Re: [galaxy-user] have fsatq ... but don't know input format for groomer?
Hi Kory,
The problem with this FASTQ block is that the sequence and quality score
identifier lines do not match ('SNPSTER6_0679:1:1:1083:939#0/1
run=100908_SNPSTER6_0679_70929AAXX' vs 'SNPSTER6_0679:1:1:1083:939#0/1'), where
the identifier for the sequence line has additional text not found on the
identifier for the quality score line, which is not valid for the FASTQ format.
Alternatively the quality score identifier line could be only a '+', without
the sequence identifier.
The quality score lines appear to be either illumina or solexa, but it is best
to check with the source of the data to be sure:
Input ASCII range: 'B'(66) - '_'(95)
Input decimal range: 2 - 31
You'll need to upload valid FASTQ files inorder to work with them in Galaxy.
Correct examples of your provided read are:
@SNPSTER6_0679:1:1:1083:939#0/1
NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
+SNPSTER6_0679:1:1:1083:939#0/1
BIQQIQQQTP[QPT[[YYTTTOVVTWVXRWPTQPQWTOOVV___V_TROOWTWTWTQWQWTTRWRO
or
@SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX
NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
+
BIQQIQQQTP[QPT[[YYTTTOVVTWVXRWPTQPQWTOOVV___V_TROOWTWTWTQWQWTTRWRO
or
@SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX
NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
+SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX
BIQQIQQQTP[QPT[[YYTTTOVVTWVXRWPTQPQWTOOVV___V_TROOWTWTWTQWQWTTRWRO
Please let us know if we can be of further assistance.
Thanks for using Galaxy,
Dan
On Feb 2, 2011, at 2:01 PM, Johnson, Kory (NIH/NINDS) [C] wrote:
> Hello,
>
> My account login is: johnso...@ninds.nih.gov
>
> I am a first time Galaxy user.
>
> I have uploaded my sequences as format “fastq” into Galaxy and would like to
> next use “Groomer” to output Sanger fastq format so to go on with exploring
> quality via box plot, deciding on a trim length (if any), and map to genome
> using bwa or bowtie.
>
> However, I am running into a problem using “Groomer”.
>
> I do not know what format my sequences are per setting the required input
> parameter.
>
> An example of my sequences is as follows:
>
> @SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX
> NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA
> +SNPSTER6_0679:1:1:1083:939#0/1
> BIQQIQQQTP[QPT[[YYTTTOVVTWVXRWPTQPQWTOOVV___V_TROOWTWTWTQWQWTTRWRO
>
> … how to tell if you have: “Sanger”, “Solexa”, “Illumina 1.3+”, etc.
>
> I have tried to submit to “Groomer” different times using these options one
> at a time and none return with results.
>
> Need help please.
>
> Also, what is the expected time for “Groomer” to return results for a file
> containing 2.7 million reads.
>
> Thank you … best,
>
> Kory
>
>
>
> Kory R. Johnson, MS, PhD
> Sr. Bioinformatics Scientist
>
>
>
> www.kellygovernmentsolutions.com
>
> Providing Contract Services For:
>
> Bioinformatics Section,
> Information Technology & Bioinformatics Program,
> Division of Intramural Research (DIR),
> National Institute of Neurological Disorders & Stroke (NINDS),
> National Institutes of Health (NIH),
> Bethesda, Maryland
>
> Mailing Address:
>
> NINDS/NIH
> Clinical Center (Building 10)
> Office 5S223
> 9000 Rockville Pike
> Bethesda, MD 20892
>
> Contact Information:
>
> Phone:301-402-1956
> Fax: 301-480-3563
> email: johnso...@ninds.nih.gov
>
> P Green Message:
>
> Please consider the environment before printing this e-mail. Thank you.
>
> Important Message:
>
> This electronic message transmission contains information intended for the
> recipient only. Such that, the information contained herein may be
> confidential, privaledged, or proprietary. If you are not the intended
> recipient, be aware that any disclosure, copying, distribution, or use of
> this information is strictly prohibited. If you have received this
> electronic information in error, please notify the sender immediately by
> telephone. Thank you.
>
>
>
> ___
> galaxy-user mailing list
> galaxy-user@lists.bx.psu.edu
> http://lists.bx.psu.edu/listinfo/galaxy-user
___
galaxy-user mailing list
galaxy-user@lists.bx.psu.edu
http://lists.bx.psu.edu/listinfo/galaxy-user
Re: [galaxy-user] FastX Clipper on FastQ data
Hi Mike, I was able to select fastqsanger files from one of my histories at our public server. If you are using the public server, can you share your history with me and I will check if there is a reason you are unable to select these datasets. If you are trying this on your local instance, can you make sure it is running up-to-date Galaxy code? Thanks for using Galaxy, Dan On Feb 17, 2011, at 7:40 AM, Michael Walter wrote: > > Dear Peter, > > Thanks for the quick reply. But yes, the groomer output was marked as > fastqsanger. I changed to generic fastq and back and it didn't work either > way. I only get the fasta files from my history as possible input files. > However, using the local installation via command line seemed to work > (fastx_clipper -a TGGAATTCTCGGGTGCCAAGG -l 15 -n -v -i s_1_sequence.txt -o > s_1_sequence_clipped.txt) > > Kind regards, > > Mike > > -- > Dr. Michael Walter > MFT Services > University of Tübingen > Calwerstr. 7 > 72076 Tübingen > > Tel.: +49 7071 29 83210 > Fax. + 49 7071 29 5228 > web: www.mft-services.de > > Confidentiality Note: > This message is intended only for the use of the named recipient(s) and may > contain confidential and/or proprietary information. If you are not the > intended > recipient, please contact the sender and delete the message. Any unauthorized > use of the information contained in this message is prohibited. > > -Ursprüngliche Nachricht- > Von: "Peter Cock" > Gesendet: 17.02.2011 11:44:01 > An: "Michael Walter" > Betreff: Re: [galaxy-user] FastX Clipper on FastQ data > >> On Thu, Feb 17, 2011 at 10:06 AM, Michael Walter >> wrote: >>> >>> Hi List, >>> >>> I have a couple of miRNA-Seq files (Illumina GAIIx, 29nt read length). These >>> reads contain differing amounts of 3' adapter sequences and therefore map >>> really badly to the human genome (with eland v2). Therefore, I'd like to use >>> the FastX clipper tool, which states that "This tool clips adapters from the >>> 3'-end of the sequences in a FASTA/FASTQ file." However, After uploading >>> my fastq files and converting it to Sanger format, the clipper does not >>> accept >>> the fastq file as input. After converting it to fasta it works fine. >>> However, the >>> mapping tools will only accept fastq files. So my question is, is there a >>> way >>> to clip the adapter directly in the fastq file (we have a local >>> installation of >>> galaxy, so I may also use command line options)? >>> >>> Thank you very much for your input, >>> >>> Mike >> >> Hi Mike, >> >> Is your input FASTQ file definitely marked as type fastqsanger (not just >> fastq)? >> >> The fasta_clipper.xml says it will take >> fasta,fastqsanger,fastqsolexa,fastqillumina and is >> (now) aware that it should use the -Q 33 switch on Sanger FASTQ, see: >> https://bitbucket.org/galaxy/galaxy-central/src/default/tools/fastx_toolkit/fastx_clipper.xml >> >> Notice however that it does not accept the generic "fastq" Galaxy >> format (which I think >> would also include color-space FASTQ). >> >> Peter > > ___ > The Galaxy User list should be used for the discussion > of Galaxy analysis and other features on the public > server at usegalaxy.org. For discussion of local Galaxy > instances and the Galaxy source code, please use the > Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other > Galaxy lists, please use the interface at: > > http://lists.bx.psu.edu/ > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] FASTQ type change
Hi Stephen and Peter, This change is definitely possible, and because the SAM format specifies that its quality scores are phred scaled and ASCII offset of 33 (regardless of provided input) it shouldn't cause complications downstream. We'll add this to our todo list. I created a ticket: https://bitbucket.org/galaxy/galaxy-central/issue/471/allow-bowtie-mapper-to-accept-fastq that you can follow if you like. Thanks, Dan On Feb 10, 2011, at 1:42 PM, Peter Cock wrote: > On Thu, Feb 10, 2011 at 6:34 PM, Stephen Taylor > wrote: >> On 10/02/2011 13:05, Peter Cock wrote: >>> >>> On Thu, Feb 10, 2011 at 12:49 PM, Stephen Taylor >>> wrote: I think you have but it doesn't help. :-) The issue is we get a lot of Illumina 1.3+ format FASTQ files and bowtie in Galaxy by default doesn't accept them although there is an option on the command line bowtie to read these. So I think the solution seems to be either hardwire the code in our local Galaxy instance to use the --solexa1.3-quals option or (probably more useful) put a drop down list in the web UI to allow the user to set the format of the fastq sequences on the bowtie tool. >>> >>> Not the best approach. >>> >>> I think you should update the XML to include the --solexa1.3-quals option >>> if the Galaxy file format is fastqillumina, see for example (in the >>> reverse situation) the -Q 33 option is only used on fastqsanger when >>> calling the FASTX tools, e.g. >>> >>> >>> https://bitbucket.org/galaxy/galaxy-central/src/default/tools/fastx_toolkit/fastx_clipper.xml >>> >>> That way the user must mark their FASTQ file type as usual (at upload time >>> or via the "pencil icon" to edit the attributes), and then bowtie will be >>> called appropriately. >>> >> >> Ok. Cool. I didn't realise you could do that! >> >> Sounds like this should be added into the main release. It would save a lot >> of time/disk space instead of using Groomer. >> > > I agree. Maybe Dan can take care of it - I don't have bowtie setup > on our local Galaxy (yet) so I wouldn't be able to test the proposed > fix. > > In the long term however the Solexa/Illumina FASTQ formats are on > their way out since CASAVA 1.8 will switch to the Sanger FASTQ > encoding: http://seqanswers.com/forums/showthread.php?t=8895 > > Peter > > ___ > galaxy-user mailing list > galaxy-user@lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-user > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Import data in RGenetics
