Re: [ccp4bb] Crystals with DNA

[Patrick Shaw Stewart]

Carina, to complement the techniques using sticky ends, etc., you can also
use the "random" microseeding approach that I mentioned to Kavya, see below.

The great advantage in a project like yours, where you have a family of
related constructs, is that you can use cross-seeding - that is, you can
use crushed crystals of one construct to seed other target constructs.  You
can even mix several seed stocks together, although we always keep seed
crystals grown in high-salt conditions separate from those grown in
high-peg conditions.

There are some very nice examples of cross-seeding and mixing seed stocks
in this paper by Obmolova et al.

Obmolova, G., Malia, T.J., Teplyakov, A., Sweet, R.W. and Gilliland, G.L.,
2014. Protein crystallization with microseed matrix screening: application
to human germline antibody Fabs. *Acta Crystallographica Section F:
Structural Biology Communications*, *70*(8), pp.1107-1115.
https://doi.org/10.1107/S2053230X14012552


More info

https://www.douglas.co.uk/mms.htm


Best wishes and good luck!

Patrick
___

Hi Kavya

1. Make a seed stock from the globules or anything else that you think
might be crystalline, and recreen.  In other words, you should add your
seed stock to *random screens* (not optimization experiments).  There could
be many conditions that are in the metastable zone of the phase diagram in
your normal screens - this method can give you crystals in those conditions.

If this works, you'll be in a better position anyway because you'll have
more control - by diluting the seed stock, you can control the number of
crystals per drop.

References:


D'Arcy, A., Villard, F. and Marsh, M., 2007. An automated microseed
matrix-screening method for protein crystallization. *Acta
Crystallographica Section D: Biological Crystallography*, *63*(4),
pp.550-554.

Shaw Stewart, P.D., Kolek, S.A., Briggs, R.A., Chayen, N.E. and Baldock,
P.F., 2011. Random microseeding: a theoretical and practical exploration of
seed stability and seeding techniques for successful protein
crystallization. *Crystal Growth & Design*, *11*(8), pp.3432-3441.


This is how we normally make the seed:


https://www.douglas.co.uk/f_ftp1/rMMS_Procedure.pdf




On Thu, Feb 8, 2024 at 11:26 AM careinaedgo...@yahoo.com <
02531c126adf-dmarc-requ...@jiscmail.ac.uk> wrote:

>  Hello all.
>
> I am struggling to get defracting crystals with a protein DNA complex. The
> crystals are plentiful but they do not diffract. I am going back to the
> grind stone and relookong at my DNA sequence.
> Is there any wisdom you could give me with regards to what works best with
> DNA in crystals?
> From my reading it seems if the length is a multiple of 7 (for B DNA) and
> blunt ended, it will stretch over the length of the crystal and improve
> crystalisability. But if you want crystals that diffract better, you will
> need to play with length and even making it only one base longer or shorter
> can make a difference, even changing the morphology of the crystal? Longer
> is better than shorter, and overhangs are good for improving diffraction?
> Presumably because they stabilize contacts? It is expensive to synthesize a
> while bunch of sequences so I need to be strategic in my choice. Would
> appreciate any advice.
> Thank you
> Careina.
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Crystallizing a tough target

[Patrick Shaw Stewart]

Hi Kavya

1. Make a seed stock from the globules or anything else that you think
might be crystalline, and recreen.  In other words, you should add your
seed stock to *random screens* (not optimization experiments).  There could
be many conditions that are in the metastable zone of the phase diagram in
your normal screens - this method can give you crystals in those conditions.

If this works, you'll be in a better position anyway because you'll have
more control - by diluting the seed stock, you can control the number of
crystals per drop.

References:

D'Arcy, A., Villard, F. and Marsh, M., 2007. An automated microseed
matrix-screening method for protein crystallization. *Acta
Crystallographica Section D: Biological Crystallography*, *63*(4),
pp.550-554.

Shaw Stewart, P.D., Kolek, S.A., Briggs, R.A., Chayen, N.E. and Baldock,
P.F., 2011. Random microseeding: a theoretical and practical exploration of
seed stability and seeding techniques for successful protein
crystallization. *Crystal Growth & Design*, *11*(8), pp.3432-3441.


This is how we normally make the seed:

https://www.douglas.co.uk/f_ftp1/rMMS_Procedure.pdf



2. Many years ago, we did some data mining of the crystallization
conditions in a remark in the PDB.  The concentrations that people reported
are below.  There were eight reports where over 100 mg/mL was used.  It
only goes up to 2004.

 https://www.douglas.co.uk/PDB_data.htm
<https://www.douglas.co.uk/PDB_data.htm>



Good luck,

Patrick

[image: image.png]



On Mon, Feb 5, 2024 at 10:27 AM kavyashreem 
wrote:

> Dear All,
>
> Has anyone worked on a protein which is highly soluble even at 80mg/ml?
>
> We have one such candidate, which does not precipitate even at 80mg/ml
> instead forms phase separated globules in crystallization plate, which
> eventually hardens over a period of 1 to 1.5 months (which is florescent
> under UV microscope.)
>
> We tried screening at different pH, but failed to get any hits.
>
> Since we got few conditions in which the phase separated globules
> solidified, we focused on them and expanded with 120mg/ml protein, still
> there were not visible precipitates except for the phase separation. This
> has been a challenging target so far. We have tried with different
> constructs, which unfortunately are not soluble!
>
> Does POMs help in such cases? Or do you have any other suggestion.
>
> Thank you
>
> Regards
>
> Kavya
>
>
>
>
> *CONFIDENTIAL: This email and any files transmitted with it are
> confidential and intended solely for the use of the individual or group to
> whom they are addressed. If you have received this email in error, please
> notify the sender immediately and delete this e-mail from your system. It
> is NOT AUTHORISED to copy, forward, or in any way reveal the contents of
> this message to anyone.*
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] [EXT] [ccp4bb] Crystallizing a tough target

[Patrick Shaw Stewart]

nd delete this e-mail from your system. It
> is NOT AUTHORISED to copy, forward, or in any way reveal the contents of
> this message to anyone.*
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Patenting ligand binding?

[Patrick Shaw Stewart]

the information in or
> > attached to the e-mail.
> > Any opinions expressed within this e-mail are those of the individual
> > and not necessarily of Diamond Light Source Ltd.
> > Diamond Light Source Ltd. cannot guarantee that this e-mail or any
> > attachments are free from viruses and we cannot accept liability for any
> > damage which you may sustain as a result of software viruses which may
> > be transmitted in or with the message.
> > Diamond Light Source Limited (company no. 4375679). Registered in
> > England and Wales with its registered office at Diamond House, Harwell
> > Science and Innovation Campus, Didcot, Oxfordshire, OX11 0DE, United
> Kingdom
> >
> >
> > 
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> > <https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1>
> >
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a
> mailing list hosted by www.jiscmail.ac.uk, terms & conditions are
> available at https://www.jiscmail.ac.uk/policyandsecurity/
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Patenting ligand binding?

[Patrick Shaw Stewart]

> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> >
> > This message was issued to members of http://www.jiscmail.ac.uk/CCP4BB,
> a mailing list hosted by http://www.jiscmail.ac.uk/, terms & conditions
> are available at https://www.jiscmail.ac.uk/policyandsecurity/
>
> -
> Randy J. Read
> Department of Haematology, University of Cambridge
> Cambridge Institute for Medical Research Tel: +44 1223 336500
> The Keith Peters Building
> Hills Road   E-mail:
> rj...@cam.ac.uk
> Cambridge CB2 0XY, U.K.
> www-structmed.cimr.cam.ac.uk
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a
> mailing list hosted by www.jiscmail.ac.uk, terms & conditions are
> available at https://www.jiscmail.ac.uk/policyandsecurity/
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] [EXT] Re: [ccp4bb] Regarding the diffraction image

[Patrick Shaw Stewart]

>
> As to why previously in a very similar condition you did get your desired
> protein plus (other) ligand


Kavya, did you use microseeding?  That's the way to get consistent results.

Since you're changing the ligand I suggest you go back and run a few random
screens (with crushed crystals of your protein with the other ligand) -
so-called microseed matrix-screening.

https://doi.org/10.1107/S0907444907007652


Good luck

Patrick






On Sat, Feb 4, 2023 at 10:32 PM Mark J. van Raaij 
wrote:

> PS it’s probably not a salt crystal…TCEP is not a salt, your ligand I
> presume is also not a salt, a small cleaved peptide neither. As to why
> previously in a very similar condition you did get your desired protein
> plus (other) ligand crystal, it just means the molecule (TCEP')
> crystallises in a similar condition to your protein - I don’t think you can
> conclude much more than that (unless there is some other difference like
> the TCEP being older this time and more oxidised, for example).
>
> Mark J van Raaij
> Dpto de Estructura de Macromoleculas, lab 20B
> Centro Nacional de Biotecnologia - CSIC
> calle Darwin 3
> E-28049 Madrid, Spain
> tel. +34 91 585 4616 (internal 432092)
> Section Editor Acta Crystallographica F
> https://journals.iucr.org/f/
>
>
> On 4 Feb 2023, at 15:48, kavyashreem  wrote:
>
> Dear all,
>
> Sorry for the confusion created, I did not mean that a protein would have
> fit in the small unit cell. My question was -
>
> 1. Why are there closely spaced spots arising in salt crystal?
>
> 2. If TCEP could crystallize in the condition, I have got a protein (same
> as this)+ligand (different ligand) complex in very close condition. (ligand
> size is within 500Da).
>
> Thank you
>
> Kavya
>
>
> On 2023-02-03 14:35, a.perra...@nki.nl wrote:
>
> Hi Kavya,
>
> Try https://csb.wfu.edu/tools/vmcalc/vm.html
>
> This tells you that a 30kD protein simply does not fit the cell.
>
> I am pretty sure you crystallised the ligand, or TCEP actually.
>
> Also, if you look at the diffractions pattern, its clear the crystal
> diffracts beyond 1.0A, diffraction spots are really very very very strong
> at 2.0A.
>
>
>
> On 3 Feb 2023, at 09:22, kavyashreem  wrote:
>
> Dear all,
>
> We crystallized a protein (30kDa) + ligand (by cocrystallization), in the
> condition 10%PEG3350, 50mM Zinc acetate.
>
> Protein was in the buffer 20mM HEPES, 150mM NaCl, 1uM ZnCl2, 4mM TCEP, pH
> 8.
>
> Crystal: Crystal:
> crystal under UV m
>
> <8ef9453e.png>
>
> When we collected the data at an in-house facility, it looked something
> like this:
>
> 
>
> The minimum resolution spot is around 9Ang and maximum ~2.2Ang.
>
> I have not come across a protein diffraction like this, nor of a salt.
> When I ran the gel for the incubated protein (protein+ligand), there was no
> degradation.
>
> Although, I was sure there is some problem with this image I tried
> processing, which could not be, But indexing showed a unit cell  of 11Ang,
> 11Ang, 46Ang in P3. which was quite expected for two of the axes but not
> the third.
>
> Can anyone please shed some light on this diffraction image?
>
> How can it happen?
>
>
> Thank you
>
> Regards
>
> Kavya
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] outliers

[Patrick Shaw Stewart]

ns, is the p-value of a structure with 1000
> > bonds in it with one 3-sigma deviate given by:
> >
> > a)  p = 1-erf(3/sqrt(2))
> > or
> > b)  p = 1-erf(3/sqrt(2))**1000
> > or
> > c) something else?
> >
> >
> >
> > On 11/8/2022 2:56 PM, Ian Tickle wrote:
> >> Hi James
> >>
> >> I don't think it's meaningful to ask whether the deviation of a single
> >> bond length (or anything else that's single) from its expected value
> >> is significant, since as you say there's always some finite
> >> probability that it occurred purely by chance.  Statistics can only
> >> meaningfully be applied to samples of a 'reasonable' size.  I know
> >> there are statistics designed for small samples but not for samples of
> >> size 1 !  It's more meaningful to talk about distributions.  For
> >> example if 1% of the sample contained deviations > 3 sigma when you
> >> expected there to be only 0.3 %, that is probably significant (but it
> >> still has a finite probability of occurring by chance), as would be
> >> finding no deviations > 3 sigma (for a reasonably large sample to
> >> avoid sampling errors).
> >>
> >> Cheers
> >>
> >> -- Ian
> >>
> >>
> >> On Tue, Nov 8, 2022, 22:22 James Holton  wrote:
> >>
> >> OK, so lets suppose there is this bond in your structure that is
> >> stretched a bit.  Is that for real? Or just a random fluke?  Let's
> >> say
> >> for example its a CA-CB bond that is supposed to be 1.529 A long,
> >> but in
> >> your model its 1.579 A.  This is 0.05 A too long. Doesn't seem like
> >> much, right? But the "sigma" given to such a bond in our geometry
> >> libraries is 0.016 A.  These sigmas are typically derived from a
> >> database of observed bonds of similar type found in highly accurate
> >> structures, like small molecules. So, that makes this a 3-sigma
> >> outlier.
> >> Assuming the distribution of deviations is Gaussian, that's a pretty
> >> unlikely thing to happen. You expect 3-sigma deviates to appear less
> >> than 0.3% of the time.  So, is that significant?
> >>
> >> But, then again, there are lots of other bonds in the structure.
> Lets
> >> say there are 1000. With that many samplings from a Gaussian
> >> distribution you generally expect to see a 3-sigma deviate at least
> >> once.  That is, do an "experiment" where you pick 1000
> >> Gaussian-random
> >> numbers from a distribution with a standard deviation of 1.0.
> >> Then, look
> >> for the maximum over all 1000 trials. Is that one > 3 sigma? It
> >> probably
> >> is. If you do this "experiment" millions of times it turns out
> >> seeing at
> >> least one 3-sigma deviate in 1000 tries is very common.
> Specifically,
> >> about 93% of the time. It is rare indeed to have every member of a
> >> 1000-deviate set all lie within 3 sigmas.  So, we have gone from one
> >> 3-sigma deviate being highly unlikely to being a virtual certainty
> if
> >> you look at enough samples.
> >>
> >> So, my question is: is a 3-sigma deviate significant?  Is it
> >> significant
> >> only if you have one bond in the structure?  What about angles?
> >> What if
> >> you have 500 bonds and 500 angles?  Do they count as 1000 deviates
> >> together? Or separately?
> >>
> >> I'm sure the more mathematically inclined out there will have some
> >> intelligent answers for the rest of us, however, if you are not a
> >> mathematician, how about a vote?  Is a 3-sigma bond length deviation
> >> significant? Or not?
> >>
> >> Looking forward to both kinds of responses,
> >>
> >> -James Holton
> >> MAD Scientist
> >>
> >>
>  
> >>
> >> To unsubscribe from the CCP4BB list, click the following link:
> >> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> >> <https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1>
> >>
> >> This message was issued to members of www.jiscmail.ac.uk/CCP4BB
> >> <http://www.jiscmail.ac.uk/CCP4BB>, a mailing list hosted by
> >>

[ccp4bb] Position available at Biotech Desk Pvt. Ltd, India – a unique opportunity for a structural biology enthusiast

[Patrick Shaw Stewart]

Posted on behalf of the Biotech Desk

Biotech Desk, located at Hyderabad, India is looking to recruit a
crystallization specialist for maintenance and installations of the Oryx
robots for protein crystallization. The person would also be in charge of
their lab services involving protein crystallization using client proteins
as a fee for service. Different constructs of the protein will be
expressed, purified and crystallized including both screening of crystal
forming conditions and optimization. Candidates who have completed their
post-graduation in Life sciences, Biophysics or related fields may apply.
The job is a right mix of bench work and customer interaction. Previous
sales experience is helpful but not essential. Interested candidates may
send their resumes to Ms. Kavitha at ad...@biotechdesk.com. Remuneration
depends upon the qualification of the person applying.



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] sugestions on weak diffracting protein crystals

[Patrick Shaw Stewart]

Hi Deepak

In my opinion, rMMS microseeding, ie adding crushed seed crystals into *random
screens*, should be used routinely in most crystallization projects.  It
gives much more control, in particular you can control the number of
crystals per drop.

In a case like this, I would use it straight away - use the crystals that
you showed us to make a seed-stock.


  The protein is a DNA binding protein and I have crystallized and solved
> the structure of this protein with its DNA partner


All seed-stocks are not the same - one may work but another may not.  Or
one particular seed-stock may give crystals with a different unit cell or
space group.  Since you have a *family *of constructs, you should try
cross-seeding with all the other (related) crystals that you have.

At the beginning of the project, to keep the number of experiments down,
you can mix together several different seed-stocks.  However it is
recommended that you keep crystals where the main precipitant was PEG
separate from crystals where the main precipitant was salt.

https://doi.org/10.1107/S2053230X14012552
https://doi.org/10.1107/S0907444907007652


or google MMS or rMMS.

Good luck, Patrick


On Tue, May 18, 2021 at 11:19 AM Deepak Deepak 
wrote:

> Dear all,
>
> I have got multiple crystals (see picture 1) of a protein (8kDa) with a
> helical aromatic oligoamide foldamer (5kDa) but these crystals *diffract
> very poorly *(see the diffraction pattern in picture 2).
>
> I prepare a 1.3mM:1.3mM complex of protein: foldamer in 20mM Tris, pH 7.5
> buffer. Crystals grew in 3-5 days in sitting and hanging drop at 20 Deg C
> and 25 Deg C in the following conditions:
>
> *- 20% PEG 400, 0.1M MES pH 6.0*
> *-20% PEG 400, 0.1M Sodium Cacodylate pH 6.0*
>
> *Multiple cryo used were:*
> *-25%Glycerol in mother solution*
>  -30% glycerol in water
> *-30%PEG 400,*
> *-35% PEG 400*
> *-20% PEG 8000 + 40% PEG 400 mix*
>
> Kindly suggest some methods/modifications on how can I improve the
> resolution and get better-diffracting crystals. Please let me know if you
> need more information.
>
> Kind regards,
> Deepak
> Ph.D. Student
>
> PS: The protein is a DNA binding protein and I have crystallized and
> solved the structure of this protein with its DNA partner and now I
> crystallized it with our foldamers but diffraction is not good. There are
> multiple structures of the Protein+DNA complex in literature but *no
> apo-protein structure *as the protein needs a binding partner to
> crystallize. *We already have solution studies showing a good binding.*
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Suggestions to improve resolution of protein crystals

[Patrick Shaw Stewart]

Hi Saurabh

Of course you should use "rMMS" microseeding.  See below

I hope it works !

Best wishes, Patrick


-- Forwarded message -----
From: Patrick Shaw Stewart 
Date: Mon, Sep 9, 2019 at 10:12 AM
Subject: Re: [ccp4bb] Optimization from needle shaped crystals
To: David Briggs 
Cc: CCP4BB@JISCMAIL.AC.UK 



Hi Chitra

Needles usually work very well for making seed stocks for random Microseed
Matrix Screening (MMS).  Your protein probably crystallizes well, but it is
growing too fast in one direction.

MMS has lots of advantages.  If it's going to work it will almost certainly
work within 12 hours.  Also, it allows you to control the number of
crystals per drop by diluting the seed stock.

