of the SplicingDiff files of CuffDiff, me and my colleagues are preplexed about the output of the p_values and q_values. We've tried different inputs of different samples to compare but never seem to manage to get p_values smaller than 0.50 and we keep getting higher than 1 q_values (also smaller which we expect) which we think is strange too. The input files we use for the CuffDiff are the CuffCompare of a combined CuffCompare of a dataset, or the CuffCompare of just the two samples we want to analyse. For the samples input files we use the TopHat files respectively. Could you please help us get meaningful results for the SplicingDiff files or help us understand the data? The top 5 rows of our typical SplicingDiff file: test_id gene_id genelocus sample_1 sample_2 1583 TSS11905 XLOC_028193- chr5:134910259-134914719 q1 q2 2385 TSS12870 XLOC_030892- chr7:29976178-30008608 q1 q2 8005 TSS6887 XLOC_016656- chr18:47803031-47807892 q1 q2 10214 TSS9761 XLOC_022527- chr20:43128822-43138649 q1 q2 2818 TSS13383 XLOC_032450- chr8:100899717-100905900 q1 q2 status value_1 value_2sqrt.JS. test_stat p_value q_value 1583 OK 0 0 0.000771867 0.797878 0.501645 164.5400 2385 OK 0 0 0.001548470 0.797809 0.505482 82.8991 8005 OK 0 0 0.003288510 0.797717 0.508184 55.5615 10214 OK 0 0 0.001414180 0.797620 0.510277 41.8427 2818 OK 0 0 0.007112780 0.797416 0.513678 33.6973 Thanks in advance for your most appreciated help, Felix Mayr ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question about output CuffDiff SplicingDiff
What version of Cufflinks is your Galaxy installation running? A recent version (1.00 and 1.01) had a problem that was causing the splicing and promoter use tests to have very few differentially regulated genes, according to http://cufflinks.cbcb.umd.edu/. -rory On Jun 16, 2011, at 8:13 AM, Felix Mayr wrote: Hi there, Looking at the output of the SplicingDiff files of CuffDiff, me and my colleagues are preplexed about the output of the p_values and q_values. We've tried different inputs of different samples to compare but never seem to manage to get p_values smaller than 0.50 and we keep getting higher than 1 q_values (also smaller which we expect) which we think is strange too. The input files we use for the CuffDiff are the CuffCompare of a combined CuffCompare of a dataset, or the CuffCompare of just the two samples we want to analyse. For the samples input files we use the TopHat files respectively. Could you please help us get meaningful results for the SplicingDiff files or help us understand the data? The top 5 rows of our typical SplicingDiff file: test_id gene_id genelocus sample_1 sample_2 1583 TSS11905 XLOC_028193- chr5:134910259-134914719 q1 q2 2385 TSS12870 XLOC_030892- chr7:29976178-30008608 q1 q2 8005 TSS6887 XLOC_016656- chr18:47803031-47807892 q1 q2 10214 TSS9761 XLOC_022527- chr20:43128822-43138649 q1 q2 2818 TSS13383 XLOC_032450- chr8:100899717-100905900 q1 q2 status value_1 value_2sqrt.JS. test_stat p_value q_value 1583 OK 0 0 0.000771867 0.797878 0.501645 164.5400 2385 OK 0 0 0.001548470 0.797809 0.505482 82.8991 8005 OK 0 0 0.003288510 0.797717 0.508184 55.5615 10214 OK 0 0 0.001414180 0.797620 0.510277 41.8427 2818 OK 0 0 0.007112780 0.797416 0.513678 33.6973 Thanks in advance for your most appreciated help, Felix Mayr ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about Filtering Cufflink files
Jagat, First, a couple housekeeping issues: (a) the questions you're asking are better suited to the galaxy-user list (questions about using Galaxy and performing analyses) rather than galaxy-dev (questions about installing Galaxy locally and tool development), so I've moved this thread to galaxy-user; (b) please start new threads when appropriate rather than replying to older threads as this makes threads shorter and more focused. Onto your questions: I have another question when I filter gene list In the filtered list there are multiple rows per gene. I should have one gene per row? I have attached the snap shot of out put, but not sure if galaxy server will take it or not. I did se the discussion on other forum: http://seqanswers.com/forums/showthread.php?t=8830 GTF files have multiple lines per feature, so your output is reasonable. which suggest that possible complications in getting one gene per row. My next question is in that scenario what should be the best way of representing one gene per FPKM value? should we take average of FPKM per gene? I think in the gene it is till giving the transcript FPKM value but these values are different from previous file filtered with transcript id. As Vasu noted, this is an ongoing area of research. For some experiments, it may be reasonable to group alternatively-spliced isoforms of the same gene and jointly estimate FPKM, and for others it may not. Fortunately, if you do want to group transcripts to get gene FPKM values, Cuffdiff does this for you: see its gene FPKM expression file. Best, J.___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Question regarding quality filtering of 454 amplicons
Hi, I have a question for you guys regarding quality filtering. I have a data set of double MID tagged 454 amplicons, from which I wish to select high quality sequences above Q20. The 454 quality filtering system seems to work differently from that given for the Illumina sequencing i.e. 454 filtering takes high quality segments, while Illumina (FASTQ) can select high quality full reads based on certain parameters. OK, so I know that the total length of my amplicon, including primers and barcodes is around 260bp. If I then set the 454 quality filtering tool to extract contiguous high quality sequence of 260, it gives me back around 45% of my raw data as hitting this criterion i.e. All 260bp are above Q20. I don¹t necessarily need this high stringency as most bases may not be informative. But if I convert my 454 data to FASTQ format and then run the Illumina filtering system which also allows me to set the number of bases allowed to deviate from the Q20 criteria, I get back over 90% of my data (allowing 10bp to deviate from Q20). I then need to go ahead and convert back to 454 format. Can you tell me if this is OK? Will I loose /confuse information somewhere along these conversions? It seems that if I do this, my barcodes are removed, as amplicons do not sort properly when I parse them through my barcode filtering program. Does anyone know of a program to filter 454 data based on average sequence quality score, which doesn¹t involve Linux and the Roche off instrument program (I have no experience in Linux! ) Thanks! -- Jack Lighten, Ph.D. Candidate, Bentzen Lab, Room 6078, Department of Biology, Dalhousie University, Halifax, NS, B3H 4J1 Canada Office:(902) 494-1398 Email: jackie.ligh...@dal.ca Profile: www.marinebiodiversity.ca/CHONe/Members/lightenj/profile/bio ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question About FTP
Hey Jennifer, I was using email/password, just tried again and I got in. Weird. Thanks for the quick response! Danny On Mon, Feb 7, 2011 at 3:21 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hello Danny, Are you connecting to main.g2.bx.psu.edu and using your Galaxy credentials email/password? Maybe you were trying anonymous/email - which will not work? Please double check and let us know if you continue to have issues, Thanks! jen On 2/7/11 8:58 AM, Danny Park wrote: Hey guys, I was trying to connect to the public instance of galaxy via FTP but was not able to do so successfully. I tried both FTP and SFTP. Is there something I am missing? Thanks, Danny ___ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org ___ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user