Hi Sylvain, This issue has been fixed in changeset 5207:72d560d3e7fd and will be available the next time that the main server is updated, which should be within the next few weeks. Thanks for reporting this error and please let us know if we can provide additional assistance. Thanks for using Galaxy, Dan On Feb 3, 2011, at 6:05 PM, Sylvain Baulande wrote: > Dear Ross, > Thank you form your prompt answer. > unfortunately I still get an error message which is : > "An error occurred running this job: A required composite data file was not > provided (RgeneticsData.ped)" > I did exactly what you mentioned except that my ped and map files have been > uploaded using the ftp procedure. > Do you have any clues ? > Thank you so much for your help, > Sylvain > > > > > 2011/2/3 Ross > Hi, Sylvian, > > The plink/rgenetics lped and pbed (compressed) formats are special > 'composite' Galaxy datatypes because the map and pedigree/genotype files need > to be kept together correctly inside Galaxy. As a result, the upload tool > requires that the file type be specified so all of the components can be > properly uploaded and stored together. > > For example, to upload pbed data from your local desktop, choose 'Upload > file' from the Get Data tools. > > When the upload form appears, the trick is that you *must* change the default > 'Autodetect' in the first (filetype) select box to the specific rgenetics > datatype - either 'pbed' as the format for compressed plink data (or 'lped' > for uncompressed plink genotype data) as the very first step. Type the first > few letters into the first box, and select the right one from the list that > appears. > > Once this is done, you will see that the upload tool form will change to show > three separate file upload inputs - one each for the plink xxx.bim xxx.bed > and xxx.fam where xxx is the name you set when you ran plink to create the > files, or for uncompressed linkage format two separate file upload inputs - > the plink .ped and .map files. > > Now you can browse for the corresponding file for each input box from your > local machine - be careful not to mix them up as the upload tool is unable to > tell unfortunately. > > At the bottom of the form, I suggest you then change the genome build to the > appropriate one (eg hg18 or hg19). > > Finally, I'd recommend that you change the 'metadata value for basename' > (which will be the new dataset name) to something that will remind you what > the data are - something more meaningful than the default 'rgenetics'. > > Click 'execute' to upload the data and create the new dataset in your > history. Compressed (pbed) format is preferred so the upload is quicker. > > Note that some tools will autoconvert between lped and pbed so there is a > delay the first time some tools are run on a new dataset. There are built in > converters (use the pencil icon) also if you need them. > > I hope this helps - thanks for using Galaxy and Rgenetics - please let us > know how you go and feel free to contact me if you have other questions. > > On Fri, Feb 4, 2011 at 6:20 AM, BAULANDE Sylvain 211527 Partnerchip > wrote: > dear Galaxy users, > I would like to import genotyping data in Rgenetics and I can't succeed. > I have ped file and map file, I try to import them in lped format but it > didn't work ... > Anybody with experience can help me to solve this issue ? > Many thanks in advance, > Best regards, > Sylvain > > > > > > ___ > galaxy-user mailing list > galaxy-user@lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-user > > > > -- > Ross Lazarus MBBS MPH > Associate Professor, HMS; Director of Bioinformatics, Channing Laboratory; > 181 Longwood Ave., Boston MA 02115, USA. Tel: +1 617 505 4850 > Head, Medical Bioinformatics, BakerIDI; > PO Box 6492, St Kilda Rd Central; Melbourne, VIC 8008, Australia; Tel: +61 > 385321444 > > ___ > galaxy-user mailing list > galaxy-user@lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-user ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Galaxy on Cloud not recognizing .txt files as fastq
Hi Karl, Using the upload tool for https URLs was added in changeset 5220:425076fe5ea0. I am not sure when this will make it to the Cloud image, but meanwhile, if you can access the file without using ssl (just 'http'), you should be able to upload. If this is not the issue you are experiencing please let us know. Do not hesitate to contact us if you need further assistance. Thanks for using Galaxy, Dan On Mar 14, 2011, at 7:30 PM, karlerh...@berkeley.edu wrote: > > I changed the permission for the files to public (everyone can > open/download), but this did not fix the problem. > > Also, to answer Dannon's question, I am entering the full path for these > files, eg. https://s3.amazonaws.com/bucketname/xyz.txt > >> From the screencasts I have watched, I noticed that fastq files uploaded > (from an S3 bucket or from elsewhere) always had a .fastq extension. Not > sure whether this is an issue for galaxy or not. > > > > > >> Hi Karl, >> As a quick check, are the permissions for the S3 file set so anyone can >> read >> the file? That's required before Galaxy's upload tool will be able to >> access >> the file. >> Alternatively, if you don't want to set such loose permissions, you should >> be able to get a a signed URL for the given file using a Firefox extension >> S3Fox. >> >> Enis >> >> On Mon, Mar 14, 2011 at 4:40 PM, wrote: >> >>> >>> Hello, >>> >>> I have been able to get Galaxy to instantiate on our Cloud account, and >>> would like to use the NGS tools to trim and map Illumina libraries. >>> >>> However, when I tried to import .txt files (the data contained in these >>> files are in fastq format) located in an S3 bucket, Galaxy did not >>> recognize them as fastq data. I tried to import the files via the URL >>> of >>> the S3 bucket, and Galaxy just imported the actual name of the URL >>> rather >>> than the file itself. >>> >>> Do I need to change the extension of these .txt files to .fastq? Or >>> have >>> I gotten something wrong with respect to the location of the data in the >>> S3 bucket? >>> >>> thanks for any help! >>> >>> karl >>> >>> ___ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >> > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] FASTQ to FASTQSanger using Groomer question
Hi David,
Your files appear to be of the Sanger FASTQ variant. As you have noticed, the
info blurb provided by the Grooming tool provides information that should be
utilized to confirm input types. While the 'Illumina 1.3+' FASTQ format does
encode scores using a different ASCII range, it is my understanding that the
scripts provided by the manufacturer to create FASTQ formatted files were
enhanced to write out Sanger encoded quality scores.
The correct Grooming path for your data is Sanger --> Sanger. Please let us
know if we can provide further assistance.
Thanks for using Galaxy,
Dan
On Mar 21, 2011, at 9:42 AM, David K Crossman wrote:
> Hello!
>
> I am fairly new to using Galaxy and have a question about the
> FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just
> recently generated from Illumina’s NGS instruments. I am aware that the
> first step to perform in Galaxy is FASTQ Groomer to convert the format to
> FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the “Input
> FASTQ quality scores type” box. However, if I look at the raw data reads, I
> notice that Line 4 (which encodes the quality values for sequence in Line 2)
> has values outside of the Illumina 1.3+ range (some of them fall into the
> Sanger format. I am enclosing the Quality Score Comparison figure along with
> some of the raw RNA-Seq data):
> Quality Score Comparison
> SS
> ...III
> ..
> !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
> | ||| |
>|
> 3359 64 73104
> 126
>
> S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads)
> I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads)
> X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw
> reads)
> Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
> RNA-Seq raw data
> @HWI-ST156_294:7:1:1058:2165:0/1
> CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC
> +
> FGGHHHGFHHFHHEGHC
> @HWI-ST156_294:7:1:1184:2191:0/1
> CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG
> +
> EE;E=ECEEBE@=GBFGF/GFFCA#
>
> @HWI-ST156_294:7:1:1018:2200:0/1
> NCTGATTAAGGATAATGAGTAGTAGAACTAATGATGTTATTCCTTGG
> +
> ###
>
> @HWI-ST156_294:7:1:1225:2217:0/1
> GTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA
> +
> FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?
>
>
> As a test in FASTQ Groomer, I chose either the Sanger or
> Illumina 1.3+ as the input quality scores type and these are the results I
> got:
>
> FASTQ Groomer on tn-read1 (using Sanger as input)
> 6.1 Gb
> format: fastqsanger, database:mm9
> Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and
> sequence, the input data is valid for: sanger Input ASCII range: '#'(35) -
> 'I'(73) Input decimal range: 2 - 40
>
> FASTQ Groomer on tn-read1 (using Illumina1.3+ as input)
> 6.1 Gb
> format: fastqsanger, database:mm9
> Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality
> and sequence, the input data is valid for: sanger Input ASCII range: '#'(35)
> - 'I'(73) Input decimal range: -29 - 9
>
> Which one is right (I presume the Illumina 1.3+ one, but I can’t find any
> sort of explanation)? I noticed that the “input decimal range” had different
> values (although they spanned the same length) in relation to which input was
> chosen. What would happen downstream in TopHat if Sanger was used instead of
> Illumina 1.3+ for these files? Is there any other reading
> material/websites/etc… out there that might help me better understand the
> quality score and which to use? Any info/help would be greatly appreciated.
>
> Thanks,
> David
>
>
> David K. Crossman, Ph.D.
> Systems Biologist/Analyst/Statistician
> Heflin Center for Genomic Science
> University of Alabama at Birmingham
> 720 20th Street South
> Kaul Room 420
> Birmingham, AL 35294-0024
> (205) 996-4045
> (205) 996-4056 (fax)
> David K. Crossman, Ph.D.