Another excellent (open-access) paper that gives lots of examples of
seeding, cross-seeding, dilution, optimization etc within a defined set of
fabs is here:

https://scripts.iucr.org/cgi-bin/paper?nj5193


Good luck, Patrick



On Sun, Sep 8, 2019 at 1:46 PM David Briggs 
wrote:

> 4. Matrix microseeding. Make a seed stock from these crystals and then
> re-run your primary screens.
>
> https://www.ncbi.nlm.nih.gov/m/pubmed/25195878/
>
> --
> Dr David C. Briggs
> Senior Laboratory Research Scientist
> Signalling and Structural Biology Lab
> The Francis Crick Institute
> London, UK
> ==
> about.me/david_briggs
>
>




On Sun, Mar 21, 2021 at 6:04 PM Saurabh Upadhyay 
wrote:

> Dear All,
>
> I am trying to crystalize a protein, which occurs in monomeric (60kDa) and
> tetrameric (240kDa) form. *The protein during crystallization was in
> MES buffer pH-6 *and the method of crystallization was "*Sitting drop*"
> in "*Proplex*" condition. Some of the conditions in which crystals were
> obtained are:
>
> *1) 0.1M HEPES pH-7; 10% (w/v) PEG 4000*
> *2) 0.1M Tris, pH-8; 8% (w/v) PEG 8000*
> *3) 0.1M Tris, pH-8; 25% (v/v) PEG 400*
>
> For reference, I have attached the images of the crystals observed below.
>
> *However, the diffraction pattern obtained and the resolution of crystals
> were very poor. Even some mosaicity has been observed.  *
>
> Kindly suggest some methods or modifications, to improve the resolution
> and  diffraction pattern of the crystals obtained.
>
> Thanking You,
> Sincerely,
> Saurabh Upadhyay,
> Ph.D. Scholar
> c/o Dr. Ashok kumar Patel,
> Kusuma School of Biological Sciences,
> Indian Institute of Technology, Hauz Khas,
> New Delhi-110016, India
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Contagious, Self-Distributing "Vaccines?"

[Patrick Shaw Stewart]

(Sorry - still off-topic - or not !)

Hi Jessica

There's something called the "transmission-virulence trade-off hypothesis",
which was introduced specifically to explain observations of myxoma virus
virulence in Australia.  What scientists found was that if they introduced
what they called Grade I (ie highly virulent) myxoma strains, they
recovered Grade III strains one or two years later.  But if they introduced
(very mild) Grade IV strains, they also recovered Grade III strains a
little later.  It always ended up as Grade III.  I discussed this in my
preprint - and also in the paper my collaborator and I are now working on !

So probably not a good idea Jacob

Thx Patrick



On Thu, Feb 18, 2021 at 4:16 PM Jessica Bruhn 
wrote:

> Hello,
>
> There have been some really excellent points raised by others (informed
> consent, feasibility, etc), but I would like to share a story about another
> time humans tried to release a virus on a wild population in order to
> further an arguably noble goal:
>
> In the 1850s European rabbits were introduced in Australia for sport
> hunting. They quickly did what bunnies do and started to become a real
> problem. In the 1950s, scientists decided to introduce myxoma virus to
> Australia, which is 90-99% fatal for European rabbits, but less lethal for
> the native rabbits. They intentionally released this virus and in the first
> year the mortality rate was 99.8% for the European rabbits. Yay, right???
> Unfortunately, in the subsequent year the mortality rate fell to 25% and
> steadily continued to fall until it was lower than the reproductive rate of
> the European rabbits. The host-virus interaction played itself out:
> less-virulent viruses arose and resistant rabbits were selected for.
>
> To me it seems unwise to assume a replication competent virus (engineered
> or not) would refrain from mutating and adapting upon release, especially
> over the time course that would be required to infect all 7 billion+ humans
> on this planet. To me, I feel our options are (1) reach herd immunity
> through natural infection and accept the preventable deaths of many
> millions of people or (2) continue with non-pharmaceutical interventions
> (mask wearing, distancing, etc) until we can vaccinate enough people to
> reach herd immunity and hopefully by that time we have robust testing and
> treatment options available for those who continue to fall ill after we
> reach herd immunity. We as humans did something amazing by producing
> multiple safe and effective vaccines in less than one year, and I would
> like us to continue trying to save as many lives as possible by employing
> these vaccines as widely as possible.
>
> Anyways, take care. I know the pandemic is hard on all of us.
>
> Best regards,
> Jessica
>
> On Thu, Feb 18, 2021 at 6:15 AM Patrick Shaw Stewart <
> patr...@douglas.co.uk> wrote:
>
>> I agree with those who say that A and B are usually incompatible.
>>
>> If we're like chickens-in-a-barn-that-have-been-infected-with-bird-flu,
>> the virus very rapidly becomes more virulent (hospital and care-home
>> infections?).  It's hard for a virus to infect your nose and throat
>> quickly, and then stop.
>>
>> In the medium term the herd will build up some immunity and then we'll
>> become more like wandering albatrosses: the virus has to keep us on the
>> move if it's going to get itself near another susceptible host.
>>
>> IMO the way a *respiratory *virus tries to "have its cake and eat it" -
>> that is, get as much of both A and B as possible - is to develop thermal
>> sensitivity.  I.e. infect nose and throat but keep out of lungs and brain :
>>
>> https://www.preprints.org/manuscript/202101.0389/v1
>>
>>
>>
>> Thanks, Patrick
>>
>>
>> On Wed, Feb 17, 2021 at 9:46 PM Edwin Pozharski 
>> wrote:
>>
>>> I guess for such vehicle to be "extremely contagious" (or contagious at
>>> all for that matter) it should be capable of rapidly multiplying inside the
>>> host, so that it outruns immune system mediated destruction for at least
>>> some time in order to be present in high enough concentration to
>>> effectively spread via aerosols.  Given the range of immunodeficiencies
>>> present in any population, you are essentially guaranteed to kill at least
>>> some people whose immune system will not be able to cope with rapidly
>>> multiplying virus.  You can theoretically fine tune the lethality of such
>>> virus to make sure that number of people you thus murder will be less than
>>> those that die either in no vaccine or traditional vaccination scenario,
>>> but that

Re: [ccp4bb] Contagious, Self-Distributing "Vaccines?"

[Patrick Shaw Stewart]

I agree with those who say that A and B are usually incompatible.

If we're like chickens-in-a-barn-that-have-been-infected-with-bird-flu, the
virus very rapidly becomes more virulent (hospital and care-home
infections?).  It's hard for a virus to infect your nose and throat
quickly, and then stop.

In the medium term the herd will build up some immunity and then we'll
become more like wandering albatrosses: the virus has to keep us on the
move if it's going to get itself near another susceptible host.

IMO the way a *respiratory *virus tries to "have its cake and eat it" -
that is, get as much of both A and B as possible - is to develop thermal
sensitivity.  I.e. infect nose and throat but keep out of lungs and brain :

https://www.preprints.org/manuscript/202101.0389/v1



Thanks, Patrick


On Wed, Feb 17, 2021 at 9:46 PM Edwin Pozharski 
wrote:

> I guess for such vehicle to be "extremely contagious" (or contagious at
> all for that matter) it should be capable of rapidly multiplying inside the
> host, so that it outruns immune system mediated destruction for at least
> some time in order to be present in high enough concentration to
> effectively spread via aerosols.  Given the range of immunodeficiencies
> present in any population, you are essentially guaranteed to kill at least
> some people whose immune system will not be able to cope with rapidly
> multiplying virus.  You can theoretically fine tune the lethality of such
> virus to make sure that number of people you thus murder will be less than
> those that die either in no vaccine or traditional vaccination scenario,
> but that would be ethical equivalent of that modern crypto fascist
> suggestion that we just have to take it easy until herd immunity is
> established, even though few million grandparents will die in the process
> while the rest of us enjoy indoor dining.
>
>
>
> On Wed, Feb 17, 2021 at 12:33 PM Jacob Keller 
> wrote:
>
>> It would seem to me that it should be possible to generate versions of
>> the Covid virus that would:
>>
>> A. be extremely contagious and yet
>> B. be clinically benign, and
>> C. confer immunity to the original covid virus.
>>
>> If, then, this virus could be released, with appropriate "kill switch"
>> safeguards built in, would this not solve the world's pandemic problems? Is
>> there any reason, practically, why this approach would not be feasible?
>>
>> Maybe we don't really know enough to manipulate A, B, C yet?
>>
>> Or maybe it's too scary for primetime...nightmare bio-warfare apocalypse?
>>
>> Has this sort of thing been done, or does it have a name?
>>
>> Jacob
>> --
>>
>> +
>>
>> Jacob Pearson Keller
>>
>> Assistant Professor
>>
>> Department of Pharmacology and Molecular Therapeutics
>>
>> Uniformed Services University
>>
>> 4301 Jones Bridge Road
>>
>> Bethesda MD 20814
>>
>> jacob.kel...@usuhs.edu; jacobpkel...@gmail.com
>>
>> Cell: (301)592-7004
>>
>> +
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

[ccp4bb] Silicone oil for "modified microbatch"

[Patrick Shaw Stewart]

Hi All

Does anyone know where you can buy

Silicone Oil Dow Corning 200/1cS


nowadays?

This is the silicone oil that can be mixed with regular paraffin oil to
speed up evaporation in microbatch-under-oil experiments, ref below.  The
1cS refers to the viscosity.

We used to get this from BDH, in quite large batches, but that product is
no longer available.

Thx Patrick

___

D'arcy A, Elmore C, Stihle M, Johnston JE. A novel approach to
crystallising proteins under oil. Journal of Crystal Growth. 1996 Oct
2;168(1-4):175-80.
https://www.sciencedirect.com/science/article/pii/002202489600351X


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Micro/Macro crystal seeding experience

[Patrick Shaw Stewart]

Hi Rafael

Just to amplify Matthew and David's point about random microseed matrix
screening -


1.  The idea is you add seeds to RANDOM SCREENS - not everyone understands
this!  People find it very hard to "let go" of the first conditions they
see that give them crystals.

2.  I now have the opposite point of view: if I have a choice between
seeding and non-seeding conditions I always try to work with the seeding
ones.  The reason is, you have far more *control*, because you can dilute
the seed stock and "dial up" the number of crystals that you want per drop.

3.  Try cross-seeding with crystals of homologous proteins, mutants etc,
even crystals with 20% sequence identity can work.

4.  Seeds are not all alike - sometimes seeds with a particular unit cell
work but other seeds (different unit cell) don't.  See ref**

5.  Just throw seeds in with a new project - at worst you're running
another screening experiment.


** Acta Cryst. <https://journals.iucr.org/f> (2014). F*70*
<https://journals.iucr.org/f/contents/backissues.html>, 1107-1115, Obmolova
et al.  Crystals of Fab 3-53/L6, grown by self-seeding, diffracted to 2.8Å
(Figure 4b).  However crystals of the same protein grown by cross-seeding
(with crystals of a homologous Fab) looked completely different and
diffracted to 2.3Å  (figure 4c).

https://scripts.iucr.org/cgi-bin/paper?nj5193 (open access).

Your project shouts "seed me".

Hope it works

Patrick



On Thu, Dec 17, 2020 at 10:27 PM Whitley, Matthew J  wrote:

> I want to second the recommendation to try microseed matrix screening.  I
> recently had a case of a protein that did not yield any crystals after
> trying more than 500 conditions.  Of those 500, one single condition gave
> to me what appeared to be crystalline material, but not distinct single
> crystals.  I harvested that well, crushed up the material as best I could
> to make a seed stock, and then used the seed stock with the first 48
> conditions of I think the JCSG+ screen.  Came back the next day, checked
> the trays under the microscope, and was astonished to find at least 10
> wells that had gorgeous crystals in them.  I harvested a few crystals from
> different wells, shot them at the Advanced Photon Source, and nearly
> fainted when diffraction to almost 1 Å popped up on the monitor for
> almost all of them.  So, you could say I’m a believer in random microseed
> matrix screening now …
>
>
>
> Good luck.
>
>
>
> Matthew
>
>
>
> ---
>
> Matthew J. Whitley, Ph.D.
>
> Research Instructor
>
> Department of Pharmacology & Chemical Biology
>
> University of Pittsburgh School of Medicine
>
>
> --
>
> Date:Thu, 17 Dec 2020 21:54:15 +
> From:David Briggs 
> Subject: Re: Micro/Macro crystal seeding experience
>
> Hi Rafael, there are many potential answers to questions such as this.
>
> Here are the first few that spring to mind:
>
>
>   1.  Did you test room temperature diffraction? Is it your
> cryo-protectant that is causing problems.
>   2.  What is your cryo-cooling protocol? Do you just dunk the crystals
> straight in to crystallisation liquor + 30% glycerol, or do you slowly step
> up the cryo-protectant concentration?
>   3.  Additive screens are worth a try.
>   4.  Modify the construct (trim termini, tags, or disordered loop
> regions).
>   5.  Microseed matrix screening to look for alternative conditions. (
> https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.douglas.co.uk%2Fmms.htmdata=04%7C01%7Cmjw100%40PITT.EDU%7C5f603236dfef49d09b5308d8a2d6b188%7C9ef9f489e0a04eeb87cc3a526112fd0d%7C1%7C0%7C637438390278906705%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C1000sdata=JJ1pHkScwTx8%2FJCZPXY9DYlIzosr9j67alrdsXIseCY%3Dreserved=0
> )
>
> Good luck!
>
> Dave
>
> --
> Dr David C. Briggs
> Senior Laboratory Research Scientist
> Signalling and Structural Biology Lab
> The Francis Crick Institute
> London, UK
> ==
> about.me/david_briggs
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] AW: [ccp4bb] External: Re: [ccp4bb] AlphaFold: more thinking and less pipetting (?)

[Patrick Shaw Stewart]

 my baby to the computing Gods. However we only
> provided the sequence to CASP, no info regarding any ligand or lipid.
> >
> >
> >
> > Less than a month after, the CASP team contacted us and send us the best
> model.  In fact it was 2 half models as the transporter is a pseudo dimer,
> with the N-lobe and C-lobe moving relative to each other during transport
> cycle, thus divided as two domains in CASP.
> >
> >
> >
> > The results were breathtaking. 0.7 And RSMD on one half, 0.6 on the
> other. And yes, group 427 was the superpower (did not know at the time that
> it was AlphaFold).
> >
> >
> >
> > We had long discussions with the CASP team, as -for us- this almost
> exact modelling was dream-like (or science fiction) and -at some point- we
> were even suspecting fraud, as our coordinates had travelled over the
> internet a few times around when interacting with colleagues.  The
> organisers reassured us that we were not the only target that had been
> “nailed” so no reason to suspect any wrongdoing.
> >
> >
> >
> > To this day I am still baffled and I would be happy to hear from the
> community, maybe from some of the CASP participants.
> >
> >
> >
> > The target is T024, the “perfect" models are domain-split version
> (T024-D1 and T024-D2), as AlphaFold2 did not perform so well on the
> complete assembly.
> >
> > Deposited PDB is 6T1Z
> >
> >
> >
> > Cedric
> >
> >
> >
> > PS: I should also note that many other groups performed very well, much
> better than I would have dreamed, including on the full protein but just
> not as crazy-good.
> >
> > —
> >
> > Prof. Cedric Govaerts, Ph.D.
> > Universite Libre de Bruxelles
> > Campus Plaine. Phone :+32 2 650 53 77
> > Building BC, Room 1C4 203
> > Boulevard du Triomphe, Acces 2
> > 1050 Brussels
> > Belgium
> > http://govaertslab.ulb.ac.be/
> >
> >
> >
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> >
> >
> >
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
> >
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a
> mailing list hosted by www.jiscmail.ac.uk, terms & conditions are
> available at https://www.jiscmail.ac.uk/policyandsecurity/
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Patrick Shaw Stewart]

;> synthesis is about $1k, so I estimate about $1 per test using 1000
>> different oligos. This price point will be important if we want to make
>> billions of tests to be used all over the world.  In some countries $1
>> is a lot.
>>
>> The detection strategy I am focusing on is FRET.  That is, oligos would
>> be made in pairs, recognizing abutting sections of the viral genome.
>> Like this:
>> 5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
>> which would anneal to one of the current CDC test primer sites:
>> 3' taaagcgactaggtaatagtctgttca 5'
>> The result in this case would be maximum FRET efficiency only when both
>> oligos are bound.  From what I can tell, the ATTO465 dye is one that is
>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
>> ATTO550 should give maximum contrast between the green and red channels
>> of the iPhone camera. That way you would discriminate presence/absence
>> by color.  Red=virus, Green=clear. That is just an example. Other tags
>> might work better.  Maybe quantum dots.
>>
>> Additional aparatus would be required, of course, and at least a few
>> reagents to crack open the capsids (DTT and guanidine).  These could be
>> shipped dry in foil packs.  The end user would simply tear it open and
>> spit into it.  If the intersted party is performing the test on
>> themselves, then there is no biohazard.  Heating to 70C (cup of coffee?)
>> should kill the virus, and these reagents will make it even more dead.
>> I'm not sure how much purification would be required.  The assay volume
>> in the Nature paper above was 1 mL.  I expect signal would be improved
>> by concentrating the RNA as close to the camera as possible.  It may
>> even be possible to absorb the nucleic acid directly onto the cover
>> glass of the smartphone camera.  RNA sticks to glass at pH < 7.5, and
>> not much else does.  Quiagen EZ1 nucleic acid purificaiton columns are
>> nothing but silica glass beads after all.
>>
>> There are still details to work out, but I am intruiged by the fact that
>> this seems physically possible and the potential of being very cheap,
>> rugged, portable and scaled up rapidly.  It would be nice to be able to
>> leverage a device that is in already in the hand of half the people on
>> the planet.
>>
>> Comments? Insights?
>>
>> -James Holton
>> MAD Scientist
>>
>> 
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>>
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] CCP4BB vs COVID19

[Patrick Shaw Stewart]

James, there are lots of quite simple experiments that would be could be
done, but I can't get anyone to think seriously about the problem - let
alone do the experiments.

The attitude seems to be, "it can't be as simple as you suggest - someone
would have noticed it".

* Has anyone measured virulence vs temperature in cell culture?*


This isn't what you've got in mind, but yes, it was noticed that the
viruses that establish persistent infections of cell cultures (and they
have to be less aggressive to do that) often *spontaneously* become
temperature sensitive.  And, conversely, temperature-sensitive viruses that
are grown at low temp but in conditions where they can multiply fast, often
spontaneously lose their initial temperature-sensitivity.  Refs in my
paper.  Thse are all experiments that were done "by accident".

In influenza a temperature-driven switch has been seen, switching between
translation (high temp) and replication (low temp).  See the link below for
figures - described in words in my paper, below.