> Heflin Center for Genomic Science
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org. Please keep all replies on the list by
> using "reply all" in your mail client. For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
> http://lists.bx.ps
Re: [galaxy-user] history
Hi Tania, In the History pane, Click 'Options' --> 'Saved Histories' and see if your history is listed there. Thanks for using Galaxy, Dan On Mar 24, 2011, at 12:15 PM, Fuchs, Tania wrote: > Hello, > > I worked on my home computer with Galaxy online and next day when I came to > the lab I hoped to be able to access everything I did at home through > history, but it does not show up in history. I was logged in both times into > my account. > > What did I do wrong? > > Thanks! > > Tania > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] convert formats
Hi Falak, Due to the fact that the underlying wig to bigWig executable can use huge amounts of RAM, a single large-memory node is allocated for these jobs. This has the unfortunate side effect that wigToBigwig jobs may need to wait for a significant amount of time before being executed. Please be patient, although if you suspect a problem and have waited for a very long period of time, please do report it. Thanks for using Galaxy, Dan On Apr 5, 2011, at 10:21 AM, Sher, Falak wrote: > Hi colleagues, > > I used MACS for peak finding through Galaxy, I want to convert the format of > the resulted wig files into bigwig using Galaxy tool "convert formats' > The job is executed but not running, I redo even then it does not start. it > is stucked with the message, job is waiting to run. > logout and re login are not helping > > any suggestion/information please ? > > F > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Normalization an dplotting of RPKM/FPKM after cufflink
Hello, We would like to mention that a community contributed XML configuration file that enables BAM display at IGV was added to Galaxy in 5252:a62cec23a157. In your local Galaxy instance, you can enable it by removing the comments from around: in your datatypes_conf.xml file for the BAM datatype. This will let users view their BAM files in a local IGV instance or using web start. We would be interested in including additional displays in Galaxy for other datatypes when they are supported in IGV. If configurations already exist for other datatypes, please feel free to contribute them. Thanks for using Galaxy, Dan On Apr 14, 2011, at 7:56 AM, Jim Robinson wrote: > Hi, > > This is not a Galaxy answer specifically, but since you mention IGV, you > can load the "expr" and of course "gtf" files in IGV 2.0. Its not released > but is available from the "early access" links on the downloads page > (htttp://www.broadinstitute.org/igv/downloads). If you want to use IGV with > Galaxy we have some XML that will enable that, email me at > igv-h...@broadinstitute.org to request it. > > Best, > > Jim > > >> Hi, >> >> I want to include the following discussion in my message regarding use Bam >> files of Tophat to visualize reads either in IGV or Galaxy or other tools. >> I want to find out if I can plot RPKM/FPKM normalized values >> after running differential analysis in Cufflinks. On the seqanswer >> (http://seqanswers.com/forums/showthread.php?t=9947 ) >> there is a preliminary discussion about this how we can plot RPKM values to >> show the differential abundance in samples. Do we have any of such >> functionality in Galaxy? alternatively, I would like to have suggestions on >> the topic especially to normalize per million reads. >> >> Thanks. >> >> >> >> --- On Tue, 2/22/11, Jeremy Goecks wrote: >> >> From: Jeremy Goecks >> Subject: Re: [galaxy-user] get wig file after tophat >> To: "David Matthews" >> Cc: "Baxter, Adam" , galaxy-u...@bx.psu.edu >> Date: Tuesday, February 22, 2011, 11:30 AM >> >> All, >> >> For visualization, Galaxy now provides a built-in browser called Trackster. >> Trackster can visualize BAM files--as well as the junction file produced by >> Tophat and the GFF files produced by Cufflinks--and also provides >> coverage/summary information for all datatypes (see attached image). >> >> You can start using Trackster by going to the Visualization --> New Track >> Browser to set up a browser and add tracks. Alternatively, you can click on >> the Trackster icon in a dataset to visualize the dataset in a new or >> existing visualization (see attached image). >> >> Thanks, >> J. >> >> >> >> On Feb 22, 2011, at 11:54 AM, David Matthews wrote: >> >>> HI, >>> >>> The option you need in IGV tools is "count". You set a window size and this >>> gives you a tdf file from your sorted bam (or sam) file which is nice and >>> quick to view on IGV. >>> >>> >>> Best Wishes, >>> David. >>> >>> __ >>> Dr David A. Matthews >>> >>> Senior Lecturer in Virology >>> Room E49 >>> Department of Cellular and Molecular Medicine, >>> School of Medical Sciences >>> University Walk, >>> University of Bristol >>> Bristol. >>> BS8 1TD >>> U.K. >>> >>> Tel. +44 117 3312058 >>> Fax. +44 117 3312091 >>> >>> d.a.matth...@bristol.ac.uk >>> >>> >>> >>> >>> >>> >>> On 22 Feb 2011, at 15:52, Ying Zhang wrote: >>> Dear David: thank you very much for helping me! I have download the IGV and I do find the IGVtools, however, I am not sure which tool I should use for generate a tdf file, the tile function will generate a tdf file, but the input file format does not include bam or sam file, instead it need wig file. But I have no wig file to put in. So I am wondering whether you need to use other tool first. I really appreciate your help! Thank you very much! Best Ying Quoting David Matthews : > Hi, > > You can get an equivalent visualisation from the IGV viewer by the Broad > Institute - its under IGV tools and generates a tdf file from bam or sam > files. This also gives a quick and easy way of looking at depth at any > particular site and is very accessible. > > Cheers > David > > > On 21 Feb 2011, at 21:44, Jeremy Goecks wrote: > >> Hi all, >> >> Ann is correct - Tophat does not produce .wig files when run anymore. >> However, it's fairly easy to use Galaxy to make a wiggle-like coverage >> file from a BAM file: >> >> (a) run the pileup tool on your BAM to create a pileup file; >> (b) cut columns 1 and 4 to get your coverage file. >> >> A final note: it's often difficult to visualize coverage files because >> they're so large. You might be better off visualizing the BAM file and >> using the coverage file for st
Re: [galaxy-user] question about the GATK tools
Hi Xiaojing, You'll need to make sure that the dbkey of your input BAM file is set to a genome build that has data available. Click the pencil icon to set the genome build. If you have set the genome build, but still have an empty select box then data may not be available for this build/tool combination, you can request that the needed data be added for this tool. If your reference genome is not available, you can also upload a FASTA file containing the genome and access it directly from the history. Thanks for using Galaxy, Dan On Aug 17, 2011, at 11:26 AM, Hong, Xiaojing wrote: > Hi, > > I just uploaded the BAM file for an exome sequencing sample and was trying to > use the GATK tools. In the first step, realigner Target creator, I can see my > uploaded file but I can’t see any options under the “using reference genome” > and the following choices so I can’t click execute. Did I do anything wrong? > Thanks! > > Xiaojing Hong > University of Iowa > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] question about the GATK tools
Hi Xiaojing, Data for hg17 is not yet available for this toolset. You may still be able to use this tool if you upload your own FASTA genome file. Please be sure to respect the GATK genome ordering rules and reorder your BAM file if necessary: http://www.broadinstitute.org/gsa/wiki/index.php/Preparing_the_essential_GATK_input_files:_the_reference_genome However, because these tools are still under development/experimental we recommended that you remap your sequences against the "hg_g1k_v37" genome if you want to use these tools at this time. Also, please keep all replies on the mailing list. Thanks for using Galaxy, Dan On Aug 18, 2011, at 1:33 PM, Hong, Xiaojing wrote: > Hi, Dan > > I did set the genome build to HG17 but I still can’t see the select box. > > Xiaojing Hong > Ph.D candidate > Department of Biology > Manak Lab > 455 Biology Building > University of Iowa > Iowa City, IA 52242 > (P) 319-335-0266 > > From: Daniel Blankenberg [mailto:d...@bx.psu.edu] > Sent: Thursday, August 18, 2011 12:19 PM > To: Hong, Xiaojing > Cc: galaxy-user@lists.bx.psu.edu > Subject: Re: [galaxy-user] question about the GATK tools > > Hi Xiaojing, > > You'll need to make sure that the dbkey of your input BAM file is set to a > genome build that has data available. Click the pencil icon to set the genome > build. If you have set the genome build, but still have an empty select box > then data may not be available for this build/tool combination, you can > request that the needed data be added for this tool. If your reference genome > is not available, you can also upload a FASTA file containing the genome and > access it directly from the history. > > > Thanks for using Galaxy, > > Dan > > > On Aug 17, 2011, at 11:26 AM, Hong, Xiaojing wrote: > > > Hi, > > I just uploaded the BAM file for an exome sequencing sample and was trying to > use the GATK tools. In the first step, realigner Target creator, I can see my > uploaded file but I can’t see any options under the “using reference genome” > and the following choices so I can’t click execute. Did I do anything wrong? > Thanks! > > Xiaojing Hong > University of Iowa > > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] wiggle file
Hi Rich, Sorry for the delay in reply. You can configure the display of custom tracks at UCSC by clicking on the custom track within the UCSC genome browser. You can also convert your wig file to a bigwig file (under Convert Formats tool menu), in order to speed up the display of this data. For help with configuring custom tracks that you have loaded into the UCSC Genome Browser, please contact the UCSC Genome Browser team. Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Jul 5, 2011, at 5:48 PM, Richard Mark White wrote: > Hi, > this should be simple but it is not..forgive the newbie question. > i am doing chip-seq. bowtie>sam filter for mapped reads>MACS. > i want to create a wiggle file that displays in ucsc, but when i choose the > "WIG" option on macs, and then try to show it in UCSC, it treats each line of > the created WIG file as a separate track, and obviously does not show it as a > graph. > is there a wiki page somewhere that can give me the basics? or can someone > point me in the right direction? > thanks. > > rich > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Chip-Seq, Encode Peaks and Galaxy
Hi Rad, Jorge, Sorry for the delay in reply. We have not yet released a pre-canned workflow to do this. However, if you are looking to associate one set of Genomic interval/region data with another set, Galaxy's interval operation tools are a good place to begin. There are good examples of using these tools available through screencasts (http://galaxycast.org), Galaxy 101 (http://usegalaxy.org/galaxy101), as well as the wiki (http://wiki.g2.bx.psu.edu/Learn/Interval%20Operations). Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Jun 23, 2011, at 9:41 AM, Radhouane Aniba wrote: > Thanks Jennifer > > Rad > > 2011/6/23 Jorge Andrade > Please keep me on the loop as I am also interested in similar workflow. > Many thanks and best regards, > Jorge > > > On Thu, Jun 23, 2011 at 3:21 AM, Jennifer Jackson wrote: > Hello Rad, > > Dan will be able to help you get started and build up a workflow for your > analysis. He is currently on vacation, but will be returning soon and will > contact you directly when he returns. > > We are very sorry about the delayed reply. Please know that we definitely > want to help you to use Galaxy for your project, > > We will be in touch, > > Best, > > Jen > Galaxy team > > > > On 6/17/11 10:55 AM, Radhouane Aniba wrote: > Hi everyone, > > I have a list of genomic regions with some variants and would like to > study the correlation between theses variants and epigenomics marks such > as histone modifications. > > From Encode download page, i got some files corresponding to peaks of > these hsitone modifications and would like to know if there is a way to > create a pipeline using galaxy to map my variants, depending on genomic > regions to the information I have from the histone modification peaks. > > Is there someone who can point me to a step by step to do things to > start using Galaxy ? > > Thank you > > Rad > > > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > -- > Jennifer Jackson > http://usegalaxy.org/ > http://galaxyproject.org/ > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > > > > -- > Radhouane Aniba > Bioinformatics Postdoctoral Research Scientist > Institute for Advanced Computer Studies > Center for Bioinformatics and Computational Biology (CBCB) > University of Maryland, College Park > MD 20742 > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Q about 'Compute' tool
Hi Ian, Under Operate on Genomic Intervals, you can try the "Get Flanks" tool; you can request upstream, downstream, or both of your provided regions. Please let us know if you need additional assistance. Thanks for using Galaxy, Dan On Oct 10, 2011, at 6:35 AM, Ian Donaldson wrote: > Hi, > > Can 'if' statements by used in 'Text manipulation' > 'Compute'? > > The reason is that i have a interval file of UCSC genes, i want to identify > the TSS of each and make a new interval reflecting the TSS position for each > gene. But because the TSS of a '-' stranded gene is actually the 'end' coord > i want to be able to check the strand in the compute statement. > > Is this possible or is there an easier way to do this inside GALAXY? > > Thank you, > Ian > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Memory issues while using Galaxy
Hi Prashant, Have you set: use_debug = False use_interactive = False In your universe_wsgi.ini file? Thanks for using Galaxy, Dan On Oct 17, 2011, at 6:15 PM, prashant singh wrote: > Hi > We have installed Galaxy on a local machine (Mac pro 2 x 2.4 gHz quad > core Intel Xeon with 32 GB RAM). We wish to use dynamic trimmer in > order to trim the data and while downloading a groomed file from > galaxy, it runs out of memory. > Please advise. > > Sent from my iPhone > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Regarding perl script
Hi Shambhavi, It sounds like your tool_conf.xml file is malformed. Check that you have proper quotes and that the tag open and close are all correct, etc. There are several programs out there that can validate xml files for you, you may wish to try to validate your xml file with one of those. Thanks for using Galaxy, Dan On Oct 18, 2011, at 12:23 AM, Shambhavi Srivastava wrote: > Hello all, > > I am a new to GALAXY and am trying to create my own workflow with my own > scripts written in PERL and integrating it with few already available in > GALAXY. I tried the basic example given in GALAXYwiki..the program about > counting GC content. I followed all the steps mentioned but when I start my > galaxy server I dont see myTools option and even the pre installed options > like GetData and all dont appear on screen. What should I do...can anyone > send me another or a step by step procedure of how can I run my programs. > Thankss.. > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Patch for better FASTQ description handling
Hi Florent, Sorry for the delay. I did try the patch out shortly after you contributed it, but it caused the functional to fail. I was able to fix the issue and allow the existing tests to start passing, but I've been bogged down lately and haven't been able to perform a more thorough review of the code. If you could provide tests with files (e.g. for the tools affected) that test the new functionality, that would be a great help. The use of partition removes python compatibility for <2.5, although this is a lesser/non-concern. Also, I'm not entirely sold on having the "Identifier line" being parsed as "identifier" + + "description" instead a single identifier line. This would mean that identifiers could not themselves contain spaces, but "There is no standardization for identifiers" (so they could technically have spaces?). Could two different reads be identified as "Read A" and "Read B", but then would no longer be uniquely identifiable as each would then be identified as "Read". If this added functionalilty were introduced as optional behavior (e.g. a user needs to click a checkbox on the tools to apply the id line splitting), these concerns can be mitigated. Peter, Florent, anyone else: I'd be very interested to hear your thoughts on the above, particularly in respect to know real-world data. For now, lets discount SRA data from this discussion. Thanks, Dan On Oct 19, 2011, at 5:00 AM, Peter Cock wrote: > On Wed, Oct 19, 2011 at 4:53 AM, Florent Angly > wrote: >> >> I have had the chance to try the patch on several datasets and it looks good >> :) >> I reiterate my suggestion to pull the patch in galaxy-central. >> Best, >> Florent > > It looks sensible, although I would add a comment to the join method > to say the description from read1 is taken (if the reads differ in their > descriptions). Mind you, the whole module seems to lack docstrings ;) > > Are there any unit tests (not that Galaxy seems to insist on them)? > > Peter > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] bed12 format for stitching blocks given a set of coding exon intervals
Hi Amit, Without taking a look at your history, I'll have to make a guess. When you retrieve regions from UCSC, on the second step, right before you click "Send query to Galaxy", make sure that you have "Whole Gene" selected under "One record per", and that you are looking at a gene track and that the format was set to "BED" on the first page. Also be sure to Not include a track header. Thanks for using Galaxy, Dan On Oct 19, 2011, at 11:10 PM, Amit Indap wrote: > Hi Galaxy, > > I am trying to stitch together MAF alignments for the coding sequence > for a few genes of interest in Drosophila. I used UCSC to send the bed > intervals of the coding exons of my gene and sent the output to > Galaxy. But when I try and use the tool "Stitch Gene blocks" it > complains that my bed is a bed3 and not a bed12. > > I'm a bit rusty with my browser skills, but how can I send my output > to Galaxy as a bed12 format so I can stitch my MAF blocks together? > > Thanks for your help! > > Amit > > -- > Amit Indap > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] tool config file: multi-select for files?
Hi Uwe, Multiple selects for dataset inputs is not yet supported, but there is a ticket open on this issue, which you may follow if you like: https://bitbucket.org/galaxy/galaxy-central/issue/137/allow-multiple-true-in-input-param-fields We have not yet decided when-or-if we will be implementing this feature, but please feel free to add comments to the ticket. For now the best course of action is to use a repeat parameter. Thanks for using Galaxy, Dan On Oct 21, 2011, at 5:45 AM, Appelt, Uwe wrote: > Dear all, > > My tool does accept multiple input-files, but there are normally bunches of > them, so the "repeat"-syntax doesn't appear to be a good idea. Inspired from > the workflow-engine-capability to accept multiple input files I wanted to do > the same for my tool: > > > > Problem: > The above "param"-syntax causes Galaxy to caugh up an error message, as soon > as I indeed select multiple files. Selecting single files works well. > > The, to actually access the list of selected files, I would expect the same > syntax as for the "repeat"-tag case to work. What I am currently trying from > within a -section is something like this: > > #for $inputSeqFile in $inputSeqFiles > ...do something with $inputSeqFile > #end for > > Problem: > Cheetah complains about $inputSeqFiles not being iterable. > > Any suggestions or ideas/alternatives to this setting? > > Thanks in advance and best regards, > Uwe > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Genetrack-Indexer/PeakPredictor
Hi Steffi, GeneTrack should be working again on the Main server, thanks for reporting the error. For information on the inner workings of GeneTrack, you should consult the paper that you mentioned, along with http://genetrack.bx.psu.edu/ and you can additionally contact the GeneTrack author, who I've CC'd here. Thanks for using Galaxy, Dan On Nov 10, 2011, at 11:32 AM, Stefanie Ververs wrote: > Hi everybody, > > I'm using the Genetrack-Peak-Predictor to predict nucleosome positions. > I still have some questions: > > 1) Am I correct that the genetrack indexer seems to be down on the Public > Galaxy Server? I get a server error, when I start it. > (The Genetrack Browser doesn't work either; although I'm still not quite sure > whether there are dependencies.) > > 2) By now, I know one paper on Genetrack - > http://bioinformatics.oxfordjournals.org/content/24/10/1305.short and I found > the following presentation slides: > http://ged.msu.edu/angus/tutorials-2011/files/lecture-chipseq.pdf. Galaxy > tells me to "cite Blankenberg D, et al. In preparation." > > Is there additional information? It would be great to know how exactly the > peak predictor works, but the slides give only a kind of overview, but of > course no explaining and no details and the paper isn't that clear. > > Thanks, > > Steffi > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Genetrack-Indexer/PeakPredictor
> I think in general you should make sure to cite the authors of the > original publication in addition to Galaxy, the note in Galaxy should > make this explicit. Absolutely agree, the citations are arguably the most important part. The GeneTrack paper citation is currently listed in the help for the tools at http://usegalaxy.org and in -central. Any place where a citation is missing is an error and will be corrected as soon as it is reported. Thanks for using Galaxy, Dan On Nov 10, 2011, at 12:55 PM, Istvan Albert wrote: > Hello Everyone, > >> Galaxy tells me to "cite Blankenberg D, et al. In preparation." > > I think in general you should make sure to cite the authors of the > original publication in addition to Galaxy, the note in Galaxy should > make this explicit. > > Small tidbits that may be useful. There is a command line version for > genetrack with its source code at: > > https://github.com/ialbert/chipexo > > this is a fork of my son's project while he rotated in a lab, he > ported a number of tools including GeneTrack to a command line > interface. Seems to work well but I have not ran it for large genomes. > > In the course that I teach the lectures covering ChipSeq analysis: 19, > 20 and 21 cover the usage and principles of GeneTrack (among other > topics) > > http://bcc.bx.psu.edu/courses/597D-2011/index-597D-2011.html > > best regards, > > Istvan > > > On Thu, Nov 10, 2011 at 12:19 PM, Daniel Blankenberg wrote: >> Hi Steffi, >> GeneTrack should be working again on the Main server, thanks for reporting >> the error. >> For information on the inner workings of GeneTrack, you should consult the >> paper that you mentioned, along with http://genetrack.bx.psu.edu/ and you >> can additionally contact the GeneTrack author, who I've CC'd here. >> >> Thanks for using Galaxy, >> Dan >> >> On Nov 10, 2011, at 11:32 AM, Stefanie Ververs wrote: >> >> Hi everybody, >> >> I'm using the Genetrack-Peak-Predictor to predict nucleosome positions. >> I still have some questions: >> >> 1) Am I correct that the genetrack indexer seems to be down on the Public >> Galaxy Server? I get a server error, when I start it. >> (The Genetrack Browser doesn't work either; although I'm still not quite >> sure whether there are dependencies.) >> >> 2) By now, I know one paper on Genetrack - >> http://bioinformatics.oxfordjournals.org/content/24/10/1305.short and I >> found the following presentation slides: >> http://ged.msu.edu/angus/tutorials-2011/files/lecture-chipseq.pdf. Galaxy >> tells me to "cite Blankenberg D, et al. In preparation." >> >> Is there additional information? It would be great to know how exactly the >> peak predictor works, but the slides give only a kind of overview, but of >> course no explaining and no details and the paper isn't that clear. >> >> Thanks, >> >> Steffi >> ___ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> > > > > -- > Istvan Albert > Associate Professor, Bioinformatics > Pennsylvania State University > http://www.personal.psu.edu/iua1/ > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Asynchronous data source
Hi Joachim, Can you try changeset 6267:7a72e5299fdc and see if that works for you? Thanks for using Galaxy, Dan On Nov 13, 2011, at 12:07 PM, Joachim Baran wrote: > Hello, again, > > On 2011-11-13, at 10:47 AM, Joachim Baran wrote: >> Does anyone know why Galaxy would not retrieve the data? Do I really have to >> show the HTML that is returned by Galaxy to make it work? > To follow up on my own email: it seems that the data is retrieved. I see > that files with the right contents are created in > galaxy-dist/database/files/000 > > So, what could be the reason that they do not show up in the web interface? > > Thanks, > Joachim > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK
Hi Franzi, You have one too many hg19 in there. The fields go like: so: hg19hg19hg19 /drive1/galaxy/reference/hg19/sam_index/hg19_ref.fa gatk But do note that these tool integrations are still undergoing active development. Please report bugs if you encounter any. Thanks for using Galaxy, Dan On Nov 16, 2011, at 6:29 PM, Metge, Franziska wrote: > > Dear happy users of Galaxy, > > We are running Galaxy locally. It's a very fine tool! By now everything works > fine, except when I try to run any GATK program. I usually get this error > message: > > > # ERROR > -- > # ERROR A USER ERROR has occurred (version 1.3-14-g348f2db): > # ERROR The invalid arguments or inputs must be corrected before the GATK > can proceed > # ERROR Please do not post this error to the GATK forum > # ERROR > # ERROR See the documentation (rerun with -h) for this tool to view > allowable command-line arguments. > # ERROR Visit our wiki for extensive documentation > http://www.broadinstitute.org/gsa/wiki > # ERROR Visit our forum to view answers to commonly asked questions > http://getsatisfaction.com/gsa > # ERROR > # ERROR MESSAGE: The fasta file you specified (/tmp/tmpp0oxJu/hg19) does > not exist. > # ERROR > -- > > my picard_index.loc line for the hg19 reference looks like this: > > > hg19hg19hg19hg19 > /drive1/galaxy/reference/hg19/sam_index/hg19_ref.fa gatk > > > also the bam file I am submitting to GATK has the reference genome specified > in it's attributes. > > Could please anyone help me. > Thank you > Franzi > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Unable to run SICER or Find Peaks
Hi AP, SICER requires BED formatted input with at least 6 columns (for strand information). You can convert your BAM files into SAM and then into interval and BED format. Once you have your input in the BED (6+) format, you should be able to use these tools. Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Nov 23, 2011, at 12:26 PM, Anupam Paliwal wrote: > Hi, > > I want to use SICER or Find Peaks for peak calling on GALAXY. > > I am using my aligned ChIP-seq tag .BAM files. However for both the tools > the history is unable to pick the Bowtie-ligned SAM to BAM converted > files. > > On the other hand, using MACS the same files are working nicely for peak > calling. > > Thanks, > > AP > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question regarding: FASTQ Quality Trimmer
Hi Rahul, This is the maximum number of bases which can have their score not included when calculating the result of the selected aggregation function. For example, if you had a 5 base window with scores of 5,5,2,5 and 5, set aggregation to min score with a specified value of 4, with the action of ">=": 0, for maximum number of bases to exclude, would trim 1, for maximum number of bases to exclude, would not trim Thanks for using Galaxy, Dan On Nov 23, 2011, at 11:27 PM, Rahul Kanwar wrote: > Hello, > > I am running Galaxy locally and it has been performing flawlessly! I wanted > to get more insight about this flag in the FASTQ Quality Trimmer program: > > Maximum number of bases to exclude from the window during aggregation > > Does it mean the number of 5' bases to exclude while the doing the trimming > step [i.e. the sliding window starts this many bp after the read start] ? I > would really appreciate if someone could shed more light on this. Thanks. > > regards, > Rahul > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Unable to run SICER or Find Peaks