Best wishes

Patrick


Figures showing the "switch":
https://www.douglas.co.uk/f_ftp1/Seminar_by_Patrick_Shaw_Stewart_-_a_few_slides_for_Bill.pdf
Paper: http://douglas.co.uk/f_ftp1/ShawStewart_final_1-s2.pdf
Easy read part 1, about seasonality: https://oldwivesandvirologists.blog/
Easy read part 2 about Covid:
https://oldwivesandvirologists.blog/Covid-19-and-the-trade-off-model-of-selection/


_


>From my paper:


*The temperature sensitivity of viral transcription*

Most laboratory respiratory viruses are propagated at 37 C, which may
result in the rapid
loss of ts characters, especially since viruses mutate very rapidly when
they are introduced
to new hosts. If, however, temperature sensitivity is a common feature of
wild respiratory
viruses, we might expect to see remnants of temperature sensitivity in the
biochemistry
of laboratory strains. It turns out that such remnants are quite common.
For several
decades virologists have found that maximum RNA transcription in influenza
viruses occurs
below normal body temperature. In 1977, Plotch and Krug [61] reported that
the greatest
activity of the RNA polymerase of WSN virus was at 30–32 C. This is similar
to the optimum
temperature of the polymerase of influenza C, which is 33 C [62,63].
Ulmanen et al. [64]
found that the rate of transcription by detergent-treated WSN viruses
(influenza A) was about
10 times greater at 33 C than at 39.5 C, and also that the binding of a
cleaved primer cap
(the ‘‘A13 fragment”) to the viral cores was ‘‘unexpectedly” much weaker at
39.5 C than at
33 C. Scholtissek and Rott [65] showed that the optimum for the polymerase
of the
Rostock strain of fowl plague virus was 36 C, five degrees below chickens’
normal body
temperature (41 C). At least two reports show that temperature affects the
balance between
transcription and viral replication. Kashiwagi et al. looked at the effect
of temperature on
RNA production for five varied influenza A strains [66]. For all strains,
vRNA unexpectedly
decreased when the temperature was increased from 37 C to 42 C. The PA
subunit of the
viral polymerase caused this thermal sensitivity. In another interesting
study, Dalton et al.
showed that the production of mRNA by the PR8 influenza strain is favored
at a higher
temperature (41 C), with very little vRNA being produced at that
temperature [67]. A plasmid-
based recombinant system showed that as the incubation temperature
increased from 31 C
to 39 C the amount of replicative RNA products (c- and vRNA) decreased and
a greater
accumulation of mRNA was observed. The cRNA that is used as a template to
make the
vRNA formed a complex with the polymerase that was particularly
heat-labile, showing rapid
dissociation even at 37 C. The authors suggested that the ‘‘switch” that
regulates the
transition from transcription to replication is dependent on temperature,
but made no
comments about how shifts in the host’s body or respiratory tract
temperature may influence
this transition.





On Sun, Mar 22, 2020 at 3:38 PM James Holton  wrote:

> Thank you Patrick,
>
> RNA structure is still structural biology, so I think relevant here.  It
> seems to me that RNA as a thermometer would be an easy hypothesis to test?
> Has anyone measured virulence vs temperature in cell culture?
>
> The 3D structure of the genome is no doublt important.  I wouldn't want to
> try crystallizing the whole thing, but I wonder if this might be an
> excellent target for cryoEM?  A challenge for that "we can classify our way
> out of anything" philosophy?  And the result would most certainly be
> interesting.
>
> -James Holton
> MAD Scientist
>
> On 3/21/2020 8:41 AM, Patrick Shaw Stewart wrote:
>
>
> James, this isn't conventional structural biology, but may be of interest,
> and I haven't been able get any mainstream virologists

Re: [ccp4bb] CCP4BB vs COVID19

[Patrick Shaw Stewart]

ion on the other end of the
> genome: the "L" type has a faster codon for Ser in ORF1.  Such tight
> coupling (r^2=0.945) means there must be significant selective pressure
> preventing both of these mutations occurring in the same virus at the
> same time.  That, I believe, is interesting.  Espeically since they are
> so far apart I expect this selective pressure might work in trans: as in
> a super-infection. That is, the S and L genome types may interfere with
> each other.
>
> The authors fall short of claiming evidence of interference upon
> super-infection, and indeed they have already been criticised for
> calling "L" the "aggressive" type.  But it is still interesting and
> points a finger at ORF8.
>
> ORF8 has only one homolog in the PDB: 5o32 with 25% identity over a
> stretch of 60 residues.  This homologous region contains the S84L site
> (Val I544 in 5o32).  I had a quick look and appears to be a
> cavity-filling mutation to me.  Not very big, but maybe something could
> fit in there.  To be sure we'd need a structure of ORF8.
>
> Good luck to you all, and stay healthy.
>
> -James Holton
> MAD Scientist
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] PhD studentship (UK): Dynamic Structural Biology – from nanocrystals to time-resolution (CASE project)

[Patrick Shaw Stewart]

The South Coast Biosciences (SoCoBio) Doctoral Training Partnership is
offering a PhD student a unique opportunity to undertake research and
training in structural biology and microfluidics.

https://research.kent.ac.uk/socobio/dynamic-structural-biology-from-nanocrystals-to-time-resolution/



Primary supervisor:
Dr Ivo Tews, Biological Sciences, University of Southampton
Co-supervisors:
Dr S. Mark Roe, School of Life Sciences, University of Sussex
Dr Jonathan West, Medicine, University of Southampton

Project Summary

Significant technical developments are revolutionising structural biology
and change the way in which a crystallographic experiment is approached.
Noise-free detection, advances in synchrotron X-ray sources and
availability of pulsed X-ray free electron laser sources (XFEL) now firmly
establish serial crystallography. Thousands of nanocrystals each contribute
a single x-ray exposure. The method is able to add dynamic information on
structural changes or transitions, observed over time. Enzymes or higher
order molecular complexes are prominent targets.

Micro- or nanocrystalline samples are required to unlock this capability.
We developed a workflow for optimising crystal growth for size and
homogeneity [1] and demonstrated serial data collection with a fixed target
delivery approach using a nano-fabricated chip-based support system,
capable of delivering one structure per hour either at the Diamond Light
Source (I24 microfocus beamline) or at an XFEL source (SACLA, Japan).

The PhD will optimise nano-crystallisation to study two high value targets.
Micro-seeding approaches are developed in collaboration with the highly
innovative CASE partner Douglas Instruments [2]. Novel high-throughput
approaches in nano-crystallisation using microfluidic platforms are
developed at Southampton [3].

*Target 1: Hsp90, a chaperone implicated in maintaining many cancers [4].
Very small crystals of Hsp90 in complex with co-chaperones and client
proteins can be formed (specifically the Hsp90/cdc37/Braf complex). The
size of these crystals is such that they are not suitable for standard data
collection, and serial nano-crystallography will enable structure
determination to understand how Hsp90 aids in protein maturation.*
*Target 2: Pdx1, an enzyme that synthesises vitamin B6 from two
carbohydrates and ammonia. Crystallisation of several key intermediates is
established, and the complex cascade of reactions has been described by us
[5]. Serial data collection to map the highly dynamic changes in the enzyme
is now required, investigating sugar ring opening, ammonia transfer, and
migration of intermediates.*


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] design specs/tolerances for crystallization rooms?

[Patrick Shaw Stewart]

>  if you're in even vaguely warm or temperate regions (or seasons), cooling
> the intake air to 4C brings it to below dew point, and then condensation
> and snow are guaranteed.


I once serviced a robot in a 4C room in Singapore, which didn't seem to
have any kind of dehumidification - or maybe it had broken down.  Water was
running feely down the walls and poling on the floor, and the robot was
covered in condensation.  Every non-stainless screw on the controller,
computer, robot etc was rusty.  Interestingly, both the robot and the
computer still worked.

Patrick


On Wed, Sep 25, 2019 at 6:04 AM Frank Von Delft 
wrote:

> My colleague Opher Gileadi gave us an excellent tip when we were designing
> our 4C harvesting room, over a decade ago:  *set it to 7C*.  The crystals
> are unlikely to mind, but it's SO much more comfortable to be in for
> hours.
>
> I seem to remember he mentioned something like a comfort inflection point
> as you approach 4C.
>
> *Install low-flow fans*.  Fridge people seem to default to installing
> hurricane machines, you have to tell them that a very very small flow is
> enough.
>
> *Get strong light* - probably even those daylight things (we don't have
> them).  Being cold is miserable enough already, there's no need to compound
> it with weak light.
>
> *Vibration* - that dwindles to insignificance if the air flow goes down.
>
> *Humidity* - we installed (at considerable expense) a low humidity air
> supply - really hard to know just how much it helps, but a few years ago
> when I had it turned it off to help save energy, very quickly I heard
> complaints about snow in the liquid nitrogen becoming a major hassle.  So
> based on that set of anecdotes, I conclude it probably *is* worth having
> dry air.
>
> It's *much* cheaper though if they can design it into the building's
> infrastructure, if it's a new building;  retrofitting turned out to be
> super expensive (in our case).
>
> As dry as possible.  Look at and understand the psychrometric chart
> (google it):  if you're in even vaguely warm or temperate regions (or
> seasons), cooling the intake air to 4C brings it to below dew point, and
> then condensation and snow are guaranteed.
>
> *Size* - make it as big as you can get away with, with lots of bench and
> shelf space.  Your students will already be miserably cold, no need for
> them to be cramped too.
>
> Good luck!
> Frank
>
>
>
>
>
> On 24/09/2019 23:40, Scott, Emily wrote:
>
> Anyone out there specifically design rooms for (protein) crystallization
> at ~22 deg and 4 deg C?  If you have successes or failures and can share
> any design specs with regard to vibration, temperature, and humidity
> tolerances, it would be much appreciated to pass on to the architects for
> our new laboratory.
>
>
>
> Sincerely,
>
> Emily Scott
>
>
>
> --
>
> Emily Scott, Ph.D.
>
> Professor, Medicinal Chemistry/Pharmacology/Biophysics
>
> Faculty Director, BioNMR Core Lab
>
> University of Michigan
>
> 428 Church Street
>
> Ann Arbor, MI 48109-1065
>
> Phone:  734-764-3530
>
> https://pharmacy.umich.edu/people/scottee
>
> Lab webpage:  http://scottlab.info
>
>
>
>
>
> **
> Electronic Mail is not secure, may not be read every day, and should not
> be used for urgent or sensitive issues
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
>
> ------
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] AW: [EXTERNAL] Re: [ccp4bb] AW: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

Dear Herman

Animals that are sick tend not to move around a lot.  One can imagine that
this limits the tendency for animal viruses and other animal pathogens to
become more and more virulent, because the very virulent strains won't
spread as fast.  And (importantly) when the most virulent strains finally
arrive at some particular location, they will find that their potential
hosts are already immune*.

Since plants don't move around, I have always wondered why plant pathogens
don't increase in virulence until they wipe out their hosts, especially
when you bear in mind that plants don't have complex immune systems.

Could these multiple genes be a way to avoid being wiped out by disease?
Ie if the plant gets sick, it just switches on a batch of "reserve"
genes**.  Is that possible?

Thx, Patrick


* This is a pet theory of mine: https://oldwivesandvirologists.blog

**Or maybe the expression of these genes is random - two genetically
identical individuals growing side-by-side might express different batches
of genes on a random basis.  Again, this might be mainly about disease
prevention.



On Fri, Sep 20, 2019 at 8:51 AM  wrote:

> Dear John,
>
> Plants cannot walk away to a more favorable spot. They remain stuck where
> they germinate, e.g. whether the place is sunny, shady, wet, dry, fertile,
> poor etc. So plants compensate by having a lot of genes available to be
> able to adapt to the particular spot where happen to be. And indeed, plants
> have usually more genes then animals!
>
> Best,
>
> Herman
>
>
>
> *Von:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *Im Auftrag von
> *John R Helliwell
> *Gesendet:* Freitag, 20. September 2019 09:19
> *An:* CCP4BB@JISCMAIL.AC.UK
> *Betreff:* [EXTERNAL] Re: [ccp4bb] AW: [ccp4bb] challenges in structural
> biology
>
>
>
> *EXTERNAL : *Real sender is owner-ccp...@jiscmail.ac.uk
>
>
>
> Dear Martin,
>
> Many thanks for these details of the size of the human genome over the
> decades and also the news of your most interesting upcoming review. I shall
> read it with great interest.
>
> Incidentally is the over 4 genes for the rice genome number correct?
> This number caught my eye as being interesting how the rice genome is more
> complicated than our genome.
>
> Best wishes,
>
> John
>
> Emeritus Professor John R Helliwell DSc
>
>
>
>
>
>
>
>
> On 19 Sep 2019, at 08:35, Kollmar, Martin  wrote:
>
> Dear John,
>
> the „100,000 human genes“ is a long-standing myth broad forward by the
> initiators of the U.S. human genome sequencing projects in 1990. This large
> number completely contradicted all genetics and mutation data since the 1940
> th, but the sequencing community (genome, cDNA, EST) didn’t read even the
> standard text books. Thus, the “30,000” genes published with the two human
> genome papers in 2001 are not “surprisingly low” but just in accordance
> with the predictions and the data since the 1940th. The gene number went
> down to about 23,000 already in 2004, and the current numbers (depending on
> database) range around 20,000 human protein-coding genes. The myth of the
> large numbers is only propagated by those who profit from larger numbers
> (e.g. bigger grants, papers in higher IF journals, big consortia).
>
>
>
> I have written a review about the current state (and history) of the human
> protein-coding genes, which will appear online in BioEssays soon and
> finally in the November issue (will be open access). In this review there
> will be some (hopefully) useful plots showing the gene numbers since the
> 1940th and a detailed review of all the numbers and their experimental
> basis (most were actually just extrapolations from small-scale data).
>
>
>
> Please excuse this kind of self-advertisement, but it is really more than
> time to move this myth out of science literature and communication.
>
>
>
> Best regards,
>
> Martin
>
>
>
> Priv. Doz. Dr. Martin Kollmar
>
>
>
> Group Systems Biology of Motor Proteins
>
> Department NMR-based Structural Biology
>
> Max-Planck-Institute for Biophysical Chemistry
>
> Am Fassberg 11
>
> 37077 Goettingen
>
> Deutschland
>
>
>
> www.motorprotein.de
> 
> (Homepage)
>
> www.cymobase.org
> 
> (Database of Cytoskeletal and Motor Proteins)
>
> www.diark.org
> 

Re: [ccp4bb] Intergrown crystals and excess of nucleation

[Patrick Shaw Stewart]

Hi Nikolaus

I completely agree with Claude's comments.  Microseeding is the first thing
to try.  You would like to find conditions where you *don't *get crystals
without seeding, but you *do *get crystals with seeding.  Then, just by
diluting the seed stock, you can control nucleation.  Look at D'Arcy and
Obmolova's papers, links below (second time!).

I also agree that crystallization in agarose can work well - if seeding
doesn't solve your problem.

The only person that I know who tried containerless crystallization ended
up with more crystals rather than fewer.

Actually your case is not very unusual - when you scale up you tend to
get *more
*crystals.  The reason is that the surface-area-to-volume ratio is greater
for smaller drops.  This means that you lose a greater proportion of the
protein on the plastic or glass surface of your plate, and also on the
air-drop interface.  Therefore you should dilute the protein and/or the
precipitant when you scale up.

Good luck, Patrick

http://scripts.iucr.org/cgi-bin/paper?S2053230X14015507
https://scripts.iucr.org/cgi-bin/paper?nj5193



On Mon, Sep 9, 2019 at 4:45 PM Claude Sauter 
wrote:

> Le 09/09/2019 à 17:22, Nikolas a écrit :
>
> Dear crystalgrowers,
>
> I am currently working with a protein that appeared to be friendly but
> turned out it was not the case.
> I found myself to face -in the scale up- the opposite of the usual problem
> of nucleation (I really love how this topic finds new ways to make fun of
> me). In 24-well plates, hanging-drop, for the same condition but in
> different drops I found few big but intergrown crystals and/or a full with
> microcrystals. Sometimes also in the same well, when having more drops.
> I already decreased the concentration to less than 4mg/mL, made small
> adjustments in the optimizations - both with apo and ligand samples, used
> Al's oil.
>
> I have read about the "containerless crystallization" but since I cannot
> obtain the sample myself I would like to know if there are any experiences
> and/or if there are suggestions for solving this problem.
>
> Many thanks!
>
> Best regards,
> Nikolas
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
> Dear Nikolas,
>
> since you have some crystal stock, I would definitely try seeding to
> better control nucleation events in your drops. Then, instead of using the
> containerless approach which requires two types of oils to prepare floating
> drops, I suggest the crystallization in agarose gel. Easy to perform, it
> favors the 3D growth of well separated crystals in ideal convection-less
> conditions. In addition, the gel provides a physical protection of your
> crystals during handling, mounting and cryocooling. For more details, see 
> "Crystal
> growth of proteins, nucleic acids, and viruses in gels. Lorber et al. Prog.
> Biophys. Mol. Biol. (2009), 101: 13-25."
>
> Happy crystallization!
>
> Claude
>
> --
> Dr Claude Sauter
> Institut de Biologie Moléculaire et Cellulaire (IBMC-ARN-CNRS)
> Biologie des ARNt et pathogénicité  tel +33 (0)388 417 102
> 2 allée Conrad Roentgen fax +33 (0)388 602 218
> F-67084 Strasbourg - France  http://cj.sauter.free.fr/xtal
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Optimization from needle shaped crystals

[Patrick Shaw Stewart]

Hi Chitra

Needles usually work very well for making seed stocks for random Microseed
Matrix Screening (MMS).  Your protein probably crystallizes well, but it is
growing too fast in one direction.

MMS has lots of advantages.  If it's going to work it will almost certainly
work within 12 hours.  Also, it allows you to control the number of
crystals per drop by diluting the seed stock.

Another excellent (open-access) paper that gives lots of examples of
seeding, cross-seeding, dilution, optimization etc within a defined set of
fabs is here:

https://scripts.iucr.org/cgi-bin/paper?nj5193


Good luck, Patrick



On Sun, Sep 8, 2019 at 1:46 PM David Briggs 
wrote:

> 4. Matrix microseeding. Make a seed stock from these crystals and then
> re-run your primary screens.
>
> https://www.ncbi.nlm.nih.gov/m/pubmed/25195878/
>
> --
> Dr David C. Briggs
> Senior Laboratory Research Scientist
> Signalling and Structural Biology Lab
> The Francis Crick Institute
> London, UK
> ==
> about.me/david_briggs
>
> --
> *From:* CCP4 bulletin board  on behalf of chitra
> latka 
> *Sent:* Sunday, September 8, 2019 12:12:28 PM
> *To:* CCP4BB@JISCMAIL.AC.UK 
> *Subject:* Re: [ccp4bb] Optimization from needle shaped crystals
>
> I can share what has worked for my crystals :
>
> 1. You can put a grid across your condition with same or altered drop
> ratios.
>
> 2. You can try micro seeding. (This has given me the best results so far).
>
> 3. You can try Hampton's additive screen.
>
> On Sun, Sep 8, 2019 at 10:09 AM Prem Prakash  wrote:
>
>> Dear all,
>> Sorry for a trivial query. I am trying to Co-crystallize my protein with
>> its substrate (peptide) using commercial screenings. In one condition of
>> JCSG plus (Molecular Dimension) that contains  0.2 M Magnesium chloride
>> hexahydrate,  0.1 M Tris 8.5 50 % v/v Ethylene glycol, I got needle like
>> crystals (picture attached). Does anyone have idea to optimize such needles
>> into better crystals. I would appreciate all your suggestions.
>>
>> Thank you
>> With kind regards,
>> Prem Prakash  (Ph.D.)
>>
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>> <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7C9e5bd9b3c9e7485ed8af08d7344ee01c%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C1%7C637035385686224007=635CdZ1OnWv%2BoTW6YrzI%2BJaPg64OrVyWzz7p9HiAt2c%3D=0>
>>
>
>
> --
> Regards
> Chitra
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7C9e5bd9b3c9e7485ed8af08d7344ee01c%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C1%7C637035385686234001=iT7qhIjkuHu1eO%2BqZMthtr4gWL%2B3pI0eYOfJOR0Jm9I%3D=0>
>
> The Francis Crick Institute Limited is a registered charity in England and
> Wales no. 1140062 and a company registered in England and Wales no.
> 06885462, with its registered office at 1 Midland Road London NW1 1AT
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Importance of temperature during initial crystallization screening

[Patrick Shaw Stewart]

Hi Sergei

We did some data-mining on this way, way back, in 2004.

See the second section in this link

https://www.douglas.co.uk/PDB_data.htm


When you consider the *non-standard *temps - ie NOT 4C or 20C - it *looks*
as though the higher-end temps *may *work better.  But of course it's hard
to make sense of the results of a martingale.