Hi AP, Please keep all replies on list, this will allow the community to assist and benefit from these correspondences. SICER requires BED input. To go from BAM to BED: 1.) Convert BAM to SAM 2.) Convert SAM to Interval (Convert SAM to interval) 3.) Convert interval to BED(6+). This can be done by implicitly (by selecting the Interval dataset, which will be marked with '(as bed)' in the SICER input box) or by clicking on the pencil icon and explicitly converting uder the section "Convert to new format". Please let us know if we can provide additional assistance. Thanks for using Galaxy, Dan On Nov 29, 2011, at 1:23 PM, Anupam Paliwal wrote: > Hi Daniel, > > Thanks for your kind attention and advice. > > I have followed the following workflow: I aligned my query sequences to > the reference genome using Bowtie; the Bowtie aligned SAM file was > subjected to filter-SAM before converting it to BAM. I have re-BAM-to-SAM > converted the BAM-file before subjecting it to pileup. > > However, now I do have the Input format file (after pileup of SAM) but am > unable to convert it to BAM format to be able to submit it ti SICER. > > > Please see if you can suggest how to convert the Input files back to BAM. > I have tried changing directly through edit-attributes, but it shows > error. > > AP > > > >> Hi AP, >> >> SICER requires BED formatted input with at least 6 columns (for strand >> information). You can convert your BAM files into SAM and then into >> interval and BED format. Once you have your input in the BED (6+) format, >> you should be able to use these tools. Please let us know if we can >> provide additional information. >> >> >> Thanks for using Galaxy, >> >> Dan >> >> >> >> On Nov 23, 2011, at 12:26 PM, Anupam Paliwal wrote: >> >>> Hi, >>> >>> I want to use SICER or Find Peaks for peak calling on GALAXY. >>> >>> I am using my aligned ChIP-seq tag .BAM files. However for both the >>> tools >>> the history is unable to pick the Bowtie-ligned SAM to BAM converted >>> files. >>> >>> On the other hand, using MACS the same files are working nicely for peak >>> calling. >>> >>> Thanks, >>> >>> AP >>> >>> ___ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >> >> > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] BWA not recognize FASTQ query file
Hi Cai, The datatype for your dataset must be set to 'fastqsanger' for the BWA wrapper to recognize it; it is probably simple 'fastq' in your history. You can manually set this attribute, by clicking on the pencil icon for the history item and selecting the correct option under the relevant dropdown menu. You can also use the FASTQ Groomer (sanger to sanger) or declare the fastq datatype variant when uploading. Please let us know if we can provide additional assistance. Thanks for using Galaxy, Dan On Jan 4, 2012, at 4:44 AM, Cai Shaojiang wrote: > Dear friends, > > We just installed a fresh galaxy on the server. Now when we try to run > BWA following this tutorial: > http://wiki.g2.bx.psu.edu/Admin/Training/Galaxy%20Admin%20Tutorial. > > It keeps telling that "FASTQ file: History does not include a dataset > of the required format / build > Must have Sanger-scaled quality values with ASCII offset 33" > > But we indeed have got the fastq file from > http://lava.mathcs.emory.edu/outgoing/data/phiX174_reads.fastqsanger. > And I also tried to upload a fastq file from my local disk. Still not > working. So I am guessing maybe the default bwa wrapper is something > wrong? Thanks. > > Yours: Cai > > -- > Cai Shaojiang > Department of Information Systems, School of Computing, National > University of Singapore > Tel: +65-65167355 > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool
Hi Raj, Thanks for reporting, this issue has been resolved in changeset 6778:35be930b21be. Please let us know if you encounter further issues. Thanks for using Galaxy, Dan On Mar 1, 2012, at 3:30 AM, Praveen Raj Somarajan wrote: > Hello, > > I'm facing an issue with "Depth Of Coverage" tool when it runs on refGene and > target BED file. The error message is: > > File "cheetah_DynamicallyCompiledCheetahTemplate_1330588825_26_16118.py", > line 402, in respond > NotFound: cannot find 'omit_interval_statistics' while searching for > 'gatk_param_type.omit_interval_statistics' > > I noticed that the issue is only when the "Advanced GATK options" is enabled > to set target BED file. > > The commandline runs perfectly with the input files, but galaxy fails due to > this error. Can anyone suggest what's the issue? > > Best, > > Raj > > This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely > for the use of the addressee(s). If you are not the intended recipient, > please notify the sender by e-mail and delete the original message. Further, > you are not to copy, disclose, or distribute this e-mail or its contents to > any other person and any such actions that are unlawful. This e-mail may > contain viruses. Ocimum Biosolutions has taken every reasonable precaution to > minimize this risk, but is not liable for any damage you may sustain as a > result of any virus in this e-mail. You should carry out your own virus > checks before opening the e-mail or attachment. > The information contained in this email and any attachments is confidential > and may be subject to copyright or other intellectual property protection. If > you are not the intended recipient, you are not authorized to use or disclose > this information, and we request that you notify us by reply mail or > telephone and delete the original message from your mail system. > > OCIMUMBIO SOLUTIONS (P) LTD > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool
Hi Raj, This is currently available in -central (https://bitbucket.org/galaxy/galaxy-central), but will be available in the next dist release. You can pull directly from central, apply the changes manually, or wait for the next dist release. Thanks for using Galaxy, Dan On Mar 2, 2012, at 2:20 AM, Praveen Raj Somarajan wrote: > Hello Dan, > > But, I am currently using the latest update of Galaxy (as 'hg incoming' says > 'no changes'). Just to clarify one thing: which repository should I clone - > https://bitbucket.org/galaxy/galaxy-dist/ (mentioned in GetGalaxy.org) OR > http://www.bx.psu.edu/hg/galaxy/ (mentioned in NewsBrief website). I use the > first one to update Galaxy. I tried to pull the below changeset, but it says > 'invalid revision'. > > Please suggest. > > Best, > > Raj > > > From: Daniel Blankenberg [mailto:d...@bx.psu.edu] > Sent: Thursday, March 01, 2012 8:45 PM > To: Praveen Raj Somarajan > Cc: galaxy-user@lists.bx.psu.edu > Subject: Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool > > Hi Raj, > > Thanks for reporting, this issue has been resolved in changeset > 6778:35be930b21be. Please let us know if you encounter further issues. > > > Thanks for using Galaxy, > > Dan > > > On Mar 1, 2012, at 3:30 AM, Praveen Raj Somarajan wrote: > > > Hello, > > I'm facing an issue with "Depth Of Coverage" tool when it runs on refGene and > target BED file. The error message is: > > File "cheetah_DynamicallyCompiledCheetahTemplate_1330588825_26_16118.py", > line 402, in respond > NotFound: cannot find 'omit_interval_statistics' while searching for > 'gatk_param_type.omit_interval_statistics' > > I noticed that the issue is only when the "Advanced GATK options" is enabled > to set target BED file. > > The commandline runs perfectly with the input files, but galaxy fails due to > this error. Can anyone suggest what's the issue? > > Best, > > Raj > > This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely > for the use of the addressee(s). If you are not the intended recipient, > please notify the sender by e-mail and delete the original message. Further, > you are not to copy, disclose, or distribute this e-mail or its contents to > any other person and any such actions that are unlawful. This e-mail may > contain viruses. Ocimum Biosolutions has taken every reasonable precaution to > minimize this risk, but is not liable for any damage you may sustain as a > result of any virus in this e-mail. You should carry out your own virus > checks before opening the e-mail or attachment. > The information contained in this email and any attachments is confidential > and may be subject to copyright or other intellectual property protection. If > you are not the intended recipient, you are not authorized to use or disclose > this information, and we request that you notify us by reply mail or > telephone and delete the original message from your mail system. > > OCIMUMBIO SOLUTIONS (P) LTD > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > > This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely > for the use of the addressee(s). If you are not the intended recipient, > please notify the sender by e-mail and delete the original message. Further, > you are not to copy, disclose, or distribute this e-mail or its contents to > any other person and any such actions that are unlawful. This e-mail may > contain viruses. Ocimum Biosolutions has taken every reasonable precaution to > minimize this risk, but is not liable for any damage you may sustain as a > result of any virus in this e-mail. You should carry out your own virus > checks before opening the e-mail or attachment. > The information contained in this email and any attachments is confidential > and may be subject to copyright or other intellectual property protection. If > you are not the intended recipient, you are not authorized to use or disclose > this information, and we request that you notify us by re
Re: [galaxy-user] Chip-seq exercise
Hi Josh, Thank you for reporting this issue, it has been resolved. Please let us know if you encounter additional problems in the future. Thanks for using Galaxy, Dan On Mar 21, 2012, at 8:18 PM, Joshua Udall wrote: > Does anyone know what happened to the chip-seq exercise by James? > > It was part of a collection here: > http://main.g2.bx.psu.edu/u/james/p/exercises > > and it was linked here: > http://main.g2.bx.psu.edu/u/james/p/exercise-chip-seq > > > > But is it 'Not Found'. > > It was a very useful exercise. Will it be back soon? > > Josh > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Problem setting up admin in Galaxy local instance!
Hi Di, You need to remove the starting comment/hash from the admin_users line: admin_users = dkngu...@uw.edu Thanks for using Galaxy, Dan On Jul 20, 2012, at 5:13 PM, Di Nguyen wrote: > Dear all, > > Please help me figure out what went wrong to set up ADMIN in my local > instance using the new retinaMBP! This is what I did > > 1. I changed universe_wsgi.ini.sample file into universe_wsgi.ini (using Mac > TextEdit) > > 2. Then, I edited universe_wsgi.ini as followed: > > # Administrative users - set this to a comma-separated list of valid Galaxy > # users (email addresses). These users will have access to the Admin section > # of the server, and will have access to create users, groups, roles, > # libraries, and more. For more information, see: > # http://wiki.g2.bx.psu.edu/Admin/Interface > #admin_users = dkngu...@uw.edu > > 3. I shutdown Galaxy, rerun sh run.sh, log back in Galaxy but still no Admin > function. > > 4. The reason that I wanted to ad Admin function is to import my NGS files > (bigger than 2Gb fer sure) into Galaxy database. Please give me some tips on > this as well. > > Thank you very much, > > Di Nguyen, postdoc > U of Washington, Seattle, WA > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Counting intervals in one file overlapping intervals in another file - what are the hidden settings?
Hi Alex, This error has been corrected, thanks for reporting it. Please let use know if you encounter any additional issues. Thanks for using Galaxy, Dan On Aug 21, 2012, at 1:12 AM, Alex Shaw wrote: > Hi, > > I'm also interested in using bedtools with galaxy. I have found a bug. > When I try to run "Intersect multiple sorted BED files" > > Error: The requested genome file > (/galaxy/home/g2test/galaxy_test/tool-data/shared/ucsc/chrom/hg_g1k_v37.len) > could not be opened. Exiting! > > I've used bedtools on the command line, and it is looking for a file > that specifies the chr length for the reference genome. > > Alex > > On 17 August 2012 08:23, Jennifer Jackson wrote: >> Hello Mo, >> >> This tool comes from a repository sourced from the Tool Shed: >> http://toolshed.g2.bx.psu.edu/ >> >> Search for a tool named "bedtools" with owner "aaronquinlan". You could >> examine the repository and then the tool wrapper author can be contacted >> directly with questions about parameters or if you think there is a bug. >> >> Hopefully this helps! >> >> Jen >> Galaxy team >> >> >> On 8/16/12 10:13 AM, Mohammad Heydarian wrote: >>> >>> Hi, >>> I am using the "Count intervals in one file overlapping intervals in >>> another file" tool (part of the bedTools package) to assess the number >>> of RNA-seq reads that map back to a specific region. (I am using this on >>> the Galaxy test server). I am finding that this tool returns many more >>> reads than it should. >>> >>> In reading the bedTools manual, it seems like this tool is the >>> "windowBed" tool and it actually has many more parameters that are not >>> shown on the Galaxy interface. What are these (hidden) settings for >>> these parameters that are not shown? >>> >>> Hopefully this can explain my incorrectly recorded reads. >>> >>> Thanks in advance. >>> >>> >>> Cheers, >>> Mo Heydarian >>> >>> >>> >>> ___ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >> >> -- >> Jennifer Jackson >> http://galaxyproject.org >> ___ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > > > > -- > Alex Shaw > Research Officer > > Neuroscience Research Australia > > www.NeuRA.edu.au > Barker Street Randwick Sydney NSW 2031 Australia > PO Box 1165 Randwick Sydney NSW 2031 Australia > T +61 2 9399 1112 F +61 2 9399 1005 > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Unable to BAM data on UCSC or Ensembl browsers
Hi Joachim, This is for your own local server? You can fix the byte-range issue issue by putting your Galaxy server behind a proxy such as nginx (http://wiki.g2.bx.psu.edu/Admin/Config/Performance/nginx%20Proxy) or apache (http://wiki.g2.bx.psu.edu/Admin/Config/Apache%20Proxy). It does look like Ensembl has changed their BAM handling and the links have stopped working, we'll work on a fix here, but do not have a time frame. Thanks, Dan On Sep 13, 2012, at 3:45 AM, Joachim Jacob wrote: > Hi all, > > I have aligned RNA seq read with tophat to drosophila melanogaster 3 genome. > However, I cannot view the alignment in UCSC (error Byte-range request was > ignored by server), nor in Ensembl. > > Error in Ensembl: > > > Malformed URL > > The URL used to reach this page may be incomplete or out-of-date. > > A location is required to build this page. For example, chromosomal > coordinates: > > > http://www.ensembl.org/Drosophila_melanogaster/Location/View?r=2L:21650001-2170 > > Perhaps can somebody find out what I am doing wrong? > > > Thanks, > Joachim > > > > -- > Joachim Jacob, PhD > > Rijvisschestraat 120, 9052 Zwijnaarde > Tel: +32 9 244.66.34 > Bioinformatics Training and Services (BITS) > http://www.bits.vib.be > @bitsatvib > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Error message on local install
Hi Chris, Are you able to share a copy of the offending file? Perhaps by uploading to the public Galaxy server, possibly trying the Grooming step there, and then sharing the history with me or by using the bug report option on the Grooming step if it fails? If not, you could look at the output created (the error dataset) and use e.g. tail to find out the last few fastq blocks that were successfully processed or wc -l to find out the number of lines written, and then use grep -C or a combination of head/tail to look at the original file and see if anything is amiss. Thanks for using Galaxy, Dan On Oct 10, 2012, at 6:28 PM, Chris Merrikh wrote: > Hi, I'm trying to solve an issue I'm having with my local installation of > Galaxy (installed on my own computer, rather than on a server). I'm using > data in the form of fastq files from an Illumina Hi-seq and I want Galaxy to > parse the bar coded sequences out into individual files for me. I've been > using the public server in the past, and I'm able to use the Groomer, Joiner, > Reverse-Complement, Trimmer, and Barcode Splitter tools just fine. Now I'm > trying to do the same thing locally on the same files. Both the large file > (38 GB) and a smaller file consisting of the first 10k lines will upload just > fine. However, I can only get the Groomer to work on the small file. When I > use it on the large file I get an error: "Error executing tool: maximum > recursion depth exceeded while calling a Python object." > > Any help on this would be greatly appreciated! > > - Chris M. > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] job information on galaxy
Hello, Thanks for reporting this error. This has been fixed in changesets 7875:62b89df24ab1 through 7879:046634d05007 in galaxy-central and will be included in the next distribution and main update. Please let us know if you encounter additional issues after the update. Thanks for using Galaxy, Dan On Oct 11, 2012, at 4:23 AM, i b wrote: > Hi, > I am trying to open the "i" icon on galaxy to look at the information > of each job, but this does not opne for old jobs, only the last recent > one ... > > Any suggestion? > > Thanks, > ib > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Warning message
Hi Rolando, You'll need to remove the old blast datatypes from your datatypes_conf.xml file. If you haven't added any new datatypes manually yourself, you can copy the datatypes_conf.xml.sample file over of your datatypes_conf.xml file. Also, in the future questions about local Galaxy instances should be sent to the galaxy-dev mailing list. Thanks for using Galaxy, Dan On Nov 12, 2012, at 10:31 PM, Rolando Mantilla wrote: > I'm having issues with the FASTQ_Groomer. What I have done it first I > downloaded an SRA file created by an Ion torrent sequencer from the NCBI > site. Then used the fastq-dump app from the NCBI site to covert the .sra file > to .fastq file. When I uploaded the data into galaxy it recognized it as a > fastq(as it should) but when I try to run the FASTQ groomer I get the message > and warnings below. I also have already downloaded the the blast_datatypes > tool from the tool_shed. I truly don't know what the issue is, any help > An error occurred running this job: Groomed 12376 sanger reads into sanger > reads. > > WARNING:galaxy.datatypes.registry:Error loading datatype with extension > 'blastxml': 'module' object has no attribute 'BlastXml' > WARNING:galaxy.datatypes.registry:Overriding conflicting datatype with > extension 'blastxml', using datatype from /mnt/galaxyData/tmp/tmpdP_cZ7. > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Umar,
Can you click the eye icon to view the contents of the 'log' dataset for the
GATK run. The end of the log should have the actual error encountered (the text
you provided is a bit of a red herring)
Since you are using hg19, the most likely cause for the error is that the
reference fasta file you are using is not ordered properly, or that your
alignments were made using a different genome (e.g. alignment with bwa using
built-in hg19 [not ordered properly] and then GATK using a different hg19 fasta
from your history.)
If you are using a custom genome, make sure that it is GATK-ordered and that
the same one is used in all steps; there is an hg19 GATK-ordered fasta file
available in a Data library ('GATK') on Main.
Thanks for using Galaxy,
Dan
On Dec 11, 2012, at 12:11 PM, Farooq,Umar (res) wrote:
> Hi,
>
> I am trying to incorporate GATK in my pipeline but not been able to make it
> work. I aligned my data with Hg 19 and then ran sam tool filter and then
> picard duplicate removal. I uploaded dbSNP and the reference FASTA file for
> Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base
> recalibration will not accept this output file. I wonder if there is sorting
> or indexing issue but how to fix this in galaxy.
>
>
> An error occurred running this job: Picked up _JAVA_OPTIONS:
> -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012]
> net.sf.picard.sam.CreateSequenceDictionary
> REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta
> OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp
>
> Thanks,
> Umar
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org. Please keep all replies on the list by
> using "reply all" in your mail client. For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
> http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
> http://lists.bx.psu.edu/
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Philippe, The GATK wrappers provided with the Galaxy distribution are for GATK version 1.4. There is a set of 1.6/GATK-lite wrappers that has been developed by the team, but is not yet available. There may also be other options available in the Tool Shed that have been contributed by the community. Thanks for using Galaxy, Dan On Dec 11, 2012, at 5:26 PM, Philipe Moncuquet wrote: > Hi, > > I have encountered the same kind of errors. When I update the loc files link > to GATK, some of the tools display the reference genomes I added and some > not. It seems that the galaxy wrapper for GATK 1.6 is not very functional. > GATK don't really care because they are not supporting it any more, even > documentation has disappeared. And I understand that galaxy developers have > other stuff to do than supporting a tool that will disappear because it's not > open source any more. I don't know what tool could replace the recalibration > process done by GATK and don't know how to correct bugs neither. Any > suggestions ? > > Philippe > > > > 2012/12/12 Farooq,Umar (res) > Hi, > > I am trying to incorporate GATK in my pipeline but not been able to make it > work. I aligned my data with Hg 19 and then ran sam tool filter and then > picard duplicate removal. I uploaded dbSNP and the reference FASTA file for > Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base > recalibration will not accept this output file. I wonder if there is sorting > or indexing issue but how to fix this in galaxy. > > > An error occurred running this job: Picked up _JAVA_OPTIONS: > -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012] > net.sf.picard.sam.CreateSequenceDictionary > REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta > OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp > > Thanks, > Umar > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Joshua, Is this on the main public site? If so, can you share your history with me and I'll take a look? If this is on a local instance, can you provide additional information, such as the GATK version that you are using? Thanks for using Galaxy, Dan On Dec 11, 2012, at 5:34 PM, Joshua Orvis wrote: > I'm having some problems with GATK as well, but do have a functional pipeline > that uses the following GATK tools in Galaxy: > > - Realigner Target Creator > - Indel Realigner > - Unified Genotyper > - Variant Filtration > > The main problem I'm having with them is that it seems I need to run the > fasta/fastq groomer on all inputs before starting, and if I attempt to use > the 'advanced' options on either of the last two steps above it fails > immediately every time with a command-line option parsing error. I plan on > digging into the wrapper script in the coming days in an attempt to correct > this, which is currently attributed to Dan Blankenberg. I'm relatively new > to Galaxy development though and don't know where to submit my updates though > should I fix any of these problems. > > Joshua > > > > > On Tue, Dec 11, 2012 at 4:26 PM, Philipe Moncuquet > wrote: > Hi, > > I have encountered the same kind of errors. When I update the loc files link > to GATK, some of the tools display the reference genomes I added and some > not. It seems that the galaxy wrapper for GATK 1.6 is not very functional. > GATK don't really care because they are not supporting it any more, even > documentation has disappeared. And I understand that galaxy developers have > other stuff to do than supporting a tool that will disappear because it's not > open source any more. I don't know what tool could replace the recalibration > process done by GATK and don't know how to correct bugs neither. Any > suggestions ? > > Philippe > > > > 2012/12/12 Farooq,Umar (res) > Hi, > > I am trying to incorporate GATK in my pipeline but not been able to make it > work. I aligned my data with Hg 19 and then ran sam tool filter and then > picard duplicate removal. I uploaded dbSNP and the reference FASTA file for > Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base > recalibration will not accept this output file. I wonder if there is sorting > or indexing issue but how to fix this in galaxy. > > > An error occurred running this job: Picked up _JAVA_OPTIONS: > -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012] > net.sf.picard.sam.CreateSequenceDictionary > REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta > OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp > > Thanks, > Umar > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] How to display data at UCSC main?