Thx Patrick

PS Janet (Newman) do you have anything more up-to-date on this?



On Thu, Aug 1, 2019 at 10:24 AM Sergei Strelkov 
wrote:

> Dear all,
>
>
> I wondered if someone could point me to a recent study on the importance
> of temperature during initial search for crystallization conditions. It
> would be interesting to see any real statistics on this subject.
>
>
> We typically try to perform screening at at two temperatures, such as
> duplicating a given kit screen at 20C and 4C if there is enough sample. My
> 'gut feeling' is that this is not as important as sampling the chemical
> space though.
>
>
> Thank you!
>
> Sergei
>
>
> Prof. Sergei V. Strelkov Laboratory for Biocrystallography Department of 
> Pharmaceutical Sciences, KU Leuven O, Campus Gasthuisberg, Herestraat 49 
> bus 822, 3000 Leuven, Belgium Phone: +32 16 33 08 45, mobile: +32 486 29 41 
> 32 Lab pages: http://pharm.kuleuven.be/Biocrystallography 
> <http://pharm.kuleuven.be/anafar>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

I have regularly been struck by how closely related proteins crystallize in
completely different conditions. Eg see Galina Obmolova and colleagues'
excellent paper (ref below).  A set of sixteen highly homologous Fabs were
crystallized in apparently random conditions.  Roughly half used PEG, half
high-salt conditions, salts used included sulfate (sic!), formate, citrate,
acetate, tartrate, chloride etc etc, while pHs ranged from 4.5 to 9.5.

I also once downloaded the entire PDB and looked for correlations between
the reported crystallization conditions and the (summed) areas of every
atom of every residue on the surface of the proteins.  I came up with . . .
hmm  . . absolutely nothing useful.

I conclude that we need to start with regular screening for pretty much
every new sample that we have - so an unbiased empirical approach is the
only good way to go.

Thx Patrick


Galina ref - Obmolova, G., et al. "Protein crystallization with microseed
matrix screening: application to human germline antibody Fabs." *Acta
Crystallographica Section F: Structural Biology Communications* 70.8
(2014): 1107-1115.



On Tue, 23 Jul 2019, 23:53 Newman, Janet (Manufacturing, Parkville),
 wrote:

> There are a bunch of people doing this – in the small molecule world. And
> a lot of work has been done on some very robust protein systems too. Can
> you guess which ones?
>
>
>
> The real issue (at the moment) is that all the pre-work needed to predict
> if or how a protein might crystallise takes more work and more protein than
> setting up crystallisation experiments.
>
> How many people do DSL on protein in a crystallisation screen, for
> example? Or do self-association chromatography to determine the B22 (which
> changes under different conditions, naturally). Or try mapping out a phase
> diagram (for each condition)?
>
>
>
> Many people are not even aware that a simple PCT can help one work out a
> sensible starting concentration for crystallisation trials.
>
>
>
> As for AI, at the moment unsupervised learning doesn’t seem to do much,
> which means we need vast, well annotated datasets to make progress. MARKO,
> which Sarah mentioned, required half a million scored images, which took
> years to get together.
>
>
>
> Janet
>
>
>
> *From:* CCP4 bulletin board  *On Behalf Of *Keller,
> Jacob
> *Sent:* Wednesday, 24 July 2019 4:18 AM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* Re: [ccp4bb] challenges in structural biology
>
>
>
> What about developing a theory of how crystallization happens, i.e., what
> does the microscopic “picture” look like when crystals are forming, then
> predicting based on that picture? I remember looking into these things
> about ten years ago, and there were some cool things being done with
> various scattering methods and with AFM, but am not sure now what is the
> state of that art.
>
>
>
> It would seem to me that crystallization is the search for intermolecular
> docking sites of sufficiently good (albeit presumably weak) affinity and
> consistent with the formation of a 3D lattice. I wonder what the affinity
> of these sites is, actually—I guess somewhere in the micromolar range,
> based on usual protein concentrations under crystallization conditions (10
> mg/ml of a 40 kD protein is 250 uM).
>
>
>
> Presumably the various docking sites would change affinity based on the
> crystallization conditions, which would explain why some crystallization
> conditions work, others don’t?
>
>
>
> Maybe a systematic look at all crystallization contacts in the PDB might
> yield some insight into crystallization? Maybe it’s already been done?
>
>
>
> JPK
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

I take the view that I'm trying to communicate with as many people as
possible, without distracting them with my spelling . . . So go for US
spellings.

Sent from mobile

On Tue, 23 Jul 2019, 22:39 Goldman, Adrian, 
wrote:

> ..and responding in the same vein:
>
> my OED says that its etymology also comes from the Latin sulfur, sulphura
> in the plural.  So there is an etymological basis for the ph, even if it
> doesn’t come from Greek.
>
> Plus, since when has etymological logic has _anything_ to do with English
> spelling?
>
> Finally, it may be how the RSC is spelling it, but I would take a fair bet
> that writers of English prose today (pace America), contemplating an stinky
> inferno, will write “sulphurous flames”, not the unattractive and less
> stinky “sulfurous ones”.
>
> Adrian
>
>
> On 23 Jul 2019, at 22:21, CCP4BB <
> 193323b1e616-dmarc-requ...@jiscmail.ac.uk> wrote:
>
> Hi
>
> Going off at a tangent...
>
> The accepted spelling by the Royal Society of Chemistry (i.e. the
> professional body representing chemists in the U.K.) since at least the
> early 1990s has been "sulfate" too. "Sulphur", etc, has been deprecated for
> quite some time. Why? Well, there's no good etymological reason for the
> "ph" in "sulphate". My 1984 copy of Greenwood and Earnshaw's "Chemistry of
> the Elements", written in Yorkshire, uses "sulfur" etc throughout.
>
> "Phosphorus" comes from the Greek, so retains the "ph"s on both sides of
> the pond.
>
> Element 13 appears to have started life as "alumium", mutated to
> "aluminum", and finally (in the English speaking world outside North
> America) settled down as "aluminium".
>
> Harry
> --
> Dr Harry Powell
>
> On 23 Jul 2019, at 17:12, Engin Özkan  wrote:
>
> On 7/23/19 3:35 AM, melanie.voll...@diamond.ac.uk wrote:
>
> No longer those 20 odd names for ammonium sulphate
>
>
> You mean ammonium *sulfate*. As it is called across the pond. :)
>
> On a related note on common nomenclature for recording crystallization
> experiments that Janet brought up:
>
> I find it odd that we still do not report cryo-protection methods and
> conditions in PDB depositions. Given that a large fraction of the small
> molecules observed in crystal structures are derived from the
> cryo-protectants, one would think that reporting the contents of that
> solution (and pH) would be paramount to a PDB deposition. Surely, the
> crystallographic experiment has changed since 1990/use of synchrotron
> sources, which PDB has adjusted well to in most other aspects (e.g.,
> including reporting of synchrotron x-ray optics and all the new
> detectors during submission).
>
> Engin
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

On a completely different tack, isn’t the most pressing requirement in
current structural biology a really good method of characterizing
macromolecular samples *before *they are put onto cryoEM grids – ie
analysing *and screening them *in solution.

For one thing I’m told those huge microscopes are quite prone to breaking
down, which makes the queues (lines) to get onto them even longer.

That method might be (micro-scale) DLS – or something completely different.

Thx, Patrick


On Mon, Jul 15, 2019 at 8:44 PM Holton, James M <
270165b9f4cf-dmarc-requ...@jiscmail.ac.uk> wrote:

> Hello folks,
>
> I have the distinct honor of chairing the next Gordon Research
> Conference on Diffraction Methods in Structural Biology (July 26-31
> 2020).  This meeting will focus on the biggest challenges currently
> faced by structural biologists, and I mean actual real-world
> challenges.  As much as possible, these challenges will take the form of
> friendly competitions with defined parameters, data, a scoring system,
> and "winners", to be established along with other unpublished results
> only at the meeting, as is tradition at GRCs.
>
> But what are the principle challenges in biological structure
> determination today?  I of course have my own ideas, but I feel like I'm
> forgetting something.  Obvious choices are:
> 1) getting crystals to diffract better
> 2) building models into low-resolution maps (after failing at #1)
> 3) telling if a ligand is really there or not
> 4) the phase problem (dealing with weak signal, twinning and
> pseudotranslation)
> 5) what does "resolution" really mean?
> 6) why are macromolecular R factors so much higher than small-molecule
> ones?
> 7) what is the best way to process serial crystallography data?
> 8) how should one deal with non-isomorphism in multi-crystal methods?
> 9) what is the "structure" of something that won't sit still?
>
> What am I missing?  Is industry facing different problems than
> academics?  Are there specific challenges facing electron-based
> techniques?  If so, could the combined strength of all the world's
> methods developers solve them?  I'm interested in hearing the voice of
> this community.  On or off-list is fine.
>
> -James Holton
> MAD Scientist
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

 is hard to get, but
> crystallization seems to me like the absolute underdog of the method pool -
> the true 'red headed stepchild' of the methods development funders.
>
> At risk of repeating myself - the other problems (worthy, significant, and
> urgent as they are!) are subservient to the main issue at hand - namely
> that crystallization remains an unpredictable and artful phenomenon while
> literally all other aspects of structure determination process (the gene to
> structure pipeline, whatever you might call it)have made astronomic leaps
> forward.
>
> Artem
> - Cosmic Cats approve of this message
>
>
> On Mon, Jul 15, 2019 at 3:44 PM Holton, James M <
> 270165b9f4cf-dmarc-requ...@jiscmail.ac.uk> wrote:
>
>> Hello folks,
>>
>> I have the distinct honor of chairing the next Gordon Research
>> Conference on Diffraction Methods in Structural Biology (July 26-31
>> 2020).  This meeting will focus on the biggest challenges currently
>> faced by structural biologists, and I mean actual real-world
>> challenges.  As much as possible, these challenges will take the form of
>> friendly competitions with defined parameters, data, a scoring system,
>> and "winners", to be established along with other unpublished results
>> only at the meeting, as is tradition at GRCs.
>>
>> But what are the principle challenges in biological structure
>> determination today?  I of course have my own ideas, but I feel like I'm
>> forgetting something.  Obvious choices are:
>> 1) getting crystals to diffract better
>> 2) building models into low-resolution maps (after failing at #1)
>> 3) telling if a ligand is really there or not
>> 4) the phase problem (dealing with weak signal, twinning and
>> pseudotranslation)
>> 5) what does "resolution" really mean?
>> 6) why are macromolecular R factors so much higher than small-molecule
>> ones?
>> 7) what is the best way to process serial crystallography data?
>> 8) how should one deal with non-isomorphism in multi-crystal methods?
>> 9) what is the "structure" of something that won't sit still?
>>
>> What am I missing?  Is industry facing different problems than
>> academics?  Are there specific challenges facing electron-based
>> techniques?  If so, could the combined strength of all the world's
>> methods developers solve them?  I'm interested in hearing the voice of
>> this community.  On or off-list is fine.
>>
>> -James Holton
>> MAD Scientist
>>
>>
>> 
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Is there any alternative to siliconized glass coverslips for crystallization?

[Patrick Shaw Stewart]

t; >
> > ####
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] crystals that dont diffract :( :(

[Patrick Shaw Stewart]

Hi Careina

Expanding on what Tim says, try crushing your crystals to make a seed
stock, and adding it to a few *random screens - *preferably screens that
you have already tried with this target.

Search for instructions for MMS or rMMS online.

Good luck,

Patrick



On 14 August 2018 at 11:34, Tim Gruene  wrote:

> Dear Careina,
>
> you could use the old crystals, that did not diffract, for microseeding
> to regrew nicer crystals. Once you have them, try to use them as quickly
> as possible. Three weeks can be a long time for crystals.
>
> Storage in liquid nitrogen should not be the problem.
>
> Best,
> Tim
>
>
> On 08/14/2018 11:58 AM, Careina Edgooms wrote:
> > I got the most beautiful crystals I have ever seen and they don't
> > diffract at all. Not poor diffraction, NO diffraction. Anyone know why
> > this could be and how I can go about fixing it? I had three beautiful
> > crystals and not one diffracted. I did leave them in the drop for about
> > 3 weeks before harvesting and in liquid nitrogen for about a month
> > before diffracting. Could that be a factor? If I regrew more beautiful
> > crystals and diffracted straight away could that help?
> > Careina
> >
> > 
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> >
>
> --
> --
> Paul Scherrer Institut
> Tim Gruene
> - persoenlich -
> OSUA/204
> CH-5232 Villigen PSI
> phone: +41 (0)56 310 5297
>
> GPG Key ID = A46BEE1A
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Fishing crystals from volatile solvent as precipitant

[Patrick Shaw Stewart]

Hi Thomas

One problem with conventional approaches is that you tend to get high
mosaicity when harvesting from drops with isopropanol.

A very good method, invented by my old friend Lesley Haire, that has always
worked (so far!) is to use microbatch-under-oil with a plate called the
Vapor Batch plate.

   - Set up the drops with everything in them except for the isopropanol.


   - Cover the drops with 50:50 paraffin and silicone oil ("Al's Oil").


   - Put a few mL of 27% isopropanol in the "moat" around the outside of
   the plate.


The isopropanol will saturate the oil and then diffuse into the drops.  You
can take your time and harvest the crystals through the oil. The oil
protects the crystals, preventing evaporation of isopropanol.

Let me know if you (or anyone) would like some sample plates to try this
out.

See example and ref. below.

Best wishes, Patrick

___


Example: https://www.douglas.co.uk/winner1.htm

*G. B. Mortuza et al.. High-resolution structure of a retroviral capsid
hexameric amino-terminal domain.  Nature 431 (2004), pp 481-485. (This
paper describes the use of the vapor batch plate with isopropanol.)*

Sent from mobile

Patrick Shaw Stewart
+44 7901 548 201

On Wed, 15 Aug 2018, 08:41 Yvonne Thielmann,  wrote:

> Dear Thomas,
>
> maybe you can try to overlay your drop with LV CryoOil from Jena
> Bioscience. Then the evaporation of the solvent is slowed down and the
> crystals are directly cryoprotected when you move the crystals through
> the oil. We had quite good results when we cryoprotected crystals in
> this oil.
>
> Best wishes,
> Yvonne
>
>
> --
> Dr. Yvonne Thielmann
> Max Planck Institute of Biophysics
> Molecular Membrane Biology
> Max-von-Laue-Strasse 3
> 60438 Frankfurt / Main
> Germany
>
> Office +49 69 6303 1056
> Lab +49 69 6303 1074
> Fax +49 69 6303 1002
>
> Am 15.08.2018 um 08:05 schrieb Kajander, Tommi A:
> > Yes sorry, i meant paratone-N also.
> >
> > Tommi
> >
> > Kohteesta: ferrer
> > Lähetetty: keskiviikko 15. elokuuta klo 0.41
> > Aihe: Re: [ccp4bb] Fishing crystals from volatile solvent as precipitant
> > Vastaanottaja: ccp4bb@jiscmail.ac.uk
> >
> >
> > Dear Thomas,
> >
> > Alternatively you can try shooting on crystals in the drop, in situ. So
> > fishing, no cryo. But potentially high radiation damage. Can be
> > considered if you have enough crystals, and if your crystallization
> > plate makes it possible.
> >
> > Regards
> >
> > JL
> >
> > On 14/08/2018 20:58, Thomas Krey wrote:
> > Dear crystallization experts,
> >
> > We have 3D protein crystals grown from a microseed matrix screening
> > vapor diffusion experiment in either
> >
> > 15% (v/v) Reagent alcohol
> > HEPES Na pH 7.5
> > 0.2 M MgCl2
> >
> > or in
> >
> > 27% Isopropanol
> > 0.18 M MgCl2
> > 90 mM HEPES Na pH 7.5
> > 10% Glycerol
> >
> > Upon opening the corresponding wells these crystals move quite a bit –
> > presumably due to the volatility of the alcohols. Does anyone have a
> > good suggestion to stabilize the swirling movements? Does anyone have
> > experience, whether these conditions alone can serve as cryo-protectant
> > (i.e., do we really have to fish, move into cryo solution and fish
> again)?
> > Any suggestion or input would be highly welcome.
> >
> > Thank you very much in advance.
> >
> > Thomas
> >
> >
> > Prof. Dr. Thomas Krey
> > Hannover Medical School
> > Institute of Virology
> > Structural Virology Group
> > Carl-Neuberg-Str. 1
> > D-30625 Hannover
> > phone: +49 (0) 511 - 532 4308
> > email: krey.tho...@mh-hannover.de <mailto:krey.tho...@mh-hannover.de>
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> >
> > --  Jean-Luc Ferrer Institut de
> Biologie
> > Structurale 71 Avenue des Martyrs CS 10090 38044 Grenoble Cedex 9 -
> > FRANCE Ph.: +33 (0)4 57 42 85 22 Cell: +33 (0)6 89 45 13 57 email:
> > jean-luc.fer...@ibs.fr <mailto:jean-luc.fer...@ibs.fr>
> > 
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> >
> >
> >
> > 
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> >
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Please share your experience about "ugly" crystals showing good diffraction

[Patrick Shaw Stewart]

Hi All

I have a comment, based on my old supervisor's explanation, which seemed to
make sense.

Crystals usually grow layer by layer.  Once a new layer is formed it
quickly expands to cover the whole surface.  That's why crystals normally
have flat surfaces and sharp edges - the layers/steps expand rapidly until
they get to the edges.

However it doesn't have to be like that.  Sometimes new layers can form
roughly as quickly as the previous layers can spread.  The result is
crystals with curved surfaces - or even just blobs.

Just because the new layers form at a rate that is comparable to the
spreading doesn't mean that the crystals won't be ordered, and won't
diffract well.

Once I understood that I understood what I was seeing better when I checked
my drops.

Best wishes Patrick


On 5 July 2018 at 22:06, Sanishvili, Ruslan  wrote:

> Hi Anirban,
>
> It would be great if you could share the compilation of relevant responses
> to your request. I think many others in the community could use these
> examples for educational purposes.
>
> Best,
>
> Nukri
>
>
> Ruslan Sanishvili (Nukri), Ph.D.
> Macromolecular Crystallographer
> GM/CA@APS
> X-ray Science Division, ANL
> 9700 S. Cass Ave.
> Lemont, IL 60439
>
> Tel: (630)252-0665
> Fax: (630)252-0667
> rsanishv...@anl.gov
>
>
>
> --
> *From:* CCP4 bulletin board  on behalf of Anirban
> Banerjee 
> *Sent:* Thursday, June 28, 2018 7:07 PM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] Please share your experience about "ugly" crystals
> showing good diffraction
>
>
> Dear all,
>
> Apologies for the non-CCP4 related question.
>
> If you have concrete experience about visually unappealing, i.e. ugly
> crystals ( your own take on ugly is fine)  diffracting better than
> comparably similar sized nicer looking crystals of the same protein, will
> you please share here ? Even better if that led to a published structure.
> Might you also have pictures ?
>
> We have all heard anecdotes about not using visual appearance to judge the
> quality of crystals as far as their ability to give good diffraction data
> is concerned but I am trying to gather some concrete pointers here to
> motivate trainees.
>
> Thanks very much for any help.
>
> Best,
>
> Anirban
>
> P.S. I know that there is probably a lot of thought and wisdom  on this
> this specific topic but I am really looking for actual experience.
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Oxford University Press

[Patrick Shaw Stewart]

evier is the place to start as their profit
> margins are like those of Apple, and of competition there is none.
>
>
> Elsevier: Like Apple, but without the design sense.
>
>
> But seriously, Adrian makes an excellent point. And the large profit
> margins wouldn’t be quite so galling, if only the publishers were able to
> provide competent and helpful administrative support; but in my recent
> experience, not-for-profit scientific society journals are actually
> providing better experiences for reviewers and authors than the big
> commercial ones.
>
> Pat
>
> 
> ---
>
> Patrick J. Loll, Ph. D.
>
> Professor of Biochemistry & Molecular Biology
>
> Drexel University College of Medicine
>
> Room 10-102 New College Building
>
> 245 N. 15th St
> <https://maps.google.com/?q=245+N.+15th+St=gmail=g>.,
> Mailstop 497
>
> Philadelphia, PA  19102-1192  USA
>
>
> (215) 762-7706
>
> pjl...@gmail.com
>
> pj...@drexel.edu
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>
>
>
> --
> Prof. George M. Sheldrick FRS
> Dept. Structural Chemistry,
> University of Goettingen,
> Tammannstr. 4,
> D37077 Goettingen, Germany
> Tel. +49-551-39-33021 or +49-5594-227312
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Anderson?Evans polyoxotungstate (TEW)

[Patrick Shaw Stewart]

I notice that Molecular Dimensions offers a similar compound

https://www.moleculardimensions.com/shopcontent.asp?type=crystallophoreno1


Are there any others?