Hi Anna, Thank you for reporting this error. There is currently an issue with displaying the link in the history item for the way we normally display interval datasets at UCSC. However, we have an alternative method available and I have enabled that for now. You will need to refresh the history pane and the link should appear for your datasets. Please let us know if you encounter additional issues. Thanks for using Galaxy, Dan On Dec 21, 2012, at 11:58 AM, Jennifer Jackson wrote: > Hello Anna, > > Are you still having this issue? Are you running the tutorial on the public > Main instance at http://main.g2.bx.psu.edu (usegalxy.org)? Please give it > another check (our server was recently updated) and if the problem is > persistent, share you history with me and I can take a look. > > To share from the public Main server: while this history is active, at the > top of History panel use "Options (gear icon) -> Share or Publish", then > generate a share link, copy it, and paste into a return email. Note the > dataset that you believe is the one for this step and that should have the > link, but does not, and I can provide feedback. > > Hopefully you have worked this out, but if not we can help, > > Jen > Galaxy team > > On 12/19/12 7:04 AM, Anna Vilborg wrote: >> Dear mailing list, >> >> I am new to Galaxy and am going through the tutorials, starting with Galaxy >> 101. >> Under point 2.5. "Recovering exon info and displaying data in genome >> browsers" >> in the tutorial, there is the option to display data at UCSC. However, I >> don't >> have this option, although my history looks otherwise identical to the >> tutorial >> one (I am using hg19 as does the tutorial). I can display my data at Ensembl. >> Does anyone now why I don't get the UCSC option? >> >> Best Regards >> Anna Vilborg >> ___ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > > -- > Jennifer Jackson > http://galaxyproject.org > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Discrepancy between Intersect and Join
Hi Aaron, I just tested this small example and it reported one region as the result of the intersect: https://main.g2.bx.psu.edu/u/dan/h/aaron-quinlan-intersect-test-02-08-2013 Do you have a history available that you can share (privately if you desire) where you see the issue, and we'll take a look. Thanks for using Galaxy, Dan On Feb 8, 2013, at 10:23 AM, Aaron Quinlan wrote: > Dear list, > > I have a student that found an unexplained discrepancy between the results > produced by the "Operate on Genomic Intervals" (OGI) intersect operation > versus the OGI join operation. In particular, we know for certain that there > are exactly 1105 intersection of at least 1bp between the two files we are > testing, as we have confirmed this with our own bedtools and the ucsc table > browser. An example intersection (intersecting positions: 10012008 - > 10012013): > > file 1: > chr1 10012008100120215.6186 > > file 2: > chr1 10011813100120135_Strong_Enhancer 0 + > 1001181310012013250,202,0 > > However, OGI intersect find 0 intersections between the files (settings: > return overlapping intervals, >= 1bp). In an effort to make sure we didn't > goof up on file formats (BED) or genome builds (hg19), we tested the exact > same two files with the OGI join operation and found 1105 intersections as > expected. > > I also tested the files with the bx-python bed_intersect.py and > bed_intersect_basewise.py scripts and get the expected results. > > Does anyone have a suggestion for how to resolve this? > > Thanks for your help and for providing such a fantastic resource to the > genomics community. > > Best, > - Aaron > quinlanlab.org > > > > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Discrepancy between Intersect and Join
Hi Aaron, If you did this on our public main server, you can use the share options (gear icon in history list --> Share or publish), this will let us investigate a bit deeper into the exact problem/situation. If you were using a local instance (or the public server), then emailing them directly to me will work just fine. Thanks for using Galaxy, Dan On Feb 8, 2013, at 3:10 PM, Aaron Quinlan wrote: > Hi Dan, > > Thanks for the follow up. Yes, I was also able to get it to work when I > created a test case using the example I originally sent. Yet when I run the > entire files, I get zero intersections. Join, in contrast, works fine. I'd > be happy to share the files. Would it be best to send them directly to you > by email? The are small. > > Thanks much for the help, > > - Aaron > quinlanlab.org > > > > > > On Feb 8, 2013, at 2:56 PM, Daniel Blankenberg wrote: > >> Hi Aaron, >> >> I just tested this small example and it reported one region as the result of >> the intersect: >> https://main.g2.bx.psu.edu/u/dan/h/aaron-quinlan-intersect-test-02-08-2013 >> >> Do you have a history available that you can share (privately if you desire) >> where you see the issue, and we'll take a look. >> >> >> Thanks for using Galaxy, >> >> Dan >> >> >> On Feb 8, 2013, at 10:23 AM, Aaron Quinlan wrote: >> >>> Dear list, >>> >>> I have a student that found an unexplained discrepancy between the results >>> produced by the "Operate on Genomic Intervals" (OGI) intersect operation >>> versus the OGI join operation. In particular, we know for certain that >>> there are exactly 1105 intersection of at least 1bp between the two files >>> we are testing, as we have confirmed this with our own bedtools and the >>> ucsc table browser. An example intersection (intersecting positions: >>> 10012008 - 10012013): >>> >>> file 1: >>> chr110012008100120215.6186 >>> >>> file 2: >>> chr110011813100120135_Strong_Enhancer 0 >>> + 1001181310012013250,202,0 >>> >>> However, OGI intersect find 0 intersections between the files (settings: >>> return overlapping intervals, >= 1bp). In an effort to make sure we didn't >>> goof up on file formats (BED) or genome builds (hg19), we tested the exact >>> same two files with the OGI join operation and found 1105 intersections as >>> expected. >>> >>> I also tested the files with the bx-python bed_intersect.py and >>> bed_intersect_basewise.py scripts and get the expected results. >>> >>> Does anyone have a suggestion for how to resolve this? >>> >>> Thanks for your help and for providing such a fantastic resource to the >>> genomics community. >>> >>> Best, >>> - Aaron >>> quinlanlab.org >>> >>> >>> >>> >>> >>> ___ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >> > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Change format with "edit attributes"
Hi Gema, For example, see the "Combine FASTA and QUAL into FASTQ" tool for creating a FASTQ file from FASTA data; when quality data is not provided, fake score values will be used. Thanks for using Galaxy, Dan On Apr 3, 2013, at 10:42 AM, Peter Cock wrote: > > > On Wed, Apr 3, 2013 at 3:40 PM, Gema Sanz Santos wrote: > Hello, > > I'm trying to change the format to the output files from Barcode splitter > from FASTA to FASTAQ so I can use them in Bowtie for Illumina. I've read that > it can be done through the edit attributes, I go to datatype and select > fastaq, save and then go to convert format and press convert but the > resulting file is 0 bytes and is not recognized by Bowtie. > > I´ve also tried to upload by copying the link and selecting fastaq as format > but in this case, I got the file shown in the picture and it is not > recognized by Bowtie again. > > > > What can I do?? I don´t know how to continue because I´m not able to change > the format to fastaq! > > Thank you very much for your help in advance > > Best, > Gema > > > Hi Gema, > > There seem to be several factors confusing you here. > > The screenshot shows FASTA data wrongly labelled as FASTQ. > > The Galaxy "edit attributes" does NOT actually edit the data. There are > separate tools which can convert from one format to another, which gives you > a new entry in the history (another green box on the right). > > You can convert from FASTQ to FASTA, but doing the opposite is not possible > without inventing quality scores (e.g. give everything score 30). > > Does that help? > > Peter > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] problem uploading txt data
Hi Chunyu, Thanks for reporting this issue, it has been resolved in our stable branch and will be available on our public server after the next update. Thanks for using Galaxy, Dan On May 12, 2013, at 10:52 AM, Chunyu Liu wrote: > hi, > I had an odd problem today, seems not a problem before: > I am trying to upload a simple tab-delimited text file into galaxy, > but it kept telling me: > empty > format: txt, database: hg19 > The uploaded binary file contains inappropriate content > > Also, showed filesize as 0 bytes. > > I tried Unix format, DOS format. It is a very small data, only 348 bytes. > 4 rows, as attached. > > What is WRONG? > > Thanks! > > Chunyu > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Unable to use FASTQ tool on Main over several days
Hi Eduardo, I've committed some code that should fix the issue that you are experiencing, and it will be available on the main server after the next update (some time next week). Until then, if you change the name of e.g. your history item 34 to not have a 'í' or other non-ascii characters in it, you should be able to continue to use this history before the main server is updated. Please let us know if you encounter additional issues. Thanks for using Galaxy, Dan On May 24, 2013, at 10:31 AM, Eduardo Fox wrote: > Please, I have been unable to use any of the tools under FASTQ Tools > for the last 4 days. I keep getting an error message with codes, for > instance GURU MEDITATION: #376b73ae417d41f3a7c2088770e13b8f. > > Is this part of the platform down for some reason? > > Best wishes and thanks, > > E. Fox > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] [galaxy-dev] Connecting to new Galaxy Cloudman by FTP
Hey Mo, You can use ssh to connect to the Galaxy machine. If you used cloudlaunch to create your instance, it should display an example connection string that will work from e.g. a linux/mac shell, something like: 'ssh -i cloudman_keypair.pem ubuntu@IP', after your instance launched. Once inside of the machine, you can do something like: 'sudo -iu galaxy', to switch to the galaxy user and then have a look at the mount points under /mnt/. The cloudman_keypair.pem file is the key file that you (should have) downloaded the first time that you launched a cloudman instance, or when you manually generated a keypair. You can create additional keypairs in your aws console if you need to download a new one to use (you can probably delete the existing cloudman_keypair and have it regenerated automatically by cloudman, but I haven't tested this and I wouldn't recommend doing this if an instance is running). You'll need to use the correct .pem file for the keypair that you specified during launch of the instance. See http://docs.aws.amazon.com/AWSEC2/latest/UserGuide/generating-a-keypair.html for Amazon's info on creating keypairs (especially if you are using e.g. Windows and putty: http://docs.aws.amazon.com/AWSEC2/latest/UserGuide/putty.html). Once you make the changes to the files locally, you can use the Cloudman Admin web UI to restart the Galaxy instance. Let us know if you encounter any issues. Thanks for using Galaxy, Dan On Jul 15, 2013, at 7:22 PM, Mohammad Heydarian wrote: > Hey Nate, > Thanks for the response and instructions. > > I understand the last three steps of your protocol, but the first step is > difficult for me to understand. I'm guessing that, "1. Set 'use_pbkdf2 = > False' in universe_wsgi.ini anywhere in the [app:main] section", is telling > me to change a setting of Cloudman by command line. This is generally where > we get stuck in using Cloudman, because we aren't familiar with command line > (we get cold sweats and light palpitations) and are weary of making changes > to the Cloudman code. > > I would ask our IT guys for help, but their expertise ends at updating Office > tools. I would bother a programmer or bioinformatician, but most of them are > so busy you need a formal collaboration to get on their radar. I would ask > people who vaguely "know" command line for help, but most of the time their > knowledge of command line is just higher than mine and we end up > troubleshooting an issue neither of us can really grasp. > > So, is there a webcast, or video, or slideshow, that can show a newbie how to > command line into Cloudman and make the changes you outline in step 1? > > > > Cheers, > Mo Heydarian > > > > > On Mon, Jul 15, 2013 at 4:22 PM, Nate Coraor wrote: > On Jul 8, 2013, at 3:50 PM, Mohammad Heydarian wrote: > > > Hi, > > I am having trouble setting up a FTP connection with the recently released > > version of Galaxy Cloudman (ami-118bfc78). > > > > I have instantiated the new version of Galaxy Cloudman with CloudLaunch and > > also through the AWS EC2 wizard (using the same security group settings as > > the previous versions) and neither instance will connect to my FTP > > connection. > > > > Has anyone else had this problem? Does anyone know what is preventing the > > FTP connection? > > > > Any help would be greatly appreciated. > > Hey Mo, > > This may be a case of the new password hashing algorithm's incompatibility > with the provided ProFTPD config. Could you try the following: > > 1. Set 'use_pbkdf2 = False' in universe_wsgi.ini anywhere in the [app:main] > section > 2. Restart Galaxy > 3. Reset your password in the Galaxy UI > 4. Test FTP again > > --nate > > > > > > > Cheers, > > Mo Heydarian > > > > ___ > > Please keep all replies on the list by using "reply all" > > in your mail client. To manage your subscriptions to this > > and other Galaxy lists, please use the interface at: > > http://lists.bx.psu.edu/ > > > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ > > ___ > The Galaxy User list should be used for the discussion of >
Re: [galaxy-user] How do I remove "Histories shared with you by others"?