On 30 March 2018 at 19:24, Nikolay Dobrev <
nikolay.dob...@bzh.uni-heidelberg.de> wrote:

> Dear all,
> I apologize for my off-topic question.
> I want to ask if anyone has so far used the Anderson-Evans
> polyoxotungstate (https://www.jenabioscience.co
> m/crystallography-cryo-em/screening/xp-screen/x-tew-anderson
> -evans-polyoxotungstate).
> Did someone see an improvement in crystal quality/diffraction?
> Any comments will be highly appreciated.
>
> Nikolay Dobrev
>
>
> 
> Nikolay Dobrev
> PhD Student in AG Sinning & AG Fischer
> Biochemie Zentrum
> Heidelberg University
> Im Neuenheimer Feld 328
> 69120 Heidelberg
> Germany
> Phone: +49 6221 54 4796
> Email: <nikolay.dob...@bzh.uni-heidelberg.de
> 
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] suggestions on a microscope for Crystallography

[Patrick Shaw Stewart]

Hi Chandra

My only comment is be careful of modern microscopes that have a frosted
glass screen with LEDs behind it, just below the plate.  For looking at
crystals you need *directional *light.  I've seen some very expensive
modern microscopes with illumination that just doesn't work for
crystallization.  If I come across that situation I normally make a
platform and raise the plate up by a few inches - it can dramatically
improve the quality of images.  You can also cut a round hole in e.g. a
piece of aluminium foil and use it to make the area of the light source
smaller.

On the other hand illumination mustn't be *too *directional because the
drop itself acts as a lens.  If you have a light source that is small and
too far from the sample you'll get black regions around the outside of the
drop where you can't see crystals.

It's all about the solid angle of the light hitting the sample - I'm sure
others can explain better than I can.

Good luck, Patrick


On 7 March 2018 at 02:06, Chandramohan Kattamuri <
1c5b7cb6c764-dmarc-requ...@jiscmail.ac.uk> wrote:

> Hi
>
> I'm looking for suggestions on a good microscope for looking at crystals,
> which includes polarization, light source (fiber optics), crosshairs and
> camera mount.  What Models and make?
>
> Thanks in advance
>
> Chandra
>
>
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Na-Binding Protein?

[Patrick Shaw Stewart]

That's very interesting.  I guess it's an unusual manifestation of the
Hofmeister series.

It might give guidance to developers of screens for both crystallization
and cryoEM.

Thx, Patrick


On 9 January 2018 at 15:44, Andrew Mesecar <amese...@purdue.edu> wrote:

> Dear Jacob,
>
>
>
> One of my favorite examples of monovalent cation discrimination is by the
> enzyme Pyruvate Kinase.  It prefers K(+), NH4(+), Rb(+) and Tl+ for maximum
> catalysis and then activity falls off as the monovalent cation sizes get
> larger, Cs(+) or smaller Na(+) >> Li (+).  The conformations of pyruvate
> kinase are known to be altered by binding of monovalent cations and it has
> been studied for over 50 years by a variety of approaches.  A number of the
> X-ray structures are with K(+).  I spent a few years of my life studying
> this enzyme a couple of decades ago.  It will hopefully provide some
> information for your project.
>
>
>
> Best of luck,
>
>
>
> Andy Mesecar
>
> On Tue, Jan 9, 2018 at 9:42 AM, Keller, Jacob <kell...@janelia.hhmi.org>
> wrote:
>
>> Dear Crystallographers,
>>
>>
>>
>> Is anyone aware of a soluble protein which changes large-scale
>> conformation +/- Na+, and is specific for Na+ per se, or at least ignores
>> K+ and Ca++? E.g., Rb+ or Li+ might be okay. Structural info would be a
>> plus, but not a sine qua non.
>>
>>
>>
>> Similarly, what about with K+ or Cl- specificities, but oblivious to
>> similar common ions?
>>
>>
>>
>> All the best,
>>
>>
>>
>> Jacob Keller
>>
>>
>>
>> +
>>
>> Jacob Pearson Keller
>>
>> Research Scientist / Looger Lab
>>
>> HHMI Janelia Research Campus
>>
>> 19700 Helix Dr, Ashburn, VA 20147
>> <https://maps.google.com/?q=19700+Helix+Dr,+Ashburn,+VA+20147=gmail=g>
>>
>> (571)209-4000 x3159 <(571)%20209-4000>
>>
>> +
>>
>>
>>
>> The content of this email is confidential and intended for the recipient
>> specified in message only. It is strictly forbidden to share any part of
>> this message with any third party, without a written consent of the sender.
>> If you received this message by mistake, please reply to this message and
>> follow with its deletion, so that we can ensure such a mistake does not
>> occur in the future.
>>
>>
>>
>
>
>
> --
> *Andrew D. Mesecar*
> Head, Department of Biochemistry
> Walther Professor of Cancer Structural Biology
> Deputy Director, Purdue Center for Cancer Research
> E-Mail: amese...@purdue.edu
> _
> *Department of Biochemistry Contact Information:*
> 175 S. University Street
> <https://maps.google.com/?q=175+S.+University+StreetW.+Lafayette,+IN+47907=gmail=g>
> W. Lafayette, IN 47907
> <https://maps.google.com/?q=175+S.+University+StreetW.+Lafayette,+IN+47907=gmail=g>
> -2063
> 765-494-1607
> --
> *Research Lab Contact Information:*
> Hockmeyer Hall of Structural Biology
> Room 311
> <https://maps.google.com/?q=311+240+S.+Martin+Jischke+Drive+West+Lafayette,+IN+47907=gmail=g>
> 240 S. Martin Jischke Drive
> <https://maps.google.com/?q=311+240+S.+Martin+Jischke+Drive+West+Lafayette,+IN+47907=gmail=g>
> West Lafayette, IN 47907
> <https://maps.google.com/?q=311+240+S.+Martin+Jischke+Drive+West+Lafayette,+IN+47907=gmail=g>
> -1971
> 765-494-1924
> _
>
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Regarding Patents

[Patrick Shaw Stewart]

There are some interesting anti-patent initiatives

https://en.wikipedia.org/wiki/Patent#Anti-patent_initiatives


including prizes as an alternative to patents

https://en.wikipedia.org/wiki/Prizes_as_an_alternative_to_patents#Other_areas_for_prize_models_over_patents



On 4 November 2017 at 15:08, Bernhard Rupp <hofkristall...@gmail.com> wrote:

> > to publish it so the world can benefit from it.
>
> Isn’t that exactly the idea of a patent? Instead of keeping the invention
>
> a trade secret (occasionally a viable alternative) you publish the
> invention,
>
> and the inventor (and in general, the supporting institutions) can get
>
> rewarded if someone plans to use the idea commercially. Someone
>
> (in academia often the tax payer) did pay for the work after all, and
> having
>
> an option to recover the money (or god forbid, make a profit…) seems
>
> a reasonable proposition….
>
>
>
> Best, BR
>
>
>
> *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of 
> *Abhishek
> Anan
> *Sent:* Saturday, November 4, 2017 05:31
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* Re: [ccp4bb] Regarding Patents
>
>
>
> I second Gert's thoughts
>
> Best,
>
> Abhishek
>
>
>
> On Sat, Nov 4, 2017 at 10:21 AM, Gert Vriend <gerrit.vri...@radboudumc.nl>
> wrote:
>
> A related question. If you have a crystal structure and found a novel
> ligand binding site that can be used to regulate protein activity, could
> you patent such "binding site"? If not, how to make the best use of such
> findings?
>
>
> I would say that the best one can do with important novel
> data/information/knowledge/insights is to publish it so the world can
> benefit from it.
>
> Gert
>
>
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] crystallization optimization

[Patrick Shaw Stewart]

Oii1OALADi7UtKkI_mrwwLYA4QugHgmtOUOK5Mw1HMEYTM0eLrh1UB5KlzbR1gdvNDPZRm1oDPNOSmHAOma5Mdveve6ZlC5WH6mgCC5qcLQd_xWchIlNmFOVWl0_LVlkIZxPEbwqt58Rj4K7aTJtr9yEI6PJ5njvoBPKMTo4XRqpLcm6BTWwlUxXiR1lz4f5CR8PWDaB6APo_1xcZzogykGtw4prvYZyqr3_Xe6jlmQ%3D%3D=http%3A%2F%2Flcrbw.pharmacie.univ-paris5.fr%2Fspip.php%3Farticle18>
> --
>
>
>
>
> --
>
> *De :* Patrick Shaw Stewart <patr...@douglas.co.uk>
> *À :* CCP4BB@JISCMAIL.AC.UK
> *Envoyé le :* Mercredi 12 juillet 2017 17h28
> *Objet :* Re: [ccp4bb] crystallization optimization
>
>
>
>
>
> Alun
>
>
>
> I agree Frank's point is very interesting - and he intriguingly refers us
> to the phase diagram.
>
>
>
> Is the point that Line A is longer than Line B ?
>
>
>
> Best wishes
>
>
>
> Patrick
>
>
>
>
>
>
>
>
>
> [image: Inline images 2]
>
>
>
>
>
>
>
>
>
>
>
>
>
> On 12 July 2017 at 14:40, Alun R Coker <alun.co...@ucl.ac.uk> wrote:
>
> Hi Everyone,
>
> Franks point is really interesting. We routinely reduce the protein
> concentration when we see too many precipitated wells, but we never dilute
> the screen. Has anyone tried this?
>
> All the best,
>
> Alun
>
>
>
> On 12/07/17 08:48, Frank von Delft wrote:
>
> The point I was failing to make:  reducing either protein or precipitant
> concentration will indeed reduce nucleation, but often won't get you bigger
> or more single crystals:  it will just make the appearance of crystals less
> reliable.
>
> The way to get big single reliable crystals is to *increase* protein and
> *greatly* reduce precipitant.
>
> (Even better:  do seeding.  Like Vicky said.  Incredible how often people
> don't bother to do seeding, yet it solves so many problems.)
>
> phx
>
>
>
> On 12/07/2017 07:50, Vicky Tsirkone wrote:
>
> Dear Frank,
>
>
>
> I may see in the attached pic several nucleation points and a considerable
> amount of microcrystals. Based to my knowledge decreasing the concentration
> of the precipitant and/or the protein concentration would be a reasonable
> approach to refine the initial hits.
>
> By checking the diagram as you correctly mentioned you may see that the
> fine tuning of protein and precipitant concetration may lead to the
> desirable result without reaching the precipitation zone.
>
>
>
> Patrick just check your screens. Just a rule of thumb, if you see
> precipitation in the ~60% of your drops then you should definitely reduce
> the protein concentration.
>
>
>
> ps dont forget to try the *streak seeding*, as well.
>
>
>
> Have a nice day and again good luck.
>
>
>
> Vicky
>
>
>
> On Wed, Jul 12, 2017 at 8:50 AM, Frank von Delft <
> frank.vonde...@sgc.ox.ac.uk> wrote:
>
> Actually, you should try *increasing* the protein concentration - a lot.
> But be prepared to drop the precipitant concentration to almost nothing (1
> or 2% isn't "low").
>
> To understand why, look at the phase diagram and what we assume about
> vapour diffusion.  (Which I'm assuming is what you're doing.)
>
>
>
> On 12/07/2017 06:28, Vicky Tsirkone wrote:
>
> Dear Patrick,
>
>
>
> You may reduce the protein concentation, as well.
>
> Another option could be the *streak seeding* by exploiting the drop of
> your initial condition.
>
>
>
> Good luck,
>
>
>
> V.T.
>
>
>
> On Mon, Jul 10, 2017 at 7:17 PM, Patrick Shaw Stewart <
> patr...@douglas.co.uk> wrote:
>
>
>
> Microseed them into two or three random screens.
>
>
>
> Search for MMS and rMMS online.
>
>
>
> Good luck
>
>
>
> Patrick
>
>
>
>
>
>
>
>
>
> On 10 July 2017 at 15:47, Liuqing Chen <519198...@163.com> wrote:
>
> hello everyone!
> I get a condition (10% w/v PEG 6000, 100mm HEPES PH7.0) in which my
> protein grow small  needle like crystals, how can i optimize it to get
> bigger crystals?  the attach is the crystals  figure.
> thanks in advance
> sincerely
> Liuqing Chen
>
>
>
>
>
> --
>
>  patr...@douglas.co.ukDouglas Instruments Ltd.
>  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
>  Directors: Peter Baldock, Patrick Shaw Stewart
>
>  http://www.douglas.co.uk
> <https://clicktime.symantec.com/a/1/25dI3WrmU_REz0R2AqEuuVcDP3s_fHPB3ls19C25QnM=?d=ydHuK2RzVboI0S1f0-VMFO47v0jLw-bGOuPIOXlvgxVovpKjpVbqlqHHe92eD9EXP1yEiYalPcDJ38NT0DPj0JHU1ay-7q9vqP6cG6Jh_Y2NFwbuGut6uA1GqbEf11-ROhtHIifuMGSuiUO4Yxf9ZKoKqiIJZmSrtwlOii1OALADi7UtKkI_mrwwLYA4QugHgmtOUOK5Mw1HMEYTM0eLrh1UB5KlzbR1gdvNDPZRm1oDPNOSmHAOma5Mdveve6ZlC5WH6mgC

Re: [ccp4bb] Granada Crystallization Boxes?

[Patrick Shaw Stewart]

Gloria, would you be interested in used ones?  I don't actually have any -
we threw them out a few months ago, I've just checked - but someone might
have some.

Best wishes, Patrick


On 11 July 2017 at 19:04, Gloria Borgstahl <gborgst...@gmail.com> wrote:

> I have recently found out that these are no longer being manufactured or
> sold commercially.  But, as fortune has it, we have just been funded to fly
> some large quartz capillaries crystallization experimente up to the
> International Space Station for neutron crystallography.  Our experimental
> design is to fly the experiments in the Granada Crystallation Boxes!  NASA
> has already approved the 3x10x0.5 cm plastic Granada boxes for flights.
> Does anyone have any in their lab supplies that they do not plan to use?
> We would be willing to buy them from you!  Thanks, Gloria
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] crystallization optimization

[Patrick Shaw Stewart]

Vicky, streak seeding is a very good method, but it can be quite a lot of
work.  Before he tries that, why wouldn't we suggest to Liuqing that he
should try MMS - that is, adding a liquid seed stock to random screens?
That way he is likely to end up with seeds in wells with similar conditions
that happen to be in the metastable zone of the phase diagram, and also
with seeds in *completely unrelated conditions *that are also in the
metastable zone.  That way you can cast your net very wide.

One simple experiment does so much - it is also an additive experiment : )
 Part of the art of crystallization is to try lots of things without
thinking too much.

Patrick




On 12 July 2017 at 07:50, Vicky Tsirkone <vtsirk...@gmail.com> wrote:

> Dear Frank,
>
> I may see in the attached pic several nucleation points and a considerable
> amount of microcrystals. Based to my knowledge decreasing the concentration
> of the precipitant and/or the protein concentration would be a reasonable
> approach to refine the initial hits.
> By checking the diagram as you correctly mentioned you may see that the
> fine tuning of protein and precipitant concetration may lead to the
> desirable result without reaching the precipitation zone.
>
> Patrick just check your screens. Just a rule of thumb, if you see
> precipitation in the ~60% of your drops then you should definitely reduce
> the protein concentration.
>
> ps dont forget to try the *streak seeding*, as well.
>
> Have a nice day and again good luck.
>
> Vicky
>
> On Wed, Jul 12, 2017 at 8:50 AM, Frank von Delft <
> frank.vonde...@sgc.ox.ac.uk> wrote:
>
>> Actually, you should try *increasing* the protein concentration - a
>> lot.  But be prepared to drop the precipitant concentration to almost
>> nothing (1 or 2% isn't "low").
>>
>> To understand why, look at the phase diagram and what we assume about
>> vapour diffusion.  (Which I'm assuming is what you're doing.)
>>
>>
>> On 12/07/2017 06:28, Vicky Tsirkone wrote:
>>
>> Dear Patrick,
>>
>> You may reduce the protein concentation, as well.
>> Another option could be the *streak seeding* by exploiting the drop of
>> your initial condition.
>>
>> Good luck,
>>
>> V.T.
>>
>> On Mon, Jul 10, 2017 at 7:17 PM, Patrick Shaw Stewart <
>> patr...@douglas.co.uk> wrote:
>>
>>>
>>> Microseed them into two or three random screens.
>>>
>>> Search for MMS and rMMS online.
>>>
>>> Good luck
>>>
>>> Patrick
>>>
>>>
>>>
>>>
>>> On 10 July 2017 at 15:47, Liuqing Chen <519198...@163.com> wrote:
>>>
>>>> hello everyone!
>>>> I get a condition (10% w/v PEG 6000, 100mm HEPES PH7.0) in which my
>>>> protein grow small  needle like crystals, how can i optimize it to get
>>>> bigger crystals?  the attach is the crystals  figure.
>>>> thanks in advance
>>>> sincerely
>>>> Liuqing Chen
>>>>
>>>
>>>
>>>
>>> --
>>>  patr...@douglas.co.ukDouglas Instruments Ltd.
>>>  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
>>>  Directors: Peter Baldock, Patrick Shaw Stewart
>>>
>>>  http://www.douglas.co.uk
>>>  Tel: 44 (0) 148-864-9090 <01488%20649090>US toll-free
>>> 1-877-225-2034 <%28877%29%20225-2034>
>>>  Regd. England 2177994, VAT Reg. GB 480 7371 36
>>>
>>
>>
>>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] crystallization optimization

[Patrick Shaw Stewart]

Microseed them into two or three random screens.

Search for MMS and rMMS online.

Good luck

Patrick




On 10 July 2017 at 15:47, Liuqing Chen <519198...@163.com> wrote:

> hello everyone!
> I get a condition (10% w/v PEG 6000, 100mm HEPES PH7.0) in which my
> protein grow small  needle like crystals, how can i optimize it to get
> bigger crystals?  the attach is the crystals  figure.
> thanks in advance
> sincerely
> Liuqing Chen
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein or DNA crystals

[Patrick Shaw Stewart]

We have sometimes used Michael Garavito's excellent suggestion of diffusing
glutaraldehyde into the drops - mentioned on this board a few days ago.
Our protein crystals either turned brown or turned into brown goo.

Michael and others, what effect would you expect glutaraldehyde to have on
DNA crystals?

Patrick


On 19 June 2017 at 15:20, Joseph Ho <sbddintai...@gmail.com> wrote:

> Dear all:
>
> I would like to seek your opinion on our crystal hits. We are working
> on protein/dsDNA complex. By changing different protein and DNA
> (14-22bp) constructs, we recently got some hits from commercial
> screens using sitting drop vapor diffusion (very small xtals). The
> precipitant is PEG and the picture of crystals are attached. In this
> particular condition, it is 30%PEG3350, sodium succinate pH5.5 and
> 100mM NaCl. The crystal seems floating and sit in the bottom. We do
> some test shot from other conditions and it is not salt crystals. The
> crystals can suck in izit dye.  I do some google and it seems izit dye
> also turns dsDNA crystal into blue. We also do UV/Vis microscope but
> no Trp fluorescence (6 Trp in 256 aa). It may due to low Trp.
>
> This is our first time to work on protein/DNA complex crystals and we
> are not certain if this is just DNA or protein/DNA crystals. Can you
> provide your comments on our hits?
>
> Thank you for your help
>
> Joseph
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] crystallization screen for protein-protein complex

[Patrick Shaw Stewart]

Hena

There was a very interesting paper by Peter Sun and coworker from 2002.
They pointed out that there is a very strong bias towards crystallizing
protein-protein complexes with PEG rather than salt as the main precipitant.

Patrick

___

Radaev and Sun.  Crystallization of protein-protein complexes. J. Appl.
Cryst. (2002). 35, 674-676





On 20 May 2017 at 22:14, Hena Dutta <hdutt...@gmail.com> wrote:
>
> Dear Members,
> I am trying to crystallize a protein-protein complex. Both are soluble
proteins and form complex as observed in FPLC either co-purifying or
separately purifying and then mixing with equi-molar ratio.
> Looking for suggested screens to try for crystallization.
>
> So far tried with Qiagen - ProComplex Suite, Classics Suite and Classics
II Suite
> No success yet.
>
> Is there any guidance which screen to try?
>
> Looking for your help...
> Regards,
> Hena.




--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Slightly OT: crystallization teaching resources for kids

[Patrick Shaw Stewart]

Yes, but the kids will want to know WHY there is an energy barrier.

I prefer my explanation below.

Happy New Year to all

Patrick
_

> I am especially needing help with the concept of nucleation, and why
nucleation is slower and then crystal growth faster once nuclei have
formed.

I always explain this by pointing out that, when the crystal is very small,
each new molecule that lands on the surface of the nascent crystal can only
be attached on one or two sides.  When the crystal is larger, molecules
that land are more likely to become attached on two, three or more sides.

Atomic force microscopy images of "islands" that appear on the faces of
crystals are also helpful.  Islands are more likely to appear on larger
faces.  Once they appear they can rapidly spread to the edges of the
crystal, which is (one mechanism explaining) why crystals have flat faces.





On 4 January 2017 at 16:45, Nicolas FOOS <nicolas.f...@esrf.fr> wrote:

> Dear Evette,
>
> If I was is your situation (explaining nucleation and other concept). I
> will discuss in terms of energy.
>
> I mean obtaining the initial nuclei is the "costly" step in terms of
> energy. To represent that, out the classical curve of energy, I will use a
> metaphoric representation such as jump over a barrier and run after.
>
> With this analogy, it's possible to explain that the first step is
> difficult and the second more accessible. If the barrier is to high, it's
> impossible to continue and run. If you don't have any barrier it's easy to
> run and if you only have a small barrier is not to difficult to jump over
> and run. But It also allow you to explain that if you facilitate the
> apparition of the first "surface" thanks to appropriate method (seeding,
> dust...) you can help the first step (to continue with the barrier story,
> it like you have ladder to help, or the ability to decrease the size of the
> barrier.
>
> For why the crystal and how, I will maybe use the example of orange
> pyramid in the food store. Orange are stable together because they have
> enough contact, because they have relatively homogeneous shape. If you
> mixed orange with water melon it's difficult to obtain nice pyramid.
>
> For crystallization experiment which work, I have no Idea out of the one
> you already mentioned.
>
>
> Hope this help.
>
> Nicolas
>
> Nicolas Foos
> PhD
> Structural Biology Group
> European Synchrotron Radiation Facility (E.S.R.F)
> 71, avenue des Martyrs
> CS 40220
> 38043 GRENOBLE Cedex 9+33 (0)6 76 88 14 87 <+33%206%2076%2088%2014%2087>+33 
> (0)4 76 88 45 19 <+33%204%2076%2088%2045%2019>
>
> On 30/12/2016 11:06, Radisky, Evette S., Ph.D. wrote:
>
> Can anyone point to some especially useful resources to help explain to
> kids (pre-chemistry, ~age 10-12) how and why molecules crystallize? Maybe a
> good online movie or animation?  I am especially needing help with the
> concept of nucleation, and why nucleation is slower and then crystal growth
> faster once nuclei have formed.  I have been supervising some experiments
> growing sucrose crystals from supersaturated solutions, which have worked
> really well, but I am having more difficulty in explaining the underlying
> fundamental concepts in a way that is understandable to the kids.
>
> Thanks!
> Evette
>
> Evette Radisky, PhD
>
> Associate Professor of Cancer Biology
>
> Mayo Clinic Cancer Center
>
> Griffin Cancer Research Building
>
> 4500 San Pablo Road
>
> Jacksonville, FL 32224
>
> tel: 904-953-6372
>
> fax: 904-953-0277
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Crystals grow at the bottom of the tube.

[Patrick Shaw Stewart]

Hi Lingyuan

I would certainly make a seed stock and use it with RANDOM screens - this
will (usually) allow you to pick up new conditions and control the number
of crystals per drop.

However you say your crystals melt easily when you harvest them.  I don't
know how David stabilized his seedstock (if he did) but you may be able to
stabilize yours with a precipitant.

In all the cases that we looked at we found that if you soaked uncrushed
crystals in a precipitant (or cocktail) and the crystals were unchanged
after 24 hours, then the precipitant/cocktail could be used to make a
seedstock.

In practice 100% PEG 600 worked for 5 of the 6 model proteins that we
looked at.  The remaining seedstock worked with seed crystals suspended in
4M amm. sulfate.

I hope it works for you.

Best wishes, Patrick


___


Ref for stabilizing seed stocks with various precipitants:

Shaw Stewart, P.D., Kolek, S.A., Briggs, R.A., Chayen, N.E. and Baldock,
P.F., 2011. Random microseeding: a theoretical and practical exploration of
seed stability and seeding techniques for successful protein
crystallization.*Crystal Growth & Design*, *11*(8), pp.3432-3441.



Ref for random microseeding:

D'Arcy A, Villard F, Marsh M. An automated microseed matrix-screening
method for protein crystallization. Acta Crystallographica Section D:
Biological Crystallography. 2007 Apr 1;63(4):550-4.





On 19 October 2016 at 15:20, Hargreaves, David <
david.hargrea...@astrazeneca.com> wrote:

> I have been presented with crystals grown in nmr tubes on two separate
> occasions. Both diffracted very well and thankfully, neither required a
> magnetic field for optimisation. On the first occasion I did use the
> initial sample as a seed stock.
>
>
>
> Best wishes,
>
>
>
> David
>
>
>
> *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of *
> kiki
> *Sent:* 18 October 2016 11:42
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] Crystals grow at the bottom of the tube.
>
>
>
> Dear all users,
>
>
>
>  I got my crystals at the bottom of the tube on ice just before I started
> to screen crystals. Those crystals' shapes were good but easy to melt when
> I harvested them. I shot these crystals. They only diffracted to 7A to 8A.
> Has anyone ever met this situation before? How to improve?
>
>
>
> Thanks,
>
> Lingyuan
> --
>
> AstraZeneca UK Limited is a company incorporated in England and Wales with
> registered number:03674842 and its registered office at 1 Francis Crick
> Avenue, Cambridge Biomedical Campus, Cambridge, CB2 0AA.
>
> This e-mail and its attachments are intended for the above named recipient
> only and may contain confidential and privileged information. If they have
> come to you in error, you must not copy or show them to anyone; instead,
> please reply to this e-mail, highlighting the error to the sender and then
> immediately delete the message. For information about how AstraZeneca UK
> Limited and its affiliates may process information, personal data and
> monitor communications, please see our privacy notice at
> www.astrazeneca.com
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] handling crystals in volatile solvents

[Patrick Shaw Stewart]

Hi Len

In every case that I know of this problem has been solved by working under
oil.  The oil becomes saturated with the volatiles, and it prevents
crystals from doing backstroke, breaststroke or front crawl during
harvesting.

The most convenient way to get going is to dispense the wells without the
volatile solvents, then allow solvents to difuse through the oil and into
the drops.  We suggest our old Vapor Batch plates, and you should place the
same concentration of the solvent that you want in the drops into the large
moat around the plate.  If you put in higher concentrations you may
dehydrate your drops :-(

A very nice feature is that you can set up e.g. a random screen, then try
soaking in one or more volatile solvents if nothing grows in the first
round.

The approach was invented by Lesley Haire, and you can find her
presentation at

http://www.douglas.co.uk/winner1.htm



See also

Mortuza, Gulnahar B., et al. High-resolution structure of a retroviral
capsid hexameric
amino-terminal domain. *Nature* 431.7007 (2004): 481-485.



The plates look like this:

http://www.douglas.co.uk/products.htm#Vapor Batch Plates



We'll send you some sample plates to try.

Best wishes,

Patrick



On 12 June 2015 at 22:11, Thomas, Leonard M. lmtho...@ou.edu wrote:

 Hi All,

 We have gotten some very nicely formed crystals out of a couple of
 different volatile solvents recently.  Besides looking for something easier
 to work in does anybody have any tips on handling crystals from these types
 of solvents.  It is very hard to loop a crystal while it is doing the
 backstroke in the well with all of its buddies.

 Thanks in advance.
 Len

 Leonard M. Thomas Ph.D.
 Macromolecular Crystallography Laboratory Manager
 University of Oklahoma
 Department of Chemistry and Biochemistry
 Stephenson Life Sciences Research Center
 101 Stephenson Parkway
 Norman, OK 73019
 405-325-1126
 lmtho...@ou.edu
 http://barlywine.chem.ou.edu
 http://structuralbiology.ou.edu




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Choice of stereomicroscope

[Patrick Shaw Stewart]

Ronnie

I see a lot of cheap and expensive microscopes, and I notice that expensive
is not always better for protein crystallization.

Almost the most important thing is that illumination comes from *one
particular direction*.  Often this means that the light source is small and
far from the sample stage.  What does not work well is to have a large
light source (eg multiple LEDs, large white screen, mirror or sintered
transparent sheet) that is close to the sample - even with the best optics
in the world, you won't see crystals well.

Dark ground (see only scattered light) and ordinary transmission mode can
both work well - good to have both if possible.

Good luck,

Patrick




On 27 March 2015 at 13:08, Ronnie Berntsson ronnie.bernts...@medchem.umu.se
 wrote:

 Dear all,

 I’m currently looking in to buying a new microscope for viewing crystal
 plates, mounting crystals etc, and would love some input into what I should
 get.

 What I would like is a microscope that has a high quality image, that is
 easy to work with and which is ergonomical. It does not have to have a
 fixed digital camera, but it should be possible to attach a digital camera
 to take pictures. Price is obviously also important...

 I’ve been looking at the standard microscopes that Molecular Dimensions
 sell, and also on a Nikon SMZ18. I remember that we used to have a Leica
 microscope in a previous lab that I liked, but can’t seem to find the model
 at the moment.

 I am also interested in getting a UV source, to inspect crystals under UV
 to see if you fluoresce (and hence are protein crystals). Molecular
 Dimension used to sell XtalLight 100, but doesn’t seem to do so anymore. Do
 any of you have other suggestions regarding the possibility of adding UV to
 a stereomicroscope?

 Suggestions and thoughts are more than welcome!

 Thanks,
 Ronnie


 --
 Ronnie Berntsson, PhD
 Assistant Professor
 Department of Medical Biochemistry and Biophysics
 Umeå University
 90187 Umeå
 Sweden

 e-mail: ronnie.bernts...@medchem.umu.se




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic - Crystallisation in anaerobic glove box

[Patrick Shaw Stewart]

Thank you for your comments everyone.

The CCP4BB is a wonderful resource and it has answered several questions
that have been bothering me for years!

Tristran has given us the correct conclusion as well as the important
facts: the capacity of oil for holding O2 is high, but the diffusion rate
is low.

This makes complete sense of the observations reported.  The O2 is (slowly)
diffusing OUT of the permanganate drop, and the oil is already saturated
with O2, therefore it takes a long time for the purple colour to be lost.

The O2 is diffusing INTO the drop in the dithionite experiment, and
presumably the oil that Julia used was already loaded with O2, so the
reducing environment was quickly lost.


I hadn't figured out how to take advantage of the protection of oil - I
just had a vague feeling that it might be helpful.  Now however I can see
that it's useful, because the oil will provide quite good protection
against a pulse of O2 e.g. if someone accidentally lets air into the
chamber.  (Or moves plates from one glovebox to another?)  O2 will start to
diffuse into the oil, but most of it will diffuse out again if the O2 pulse
is short.  And the lids that are standard on microbatch plates will help a
lot.

(The oil is almost the ideal barrier, although you *might* prefer something
with a very low solubility since it *might *give a lower O2 flux in the
steady state - as Tristran says it's complicated.  And I'm guessing that
the O2 flux through the thin plastic tape used in vapor diffusion setups
would be quite high.  Does anyone have a friend who works in food science?)

There's an even more exciting conclusion: we should degass our oil even for
use with *aerobic *microbatch setups.  I have heard of a case where
diffracting crystals were only obtained for aerobic targets in a glovebox,
and I think the skins on drops are, or can be, related to oxidation.

There may even be mileage in microbatch with the zip lock bag approach for
targets that are not overly sensitive - *if* you degas your oil before you
start  a vacuum should do it.

I agree that Al's Oil (silicone) should be avoided from this point of view
- although I would certainly use it anyway for screening experiments
(whether aerobic or anaerobic).


Riveting stuff.

Thx to all, Patrick



On 18 March 2015 at 18:58, Tristan Croll tristan.cr...@qut.edu.au wrote:

 It's a little complicated. It's true that oxygen is more soluble in most
 oils than in water - but in a high viscosity mineral oil the diffusion rate
 is orders of magnitude lower. So the combination of an oil overlay and a
 reducing agent in your buffer should protect your sample much longer than
 the reducing agent alone - as long as your oil was degassed to start with.
 Note that silicon oils are a bad choice for this - silicones have an
 enormous affinity for oxygen (so much so that they've been explored as
 artificial blood substitutes), and it diffuses through them very readily.



 Tristan Croll
 Lecturer
 Faculty of Health
 School of Biomedical Sciences
 Institute of Health and Biomedical Engineering
 Queensland University of Technology
 60 Musk Ave
 Kelvin Grove QLD 4059 Australia
 +61 7 3138 6443

 This email and its attachments (if any) contain confidential information
 intended for use by the addressee and may be privileged.  We do not waive
 any confidentiality, privilege or copyright associated with the email or
 the attachments.  If you are not the intended addressee, you must not use,
 transmit, disclose or copy the email or any attachments.  If you receive
 this email by mistake, please notify the sender immediately and delete the
 original email.



  On 18 Mar 2015, at 11:49 pm, Edward A. Berry ber...@upstate.edu wrote:
 
  Do you have evidence that the oil blocks diffusion of O2? O2 is a
 nonpolar molecule, generally much more soluble in oils than in water. I'm
 not sure about silicone oils, but I would think they also dissolve O2
 readily.
  eab
 
  On 03/18/2015 08:02 AM, Patrick Shaw Stewart wrote:
 
  Hi Steve
 
  I have one more comment for this thread.
 
  The microbatch-under-oil method is very handy for anaerobic work:
 
 1.  You can keep the microbatch stock solutions in normal microtitre
 plates (polypropylene is best to reduce evaporation) for months, which
 hugely reduces the amount of degassing that you need to do.  You will only
 use say 0.5 ul of stock per drop.
 
 2.  The oil offers a surprising amount of protection from oxidation,
 which may be helpful eg in harvesting.
 
 3.  Microbatch can be automated - in parallel to vapor diffusion if
 desired
 
 
  It's amazing how often (aerobic) microbatch produces far superior
 crystals to V.D. for no obvious reason - it's well worth trying for both
 screening and optimization.
 
  Best wishes
 
  Patrick
 
 
 
  On 11 March 2015 at 10:17, Stephen Carr 
 stephen.c...@rc-harwell.ac.uk mailto:stephen.c...@rc-harwell.ac.uk
 wrote:
 
 Dear CCP4BBer's
 
 Apologies for the off-topic post

Re: [ccp4bb] Off-topic - Crystallisation in anaerobic glove box

[Patrick Shaw Stewart]

Hi Steve

I have one more comment for this thread.

The microbatch-under-oil method is very handy for anaerobic work:

1.  You can keep the microbatch stock solutions in normal microtitre plates
(polypropylene is best to reduce evaporation) for months, which hugely
reduces the amount of degassing that you need to do.  You will only use say
0.5 ul of stock per drop.

2.  The oil offers a surprising amount of protection from oxidation, which
may be helpful eg in harvesting.

3.  Microbatch can be automated - in parallel to vapor diffusion if desired


It's amazing how often (aerobic) microbatch produces far superior crystals
to V.D. for no obvious reason - it's well worth trying for both screening
and optimization.

Best wishes

Patrick




On 11 March 2015 at 10:17, Stephen Carr stephen.c...@rc-harwell.ac.uk
wrote:

 Dear CCP4BBer's

 Apologies for the off-topic post, but the CCP4BB seems to be the best
 place to ask about crystallisation.

 I am looking to set up crystallisation in an anaerobic glove box and
 wondered how other people did this, specifically the crystallisation
 stage.  My initial thoughts were to place a small crystallisation incubator
 inside the box, however the smallest I have come across so far (~27L) is
 still rather large.  Has anyone come across smaller incubators?
 Alternatively are incubators even neccessary if the glove box is placed in
 a room with good air conditioning and stable temperature control?

 Any recommendations would be very helpful.

 Thanks in advance,

 Steve Carr

 Dr Stephen Carr
 Research Complex at Harwell (RCaH)
 Rutherford Appleton Laboratory
 Harwell Oxford
 Didcot
 Oxon OX11 0FA
 United Kingdom
 Email stephen.c...@rc-harwell.ac.uk
 tel 01235 567717

 This email and any attachments may contain confidential, copyright and or
 privileged material, and are for the use of the intended addressee only. If
 you are not the intended addressee or an authorized recipient of the
 addressee, please notify us of receipt by returning the e-mail and do not
 use, copy, retain, distribute or disclose the information in or attached to
 this email.

 Any views or opinions presented are solely those of the author and do not
 necessarily represent those of the Research Complex at Harwell.

 There is no guarantee that this email or any attachments are free from
 viruses and we cannot accept liability for any damage which you may sustain
 as a result of software viruses which may be transmitted in or with the
 message.

 We use an electronic filing system. Please send electronic versions of
 documents, unless paper is specifically requested.

 This email may have a protective marking, for an explanation, please see:

 http://www.mrc.ac.uk/About/informationandstandards/documentmarking/index.htm
 .




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] how to reduce protein solubility

[Patrick Shaw Stewart]

 I use a syringe with a needle and poke through the tape into the
reservoir and top it off

Another approach is to poke holes in the tape with a needle, and just let
the drops slowly evaporate and dry out.  I'm told it works!