Hi Casey, I was able to confirm this issue and we’ll work on a fix for it. Thanks for reporting. Thanks for using Galaxy, Dan On Feb 6, 2014, at 10:25 AM, Jennifer Jackson wrote: > Hi Casey, > > I just tested the UI "unsharing" for both of your cases and was unable to > replicate the problem. Can you confirm that you are using the public Main > Galaxy instance at http://usegalaxy.org ? And is this your account email? > Please confirm and we can try to see what may be going on. > > For the other, prior, question you reference, that one was fully resolved and > permissions were not a factor. The thread has a reply with a link to our > sharing wiki/video. The UI is/was behaving as expected. To share/unshare, use > the pull-down menus or use the forms available from the history menu. > > Let us know about where you are using Galaxy, and we can follow up with more > testing, > > Thanks! > > Jen > Galaxy team > > > On 2/6/14 3:46 AM, Casey Bergman wrote: >> Hello - >> >> I am trying to clean out my "Histories shared with you by others" page on >> the main public Galaxy server. I would like to remove old histories shared >> with me. I have tried two methods, neither of which allow me to remove >> these histories: >> >> 1. clicking the check box to a history shared with me, then clicking >> "Unshare" at the bottom of the page >> 2. clicking the drop down menu and then selecting "Unshare" >> >> In both cases, I get the error message "History is not owned by the current >> user". This behavior appears to be referenced in another recent thread from >> the sharer's side >> (http://user.list.galaxyproject.org/Trying-to-quot-unshare-quot-a-history-in-order-to-delete-td4656453.html). >> >> Any ideas on what is going on here? >> >> Best regards, >> Casey >> >> >> >> >> >> ___ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> >> To search Galaxy mailing lists use the unified search at: >> >> http://galaxyproject.org/search/mailinglists/ > > -- > Jennifer Hillman-Jackson > http://galaxyproject.org > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Can not delete data from my local galaxy
Hi Nishant, In your universe_wsgi.ini file, you need to set: allow_user_dataset_purge = True Thanks for using Galaxy, Dan On Apr 10, 2014, at 8:09 AM, Nishant THAKUR wrote: > Hello, > I am using local galaxy server. I have disc storage problem and I noticed > that galaxy is utilizing most of the space. I deleted old projects > permanently, but they are appearing again in the saved history with one > message which says "datasets were not removed from disk because that feature > is not enabled in this Galaxy instance". > Any suggestions how to enable this feature or delete dataset permanently from > history. > > Galaxy installed on ubuntu 12.04 LTS, 3.5.0-44-generic, 64bit. > > > Best regards > Nishant Thakur > > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Base Recalibration tool on usegalaxy
Hi Kaz, We do have a problem with the Table Recalibration tool on Main right now. We’ll let you know when we have a fix. Thanks for using Galaxy, Dan On Apr 11, 2014, at 10:24 PM, KS wrote: > Hi Bjoern, > > Thank you for the reply. > > I found Table Recalibration, probably from GATK, on Tool Shed as you informed. > http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=name&advanced_search=false&operation=view_or_manage_repository&page=1&async=false&show_item_checkboxes=false&f-free-text-search=recalibration&id=797c55906a13241a > But I am only a user of usegalaxy public server, so I am afraid I > think I can't install tool from tool shed. > > What I am doing is here: > https://usegalaxy.org/u/ksfk/h/illumina-exome > > I think I need Table Recalibration in "NGS: GATK Tools (beta)" tool > group of left pane of usegalaxy, but I cannot find it. > > I am wondering whether there is any way to directly call Table > Recalibration without web-application wrapper. > > Regards, > Kaz > > 2014-04-12 7:26 GMT+09:00 Björn Grüning : >> Hi Kaz, >> >> you are searching for GATK tools, right? Please have a look at the GATK >> suites in the Tool Shed. >> >> Cheers, >> Bjoern >> >> Am 12.04.2014 00:16, schrieb KS: >>> >>> Dear all, >>> >>> I can't find either of Table Recalibration or Base Recalibrator on >>> usegalaxy public server. I am defident this is right place to ask, but >>> seqanswers is clouded with many other pipelines. >>> >>> Is there an update of base recalibration tool on usegalaxy? >>> >>> Best, >>> Kaz >>> ___ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >>> To search Galaxy mailing lists use the unified search at: >>> >>> http://galaxyproject.org/search/mailinglists/ >>> >> ___ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> >> To search Galaxy mailing lists use the unified search at: >> >> http://galaxyproject.org/search/mailinglists/ > > ___ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ > ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Base Recalibration tool on usegalaxy
Hi Kaz, The issue with the Table Recalibration tool should now be resolved, you’ll need to refresh your Galaxy window if you haven’t already. Thanks for reporting the error and let us know if you find any more issues. Thanks for using Galaxy, Dan On Apr 12, 2014, at 2:27 AM, KS wrote: > Hi Dan, > > Thank you for informing. > > I know I should install my own local galaxy server for repetitive > analyses, but this is the first time for me to analyse exome. Thank > you for giving me opportunity to use galaxy in public. > > Hoping recovery of Table Recalibration tool. > > Regards, > Kaz > > 2014-04-12 13:08 GMT+09:00 Daniel Blankenberg : >> Hi Kaz, >> >> We do have a problem with the Table Recalibration tool on Main right now. >> We'll let you know when we have a fix. >> >> >> Thanks for using Galaxy, >> >> Dan >> >> >> On Apr 11, 2014, at 10:24 PM, KS wrote: >> >>> Hi Bjoern, >>> >>> Thank you for the reply. >>> >>> I found Table Recalibration, probably from GATK, on Tool Shed as you >>> informed. >>> http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=name&advanced_search=false&operation=view_or_manage_repository&page=1&async=false&show_item_checkboxes=false&f-free-text-search=recalibration&id=797c55906a13241a >>> But I am only a user of usegalaxy public server, so I am afraid I >>> think I can't install tool from tool shed. >>> >>> What I am doing is here: >>> https://usegalaxy.org/u/ksfk/h/illumina-exome >>> >>> I think I need Table Recalibration in "NGS: GATK Tools (beta)" tool >>> group of left pane of usegalaxy, but I cannot find it. >>> >>> I am wondering whether there is any way to directly call Table >>> Recalibration without web-application wrapper. >>> >>> Regards, >>> Kaz >>> >>> 2014-04-12 7:26 GMT+09:00 Björn Grüning : >>>> Hi Kaz, >>>> >>>> you are searching for GATK tools, right? Please have a look at the GATK >>>> suites in the Tool Shed. >>>> >>>> Cheers, >>>> Bjoern >>>> >>>> Am 12.04.2014 00:16, schrieb KS: >>>>> >>>>> Dear all, >>>>> >>>>> I can't find either of Table Recalibration or Base Recalibrator on >>>>> usegalaxy public server. I am defident this is right place to ask, but >>>>> seqanswers is clouded with many other pipelines. >>>>> >>>>> Is there an update of base recalibration tool on usegalaxy? >>>>> >>>>> Best, >>>>> Kaz >>>>> ___ >>>>> The Galaxy User list should be used for the discussion of >>>>> Galaxy analysis and other features on the public server >>>>> at usegalaxy.org. Please keep all replies on the list by >>>>> using "reply all" in your mail client. For discussion of >>>>> local Galaxy instances and the Galaxy source code, please >>>>> use the Galaxy Development list: >>>>> >>>>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>>>> >>>>> To manage your subscriptions to this and other Galaxy lists, >>>>> please use the interface at: >>>>> >>>>> http://lists.bx.psu.edu/ >>>>> >>>>> To search Galaxy mailing lists use the unified search at: >>>>> >>>>> http://galaxyproject.org/search/mailinglists/ >>>>> >>>> ___ >>>> The Galaxy User list should be used for the discussion of >>>> Galaxy analysis and other features on the public server >>>> at usegalaxy.org. Please keep all replies on the list by >>>> using "reply all" in your mail client. For discussion of >>>> local Galaxy instances and the Galaxy source code, please >>>> use the Galaxy Development list: >>>> >>>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>>> >>>> To manage your subscriptions to this and other Galaxy lists, >>>> please use the interface at: >>>> >>>> http://lists.bx.psu.edu/ >>>> >>>> To search Galaxy mailing lists use the unified search at: >>>> >>>> http://galaxyprojec
Re: [galaxy-user] Galaxy User List Being Retired on June 6, 2014.
I think this is great. Do we have it clearly explained on the wiki somewhere about how to turn on mailing list mode within biostar? I didn’t see anything in a quick search, but it would probably help ease the transition for people that just love the mailing list approach. I also find it incredibly useful just for following new posts. Thanks, Dan On May 30, 2014, at 12:47 PM, Dave Clements wrote: > Hello all, > > In case you didn't see this it the June Galaxy Newsletter that went out today: > > > Galaxy-User Being Retired June 6 > > > Join the conversation! Learn how here. > > The Galaxy Biostar online forum was launched April 23 as a replacement for > the Galaxy-User mailing list. > > During the past 5 weeks, Galaxy Biostar has been wildly successful with over > 125 active threads, more than 5 times the number of active threads on > Galaxy-user in the 5 weeks before the switch. > > Galaxy-User has remained open during the transition, but now it's time to > retire it. All new posting to Galaxy-User will be stopped on Friday, June 6, > some 101 months, and 8,100 postings after it was launched. All those postings > will remain available both in Galaxy Biostar (where they have been imported), > and in the online list archives. > > Thanks for making Galaxy Biostar, and Galaxy-User before it, such a great > resource. > > > > > > > Thanks again, > > Dave C > > > > -- > http://galaxyproject.org/GCC2014 > http://galaxyproject.org/ > http://getgalaxy.org/ > http://usegalaxy.org/ > https://wiki.galaxyproject.org/ > ___ > The Galaxy User List is being replaced by the Galaxy Biostar > User Support Forum at https://biostar.usegalaxy.org/ > > Posts to this list will be disabled in May 2014. In the > meantime, you are encouraged to post all new questions to > Galaxy Biostar. > > For discussion of local Galaxy instances and the Galaxy > source code, please use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/ Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