On 17 February 2015 at 09:19, Bernhard Rupp hofkristall...@gmail.com
wrote:

 Just a possibility for salvage of your already set-up drops:



 You can spike the reservoirs with some highly concentrated precipitant (no
 matter what as long as

 it sucks more water out of your drop). It does not solve your problem but
 maybe you can

 revive a few drops and get more information from your experiment.

 I use a syringe with a needle and poke through the tape into the reservoir
 and top it off with the

 high conc. precip. The tiny hole is easy to re-tape and does not hinder
 observation.



 Best, BR



 *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of *
 Mattiroli,Francesca
 *Sent:* Tuesday, February 17, 2015 5:23 AM
 *To:* CCP4BB@JISCMAIL.AC.UK
 *Subject:* [ccp4bb] how to reduce protein solubility



 Hi all,

 I am struggling with a protein complex that is too soluble. I have reached
 about 20 mg/ml but I still observe very little precipitation (clear drops
 in 90-95% of the tested conditions). The proteins are expressed in insect
 cells and going to higher concentration is not easily achievable.
 I have tried different buffer conditions (salt concentration and pH) and I
 am testing temperatures. I am at a loss with what to try next.
 Do you think PTMs (phosphorylation, acetylation) might be causing this?
 Any input on how to decrease solubility?

 Thank you very much in advance,

 Francesca




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fabricating hamilton syringe coupler for LCP preparation

[Patrick Shaw Stewart]

Hi Thomas

We use a very simple solution.

We simply shorten a normal needle to 6.5 mm and push it into another
syringe that has *two *of the white PTFE ferrules made by Hamilton.  (We
salvage the extra ferrule from another needle.)

We use a 22 gauge needle (not 22S, where the S stands for *small *inner
diameter).

Now you can push the two syringes together and make your LCP. It helps if
you tighten the knurled nose-piece to compress the PTFE ferrules before you
join the syringes.  You have to keep a little pressure on the two syringes
to hold them together while you mix up the LCP, or use eg tape.  (Which is
why we've made a little mixer on a rail, but that's another story.)

One nice feature is that you hardly waste any LCP and the needle for
dispensing it is already attached to the syringe.

Let me know if you need more info or you'd like me to send you a short
needle.

Best wishes,

Patrick






On 16 December 2014 at 02:14, Thomas Cleveland thomas.clevel...@gmail.com
wrote:

 Hi everyone,

 Thanks for the advice.  I had, in fact, already ordered some
 commercial couplers, but they haven't come in yet, and there was an
 experiment I wanted to do today.

 Here's what I found:

 1.  The steel ferrules have an orientation, with a tight side and a
 loose side.  They can be removed by sliding in one direction, but not
 the other.  Even then, it's pretty difficult.  I had to use pliers,
 and pieces of needle broke off during the process.  The tight side of
 the ferrule then needed to be reamed open slightly with a steel tool
 before I was able to slide the ferrule onto the other needle.

 2.  Soldering stainless steel is really a pain.

 In the end I got a coupler that seems to work well, but it was a pain,
 and it's a bit charred looking.

 Thanks again,
 Tom


 On Mon, Dec 15, 2014 at 6:01 PM, Aaron Thompson
 aaron.a.thomp...@gmail.com wrote:
  I agree with Jim – purchasing the couplers will get you up and running
 much
  quicker.
 
  TTP also sells nice couplers:
 
 https://www.ttplabtechstore.com/ttp_ecom/cc/ItemDetails.jsp?@where.ItemID@EQ=3072-01050sessionkey=#
 
  Aaron
 
 
 
  On Mon, Dec 15, 2014 at 12:38 PM, Bernhard Rupp 
 hofkristall...@gmail.com
  wrote:
 
  Tried the RN kludge at least I did not get it to work. You cannot
  tighten the plastic swage lock type sleeves
  tight enough. On operation the pressure drives the PEEK tubing out of
 the
  compression fit.
  Maybe if you have a jig that holds the 2 syringes in a fixed position so
  they cannot move apart it can work.
 
  Best, BR
 
  -Original Message-
  From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of
  Daniel Anderson
  Sent: Monday, December 15, 2014 8:48 PM
  To: CCP4BB@JISCMAIL.AC.UK
  Subject: Re: [ccp4bb] Fabricating hamilton syringe coupler for LCP
  preparation
 
  Here's my addition to Jim Fairman's reply:
 
  You could use a pair of RN compression fittings (www.hamilton dot com
 part
  number 55751-01) and a segment of HPLC tubing. HPLC tubing within my
 field
  of view can have an inside diameter as small as 0.005 inch.
 
  hope that helps, Happy Merry, etc.,
 Dan
 
 
  On 12/15/2014 11:09 AM, Thomas Cleveland wrote:
   Hi all,
  
   I'm trying to put together some homemade syringe couplers following
   the published instructions from the Caffrey group.  I'm having a bit
   of trouble with this part:
  
   The stainless steel ferrule of the second needle is removed and
   placed on the free end of the coupling needle such that the double
   thumb nut is held symmetrically between the two steel ferrules
  
   Has anyone done this, and if so, how did you remove the stainless
   steel ferrule from the second needle in order to place it over the
   first?  The stainless steel ferrule appears to be firmly attached and
   I'm having trouble removing it.
  
   Thanks,
   Thomas Cleveland



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] fastening crystal formation

[Patrick Shaw Stewart]

Michael (and some others)

You haven't mentioned - and I guess don't use regularly - the random MMS
approach, where crushed seed-crystals are added to random screens.  This
really is a terrific method, and it will on average roughly double
productivity.  It's the first thing I would think of in a case like
Vijaykumar's (as I told him this morning!).

Galina Obmolova and her colleagues published a great paper earlier this
year about MMS.  They were working with a set of 16 Fab fragments that
comprised all combinations of 4 different heavy chains and 4 different
light chains.  Three structures were generated without MMS, but by various
very creative uses of microseeding they were able to get all 16/16
structures.  Ref below.

Best wishes,

Patrick

__


Obmolova, G., Malia, T. J., Teplyakov, A., Sweet, R. W.,  Gilliland, G. L.
(2014). Protein crystallization with microseed matrix screening:
application to human germline antibody Fabs. *Structural Biology and
Crystallization Communications*, *70*(8).




On 31 October 2014 16:07, R. M. Garavito rmgarav...@gmail.com wrote:

 Although three months is a long time, it is no completely unheard of, and
 does not require the invocation of proteolysis.  The longest time I have
 heard of is ~1 yr, so count yourself lucky.  However to get good advice, as
 well as to use it, you need to ask yourself several questions:

 1.  What kind of crystals are they?  Protein, salt, etc? If they are salt,
 don't pursue this condition.

 2.  How many crystals did you get?  One or 2 in a drop or a microcrystal
 shower. And of what kind?  Single, well shaped, rosettes, needle clusters,
 or something that looks crystalline.  Screen more broadly around your
 initial hit.

 3.  How many times have your tried to repeat this?  Once, twice, or more?
 Did you try setups in duplicate?  If so, did you get reproducible results?
 Have you actually screened around these conditions, varying each component
 systematically (PEG, salt, pH, buffer, etc.)?

 4.  What method did you use? And in what kind of container?  For one
 thing, we don't completely trust the integrity of our setups for longer
 than 2 months.  All containers leak water slowly, so when crystals take
 longer than 2 months to grow (a) the real conditions are at much higher
 values than you naively think (i.e., the drop has dried out more than you
 expected) or (b) other components are crystallizing, for example a zinc
 salt.  It depends what else is in your protein buffer, as well.

 To quicken protein crystallization (which is not always a good thing),
 increase your protein concentration (by 1.5-2x) and/or PEG concentration
 (such as screening up to 40% PEGmme 550).  Sadly, crystallization is a
 combination of thermodynamic and kinetic factors:  you can get crystals
 (sometimes a single crystal only) when just outside the truly optimal
 conditions, but this may be only a sporadic event. You got to keep
 screening.

 Good luck,

 Michael


 **
 *R. Michael Garavito, Ph.D.*
 *Professor of Biochemistry  Molecular Biology*
 *603 Wilson Rd., Rm. 513*
 *Michigan State University  *
 *East Lansing, MI 48824-1319*
 *Office:*  *(517) 355-9724 Lab:  (517) 353-9125*
 *FAX:  (517) 353-9334Email:  rmgarav...@gmail.com
 garav...@gmail.com*
 **




 On Oct 31, 2014, at 6:05 AM, Vijaykumar Pillalamarri 
 vijaypkuma...@gmail.com wrote:

 Dear all,

 I am trying to crystallize a 30 kD protein. Protein crystals are formed
 after 3 months. The crystals are formed in the following condition:
 0.01M Zinc sulphate
 0.1M MES monohydrate pH 6.5
 25% v/v PEG monomethyl ether 550

 Please suggest me how to grow these crystals faster.

 Thanking you

 --
 Vijaykumar Pillalamarri,
 UGC-JRF,
 C/O: Dr. Anthony Addlagatta,
 Senior Scientist,
 CSIR-IICT, Tarnaka,
 Hyderabad, India-57
 Mobile: +918886922975





-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] frozen pellet insoluble protein

[Patrick Shaw Stewart]

Andreas, you probably know all this, but I only understood quite recently.
What happens is that as ice crystals form you get brine rejection, the
same thing that happens in the arctic when sea water freezes.  Therefore
you can have protein concentrated in pockets of high salt.  Fine for some
proteins, but others don't like it.  And it can happen during (slow)
thawing as well as during freezing.  - Patrick





On 29 September 2014 16:02, Andreas Förster docandr...@gmail.com wrote:

 Dear all,

 I've encountered people who refuse to freeze cells and always lyse fresh
 pellets.  Better protein, they say.  I've never had reason to do so myself,
 or even to believe in their voodoo.  Up until now, maybe.

 My protein expresses well and is almost all in the soluble fraction in an
 expression test from a fresh pellet.  The large-scale expression from the
 same pellet, now frozen and thawed, yielded 90% insoluble protein.

 If it's the freezing that dooms the protein, I'm happy to redo the
 fermentor run.  Are there other examples out there of this?

 Thanks.


 Andreas




 --
   Andreas Förster
  Crystallization and X-ray Facility Manager
Centre for Structural Biology
   Imperial College London




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

Hi Joel and Jaime - very nice to hear from you.  I hope everything is going
well in Rehovot.

Proteopedia is the natural place to put comments etc.  However it might
look more natural if there was more info there in the first place - ie if
people gave more explanation about the significance of their and other
people's structures, then comments like the one I suggested could be added.
 I don't know how you get people to become more active at Proteopedia.
 Maybe your students could post occasional messages to eg the CCP4bb with
comments that show how useful Proteopedia can be.  Tricky though!

Best wishes, Patrick




On 16 May 2014 14:35, Joel Sussman joel.suss...@weizmann.ac.il wrote:

  16-May-2014
 Dear Patrick,
 *Proteopedia* [*http://proteopedia.org] http://proteopedia.org%5D* uses
 exactly the same style for referencing published material.

  *Proteopedia* allows for the easy insertion of Pubmed and DOI references
 by only requesting from the user to enter the Pubmed or DOI ids. We have
 extended the same software used in Wikipedia for the internal
 *Proteopedia* engine to, based on this reference ID, retrieve, format and
 insert the correctly formatted reference at the bottom of the page.

  For example, *type refPMID 18673581/ref or refdoi
 10.1093/nar/gku213/ref* in the wikitext box and save the page. If you
 type the reference in this manner, the properly formatted reference will be
 created automatically at the bottom of the page (or wherever you place the
 necessary wikitext references/).

  See *http://proteopedia.org/w/Help:Editing#Citing_Literature_References
 http://proteopedia.org/w/Help:Editing#Citing_Literature_References* and
 Proteopedia pages for actual examples.
 best regards,
 Jaime  Joel

 On 15May, 2014, at 13:48, Patrick Shaw Stewart patr...@douglas.co.uk
 wrote:


 I may be missing something here, but I don't think you have to rebut
 anything.  You simply report that someone else has rebutted it.  Along the
 lines of

  Many scientists regard this published structure as unreliable since a
 misconduct investigation by the University of Alabama at Birmingham has
 concluded that it
 was, more likely than not, faked [1]

 [1] http://www.nature.com/news/2009/091222/full/462970a.html






 On 15 May 2014 18:00, Nat Echols nathaniel.ech...@gmail.com wrote:

 On Thu, May 15, 2014 at 9:53 AM, Patrick Shaw Stewart 
 patr...@douglas.co.uk wrote:

 It seems to me that the Wikipedia mechanism works wonderfully well.  One
 rule is that you can't make assertions yourself, only report pre-existing
 material that is attributable to a reliable published source.


  This rule would be a little problematic for annotating the PDB.  It
 requires a significant amount of effort to publish a peer-reviewed article
 or even just a letter to the editor, and none of us are being paid to write
 rebuttals to dodgy structures.

  -Nat




  --
  patr...@douglas.co.ukDouglas Instruments Ltd.
  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
  Directors: Peter Baldock, Patrick Shaw Stewart

  http://www.douglas.co.uk
  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
  Regd. England 2177994, VAT Reg. GB 480 7371 36





-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

@JISCMAIL.AC.UK
 *Sent:* Wednesday, 14 May 2014, 19:22
 *Subject:* Re: [ccp4bb] PDB passes 100,000 structure milestone


 On Wednesday, 14 May, 2014 13:52:02 Phil Jeffrey wrote:
  As long as it's just a Technical Comments section - an obvious concern
  would be the signal/noise in the comments themselves.  I'm sure PDB
  would not relish having to moderate that lot.
 
  Alternatively PDB can overtly link to papers that discuss technical
  issues that reference the particular structure - wrong or fraudulent
  structures are often associated with refereed publications that point
  that out, and structures with significant errors often show up in that
  way too.  I once did a journal club on Muller (2013) Acta Cryst
  F69:1071-1076 and wish that could be associated with the relevant PDB
  file(s).

 Perhaps some combination of those two ideas?

 The PDB could associate with each deposited structure  a crowd-sourced
 list of published articles citing it.They already make an effort to
 attach the primary citation, but so far as I know there is currently
 no effort to track subsequent citations.

 While spam comments in a free-format forum are probably inevitable,
 spam submission of citing papers seems less likely to be a problem.

 - Ethan

   On Wed, May 14, 2014 at 12:32 PM, Zachary Wood z...@bmb.uga.edu
   mailto:z...@bmb.uga.edu wrote:
  
  Hello All,
  
  Instead of placing the additional burden of policing on the good
  people at the PDB, perhaps the entry page for each structure could
  contain a comments section. Then the community could point out
  serious concerns for the less informed users. At least that will
  give users some warning in the case of particularly worrisome
  structures. The authors of course could still reply to defend their
  structure, and it may encourage some people to even correct their
  errors.
  
 --
 Ethan A Merritt
 Biomolecular Structure Center,  K-428 Health Sciences Bldg
 MS 357742,  University of Washington, Seattle 98195-7742






-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

I may be missing something here, but I don't think you have to rebut
anything.  You simply report that someone else has rebutted it.  Along the
lines of

Many scientists regard this published structure as unreliable since a
misconduct investigation by the University of Alabama at Birmingham has
concluded that it
was, more likely than not, faked [1]

[1] http://www.nature.com/news/2009/091222/full/462970a.html






On 15 May 2014 18:00, Nat Echols nathaniel.ech...@gmail.com wrote:

 On Thu, May 15, 2014 at 9:53 AM, Patrick Shaw Stewart 
 patr...@douglas.co.uk wrote:

 It seems to me that the Wikipedia mechanism works wonderfully well.  One
 rule is that you can't make assertions yourself, only report pre-existing
 material that is attributable to a reliable published source.


 This rule would be a little problematic for annotating the PDB.  It
 requires a significant amount of effort to publish a peer-reviewed article
 or even just a letter to the editor, and none of us are being paid to write
 rebuttals to dodgy structures.

 -Nat




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] First stucture of FCFV

[Patrick Shaw Stewart]

Those who use lysozyme as a model protein should note that fungal spores of
an unknown strain can have a dramatic effect on lysozyme crystal
nucleation, as noticed by my student many years ago (I wasn't completely
happy with the report because we never knew what we were working with!).

Chayen, N. E., Radcliffe, J. W.,  Blow, D. M. (1993). Control of
nucleation in the crystallization of lysozyme. *Protein Science*, *2*(1),
113-118.
http://onlinelibrary.wiley.com/doi/10.1002/pro.5560020112/full


I've often wondered why crystallization experiments at room temp don't
become a sea of bacteria and fungi within a week.  Is it because the high
precipitant concs used stop growth?  After all, medical saline is only 150
mM - much less than the average NaCl conc used for crystallization, which
is about 1.7M.  I guess not many bugs can grow in 20% PEG either.

Patrick




On 3 April 2014 15:25, Reza Khayat rkha...@ccny.cuny.edu wrote:

 I think fungus dependent crystallization has occurred for some
 labs. A paper that pops into mind is from my graduate
 laboratory (not my work though):

 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2225192/

 Reza

 Reza Khayat, PhD
 Assistant Professor
 The City College of New York
 Department of Chemistry, MR-1135
 160 Convent Avenue
 New York, NY  10031
 Tel. (212) 650-6070
 www.khayatlab.org


  Original message 
 Date: Thu, 3 Apr 2014 06:36:37 -0700
 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf
 of Chad Brautigam cabrautc...@yahoo.com)
 Subject: Re: [ccp4bb] First stucture of FCFV
 To: CCP4BB@JISCMAIL.AC.UK
 
I once encountered mold-dependent crystallization of
a protein.  Wouldn't that have made for a lively
Methods section?
Luckily, we determined the structure from crystals
derived from a different, non-moldy condition.
Whew.
Chad
From: Artem Evdokimov artem.evdoki...@gmail.com
To: CCP4BB@JISCMAIL.AC.UK
Sent: Thursday, April 3, 2014 7:55 AM
Subject: Re: [ccp4bb] First stucture of FCFV
Common molds like aspergillus or penicillium. After
a while you sometimes get sporangia, then you can
tell with more certainty. ..
A.
On Apr 3, 2014 3:50 AM, Bernhard Rupp
hofkristall...@gmail.com wrote:
 
  Several people were asking what this FCFV
  tentacles actually might be. I think it is some
  fungus/yeast growing out of nutritious drops. Does
  resemble fungus/mushroom mycelium. I have also
  some that look like huge bacteriophages with nice
  heads on them, probably yeast buds. There is also
  a yeast lab next to the Xtallization facility :-/
  *** feel free to speculate.
 
  Best, BR
 
 




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] seeding, reproducibility

[Patrick Shaw Stewart]

One or more ingredients in the original hit (which you use to suspend the
seed crystals in) can indeed be essential, and may be all you need to get
nice crystals.  In D'Arcy's original paper you will see that he needed Ca2+
to get nice crystals of one of his proteins.  The same is true in Stoddards
paper, which inspired D'Arcy, ref below.  However in the majority of cases
it is just the seed that you need, i.e. there was a nucleation problem in
the new hits that appear with seed stock.  You can see this very clearly
because (in most cases) diluting the seed stock in the same solution gives
a corresponding reduction in the number of crystals.


Ireton, Gregory C., and Barry L. Stoddard. Microseed matrix screening to
improve crystals of yeast cytosine deaminase. *Acta Crystallographica
Section D: Biological Crystallography* 60, no. 3 (2004): 601-605.



On 18 January 2014 00:18, Mahesh Lingaraju mxl1...@psu.edu wrote:

 Thanks you for the suggestions, Patrick and Matthias. I was actually
 wondering if any of the components from the seeding solution actually were
 important but your explanations sound more logical.

 I apologize for the large attachment. I did not realize that it was so
 big.

 Have a nice weekend !

 Mahesh


 On Fri, Jan 17, 2014 at 6:18 PM, Patrick Shaw Stewart 
 patr...@douglas.co.uk wrote:


 Mahesh, this is a very interesting and slightly controversial question.

 One approach is to mix together all of the crystals that you have in the
 initial screen.  The idea at the beginning of the project is to get as many
 diverse hits as possible - you can worry about crystal size, space group
 and quality later on.

 If you can collect data from crystals and determine the unit cell then
 you can be more rational.  You can construct a library of polymorphs
 having different unit cells.  This *may *allow you to push the space
 group in a given condition to the unit cell or space group that you want -
 maybe you find e.g. that your ligand can only diffuse into the active site
 with a certain unit cell.

 There is a very interesting paper with several examples of how to use
 polymorphs by the Stura group, see below.

 However, seeding can give rise to crystals with different but related
 space groups.  A very nice example is shown in the wikipedia article about
 epitaxy - titanium oxide growing on iron oxide.  Also Stura's paper on
 epitaxial jumps is interesting and relevant.

 Make sure you dilute your seed stock in a systematic way as part of your
 final optimization - one great advantage of microseeding is that oyu can
 control the number of crystals per drop by diluting the seed stock.

 Also, make sure that you use fresh crystals to make the seed stock.  For
 some strange reason old crystals sometimes fail to act as seeds, even
 though they can be crushed and still diffract.  Maybe the unit cell
 shrinks, or maybe the crystals become cross-linked.  Make the seed stock as
 soon as your crystals stop growing, then freeze them.  Seed stocks can
 almost always be frozen.

 Best wishes, Patrick



 *Library of polymorphs:*
 Vera, Laura, Claudia Antoni, Laurent Devel, Bertrand Czarny, Evelyn
 Cassar-Lajeunesse, Armando Rossello, Vincent Dive, and Enrico A. Stura.
 Screening Using Polymorphs for the Crystallization of Protein–Ligand
 Complexes. Crystal Growth  Design 13, no. 5 (2013): 1878-1888.

 Stura, Enrico A., Jean-Baptiste Charbonnier, and Michael J. Taussig.
 Epitaxial jumps. Journal of crystal growth 196, no. 2 (1999): 250-260.


 *Cross-seeding:*
 Obmolova, Galina, Thomas J. Malia, Alexey Teplyakov, Raymond Sweet, and
 Gary L. Gilliland. Promoting crystallization of antibody-antigen complexes
 via microseed matrix screening. Acta Crystallographica Section D:
 Biological Crystallography 66, no. 8 (2010): 927-933.

 Abuhammad, Areej, Edward D. Lowe, Michael A. McDonough, P. D. Shaw
 Stewart, Stefan A. Kolek, Edith Sim, and Elspeth F. Garman. Structure of
 arylamine N-acetyltransferase from Mycobacterium tuberculosis determined by
 cross-seeding with the homologous protein from M. marinum: triumph over
 adversity. Acta Crystallographica Section D: Biological Crystallography
 69, no. 8 (2013): 1433-1446.


 *Seed stability etc*
 Shaw Stewart, Patrick D., Stefan A. Kolek, Richard A. Briggs, Naomi E.
 Chayen, and Peter FM Baldock. Random microseeding: a theoretical and
 practical exploration of seed stability and seeding techniques for
 successful protein crystallization. Crystal Growth  Design 11, no. 8
 (2011): 3432-3441.



 *Original description of the random microseeding method*D'Arcy, Allan,
 Frederic Villard, and May Marsh. An automated microseed matrix-screening
 method for protein crystallization. Acta Crystallographica Section D:
 Biological Crystallography 63, no. 4 (2007): 550-554.






 On 17 January 2014 22:24, Mahesh Lingaraju mxl1...@psu.edu wrote:
 
  Hi Folks
 
  The protein that I am working on gives several initial hits which are
 needles. And at random, I picked the needles

Re: [ccp4bb] seeding, reproducibility

[Patrick Shaw Stewart]

Mahesh, this is a very interesting and slightly controversial question.

One approach is to mix together all of the crystals that you have in the
initial screen.  The idea at the beginning of the project is to get as many
diverse hits as possible - you can worry about crystal size, space group
and quality later on.

If you can collect data from crystals and determine the unit cell then you
can be more rational.  You can construct a library of polymorphs having
different unit cells.  This *may *allow you to push the space group in a
given condition to the unit cell or space group that you want - maybe you
find e.g. that your ligand can only diffuse into the active site with a
certain unit cell.

There is a very interesting paper with several examples of how to use
polymorphs by the Stura group, see below.

However, seeding can give rise to crystals with different but related space
groups.  A very nice example is shown in the wikipedia article about
epitaxy - titanium oxide growing on iron oxide.  Also Stura's paper on
epitaxial jumps is interesting and relevant.

Make sure you dilute your seed stock in a systematic way as part of your
final optimization - one great advantage of microseeding is that oyu can
control the number of crystals per drop by diluting the seed stock.

Also, make sure that you use fresh crystals to make the seed stock.  For
some strange reason old crystals sometimes fail to act as seeds, even
though they can be crushed and still diffract.  Maybe the unit cell
shrinks, or maybe the crystals become cross-linked.  Make the seed stock as
soon as your crystals stop growing, then freeze them.  Seed stocks can
almost always be frozen.

Best wishes, Patrick



*Library of polymorphs:*
Vera, Laura, Claudia Antoni, Laurent Devel, Bertrand Czarny, Evelyn
Cassar-Lajeunesse, Armando Rossello, Vincent Dive, and Enrico A. Stura.
Screening Using Polymorphs for the Crystallization of Protein–Ligand
Complexes. Crystal Growth  Design 13, no. 5 (2013): 1878-1888.

Stura, Enrico A., Jean-Baptiste Charbonnier, and Michael J. Taussig.
Epitaxial jumps. Journal of crystal growth 196, no. 2 (1999): 250-260.


*Cross-seeding:*
Obmolova, Galina, Thomas J. Malia, Alexey Teplyakov, Raymond Sweet, and
Gary L. Gilliland. Promoting crystallization of antibody-antigen complexes
via microseed matrix screening. Acta Crystallographica Section D:
Biological Crystallography 66, no. 8 (2010): 927-933.

Abuhammad, Areej, Edward D. Lowe, Michael A. McDonough, P. D. Shaw Stewart,
Stefan A. Kolek, Edith Sim, and Elspeth F. Garman. Structure of arylamine
N-acetyltransferase from Mycobacterium tuberculosis determined by
cross-seeding with the homologous protein from M. marinum: triumph over
adversity. Acta Crystallographica Section D: Biological Crystallography
69, no. 8 (2013): 1433-1446.


*Seed stability etc*
Shaw Stewart, Patrick D., Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen, and Peter FM Baldock. Random microseeding: a theoretical and
practical exploration of seed stability and seeding techniques for
successful protein crystallization. Crystal Growth  Design 11, no. 8
(2011): 3432-3441.



*Original description of the random microseeding method*D'Arcy, Allan,
Frederic Villard, and May Marsh. An automated microseed matrix-screening
method for protein crystallization. Acta Crystallographica Section D:
Biological Crystallography 63, no. 4 (2007): 550-554.





On 17 January 2014 22:24, Mahesh Lingaraju mxl1...@psu.edu wrote:

 Hi Folks

 The protein that I am working on gives several initial hits which are
needles. And at random, I picked the needles from a condition (0.2 M cacl2,
0.1 M HEPES pH 7.5  28% PEG 400) and seeded into another screen where I
added 1µl protein + 1µl reservoir solution + 0.3 µl seed stock. I prepared
the seed stock fresh by adding 36 µl of the reservoir solution to
preexisting 2µl drop.
 One of the conditions from the seeded screen gave me a hit that looks
really promising ( see attached). I am sort of positive that these crystals
are protein as they are UV active.

 I tried to reproduce these but with needles from another condition which
actually look much nicer than the seeds i used to produce these crystals.
However, I failed to do so.

 While i understand that seed quality is important, I find it interesting
that the crystals do not reproduce with similar or better looking seeds. Is
it common that the seeds absolutely need to be from the same condition to
reproduce hits ?

 thanks for any suggestions

 Mahesh





--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] structural homologs as cross seeds

[Patrick Shaw Stewart]

There are many examples where cross-seeding with homologous proteins has
worked, both in classical and recent work.  You should add seed-stocks from
any crystals with significant homology to your routine screening
experiments in the first place.

The important thing is to use *random *screens at first.  This has the
effect of giving you new leads and also optimizing the ones that you have
(plus you can control the number of crystals per drop).

See http://hamptonresearch.com/documents/ramc/RAMC2011_T11_Obmolova.pdf
(Omolova and colleagues have examples where complexes were seeded with
crystals of one of the components and vice versa.)

The excellent review by Stura and co covers most of the theoretical points.
 (1999). Epitaxial jumps. *J. crystal growth*, *196*(2), 250-260.

For practical details see the original paper by D'Arcy (Acta Cryst D:
63.4 (2007):
550-554) and also our paper Random microseeding: a theoretical and
practical exploration   *Crystal Growth  Design* 11.8 (2011):
3432-3441.

also http://www.douglas.co.uk/MMS_proc.htm

Acoot, this is also the approach to use with your cubic crystals.  Don't
think about it too much, just try it!

The only thing that I can't explain is why this random seeding method,
including cross-seeding, is not more well-known.

Hope it works

Patrick



On 27 December 2013 21:03, Mark van Raaij mjvanra...@cnb.csic.es wrote:

 the differences are likely to be on the protein surface, and these would
 make the crystal contacts, i.e. it would be unlikely the protein could
 crystallise in the same crystal habit.
 Never say never in crystallisation (i.e. try anything), but I would go for
 other things first like additives, different crystallisation techniques,
 temperatures, concentrations etc.

 On 27 Dec 2013, at 20:29, Mahesh Lingaraju wrote:

  Dear all,
 
  I was wondering if it sounds logical to use the crystals from a possible
 structural homolog as seeds to induce nucleation ? (in terms of overall
 sequence, the proteins are considerably different but based on sequence
 alignment and structures from other related proteins, it is highly likely
 the protein would have the same structure.)
 
  Please comment if any of you had experience with this.
 
  Thank you
 
  Happy holidays :)
 
  Mahesh




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein concentration for crystallization

[Patrick Shaw Stewart]

 attachments) is strictly
 prohibited.

 If you have received this message in error, please contact
 the sender by reply e-mail message and destroy all copies of the
 original message (including attachments).




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improve diffraction ...any ideas?

[Patrick Shaw Stewart]

Use random microseeding to pick up new conditions, and work with those.

See http://www.douglas.co.uk/mms.htm and
http://www.douglas.co.uk/MMS_proc.htm for theory, references and practical
details



On 24 May 2013 03:20, Urmi Dhagat udha...@svi.edu.au wrote:

 Hi,

 I am working on a protein antibody complex which readily crystallizes
 (crystals form overnight and grow over 2-3 days) in 0.1M Bicine pH 9, 10 %
 PEG8000. The crystals are chunky - shaped like a parallelogram but they
 diffract poorly to about 8 Å.

 I have tried the following to improve diffraction:
 1.  Screen different temperatures 4°C  - crystals have bad form and
 10°C crystals grow slower but diffraction does not improve.
 2.  I have done an additive screen – A few hits came up like Yttrium
 Chloride and Acetonitrile but they don’t improve diffraction either
 3.  I have tried streak seeding this does not help either
 4.  Tested different cryo protectants – MPD, PEG400, Ethylene glycol
 and glycerol - 10 - 15% glycerol seems to work best
 5.  Not sure if cryo protectant affects diffraction in this case – I
 will look at room temp diffraction soon to rule this out.
 6.  Typical diffraction images attached

 Does anyone have suggestions on what I could try to improve diffraction of
 my crystals?



 Urmi Dhagat
 St Vincent's Institute





-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improve diffraction ...any ideas?

[Patrick Shaw Stewart]

Rajiv, I don't quite get your idea.  Once the crystals of the single
proteins have grown, you can't soak the other protein in, can you?  Or do
you mean something else?

Umri, if you do get crystals of one of the components it's well worth
trying cross-seeding into the complex, again using random screens.  There
are a few examples where this has worked, particularly with antibodies.

Patrick


On 24 May 2013 06:43, Rajiv K Bedi rkn...@essex.ac.uk wrote:

 Dear Umri,

 I think the main problem is co-crystallization.

 What I would do is crystallize protein and antibody separately and then
 soak protein crystals into reservoir solution containing antibody or vice
 versa.
 And do try to get crystals from different conditions which may alter the
 space group and thereby improve diffraction quality, hopefully.

 All the best,
 Rajiv




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improve diffraction ...any ideas?

[Patrick Shaw Stewart]

Hello Scott

Setting up rMMS by hand works fine, but it's a bit slow and uses more
protein and (sometimes much more important!) more seed stock.

We recommend using a Hamilton syringe, preferably with a rounded needle, to
set up by hand.  1.0 protein + 0.7 reservoir solution + 0.3 seed stock
works well.  Dispense the protein and reservoir solution first, then add
the seed stock   You can clean the needle by passing it through the
reservoir just before you dispense seed stock.  It's surprising how
accurately you can dispense the seed like that with a syringe and your
fingers.

I can't say whether dispensing by robot or by hand gives better results.
 The most productive group that I know that used this method had great
success by hand before started using a robot, so I'm sure that both work
well.

Bear in mind that you're likely to get showers of small crystals at first
when you use this method.  So you will probably need to dilute the seed
stock.  What works extremely well for this is our new Combinatorial
script.  Here you arrange the hits in columns, and add a different seed
stock to each row.  Make a dilution series from neat seed stock to say a
1:100,000 dilution.  Add the most dilute seed stock to the first row, the
next most dilute to the second and so on.  Its a really quick way to get
1-5 crystals per well, and you can easily set up a whole plate with almost
the same number of crystals per well.  We use the robot to do this but I'm
sure it would be easy to do the same thing by hand.

Best wishes

Patrick



On 24 May 2013 13:46, Scott wrote:

 Dear Patrick,

  Have you had better optimization using MMS by setting up trays with a
 robot or into
 larger sitting drops by hand?

  Thank you for your suggestions.

  Cheers,

  Scott


   



  On May 24, 2013, at 8:01 AM, Patrick Shaw Stewart patr...@douglas.co.uk
  wrote:


  Use random microseeding to pick up new conditions, and work with those.

  See http://www.douglas.co.uk/mms.htm and
 http://www.douglas.co.uk/MMS_proc.htm for theory, references and
 practical details



 On 24 May 2013 03:20, Urmi Dhagat udha...@svi.edu.au wrote:

 Hi,

 I am working on a protein antibody complex which readily crystallizes
 (crystals form overnight and grow over 2-3 days) in 0.1M Bicine pH 9, 10 %
 PEG8000. The crystals are chunky - shaped like a parallelogram but they
 diffract poorly to about 8 Å.

 I have tried the following to improve diffraction:
 1.  Screen different temperatures 4°C  - crystals have bad form and
 10°C crystals grow slower but diffraction does not improve.
 2.  I have done an additive screen – A few hits came up like Yttrium
 Chloride and Acetonitrile but they don’t improve diffraction either
 3.  I have tried streak seeding this does not help either
 4.  Tested different cryo protectants – MPD, PEG400, Ethylene glycol
 and glycerol - 10 - 15% glycerol seems to work best
 5.  Not sure if cryo protectant affects diffraction in this case – I
 will look at room temp diffraction soon to rule this out.
 6.  Typical diffraction images attached

 Does anyone have suggestions on what I could try to improve diffraction
 of my crystals?



 Urmi Dhagat
 St Vincent's Institute





  --
  patr...@douglas.co.ukDouglas Instruments Ltd.
  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
  Directors: Peter Baldock, Patrick Shaw Stewart

  http://www.douglas.co.uk
  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
  Regd. England 2177994, VAT Reg. GB 480 7371 36








-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] salt or not?

[Patrick Shaw Stewart]

Careina,

One thing to try if other ideas don't work or are too difficult, is
covalently (therefore unambiguously) labelling a little of your protein
with a fluorescent dye.  If you add 20 nL of this to the drop *after the
crystals have grown*, protein crystals will light up, but salt crystals
will not.  Thermo make some very easy-to-use kits for labelling.  See
methods section of our paper *Cryst. Growth Des.*, 2011, *11* (8), pp
3432–3441.

Could you also label the DNA   . . .   ?

Hope it helps, best wishes, Patrick


On 15 April 2013 11:18, Careina Edgooms careinaedgo...@yahoo.com wrote:

 Dear ccp4

 I have been performing trials on a protein DNA complex for a while now and
 have not seen any crystals form. Today I checked an old plate (over a month
 old) and I see 4 large crystals. *excitement* Three of them look tetragonal
 in shape (like a pyramid) and one of them looks hexagonal. I do not know if
 they are salt or protein. There is calcium chloride in the buffer. They
 feel quite soft to touch. They do not cause much birefringence. One of them
 does not seem to absorb much izit. It did go a bit blue but not entirely.

 How can I tell if this crystal is protein or not? Do you think its worth
 trying to see how it diffracts?

 Also, does Izit affect diffraction/ protein structures at all? Could I use
 a crystal with Izit in a diffraction experiment and ultimately to get the
 structure?

 Best
 Careina




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] protein crystals or salt crystals

[Patrick Shaw Stewart]

Amro

Here is an extract from our paper, describing a method that is almost
infallible, and not too hard to do if you're organized.  It can never
give false positives and (in the 3 cases we looked at it) only gave
false negatives when there was heavy precipitate in the drop.

Best wishes, Patrick


Ref: Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs,
Naomi E. Chayen and Peter F.M. Baldock. 'Getting the most out of the
random microseed matrix-screening method in protein crystallization'.
Cryst. Growth Des., 2011, 11 (8), pp 3432–3441. On-line
athttp://pubs.acs.org/doi/abs/10.1021/cg2001442.


In the cases of crystals of the proteins concanavalin A, trypsin, and
thaumatin, we used an interesting novel method of making the
distinction, which is a modification of the method of Pusey et al.17
We covalently labeled 50 μL aliquots of the proteins with the
fluorescent dye DyLight 350 NHS Ester (from Thermo), following the
manufacturer’s instructions except that we used higher protein
concentrations (30 mg/mL for trypsin and concanavalin A, 36 mg/mL for
xylanase). We added 20 nL samples of labeled protein to wells
containing putative protein crystals after the crystals had grown. We
photographed crystals in a darkroom by illuminating with the UV
Pen-280 or with an FL4BLB UV lamp (Luxina), which has a peak
wavelength of 370 nm. As shown in Figure 2, crystals fluoresced
brightly and were unambiguously identified as protein rather than salt.
(The DyLight kits are very easy to use because all resins, columns,
etc. are provided. We chose the label that is excited at 350 nm
because it is not necessary to use a filter since most cameras have
built-in UV filters.) The advantages of the method are (1) since it
allows protein to be seen directly, it does not give false positives
or negatives (except when the drop contains a lot of precipitate, see
below). (2) It cannot interfere with the crystallization process. (3)
Labeled protein need only be prepared if crystal identification by
other methods fails; (4) even needles and small crystals can be
identified. The method does not work well when the drop contains a lot
of protein precipitate, which may absorb the labeled protein before it
can reach the crystals. Note also that protein sometimes coats salt
crystals in crystallization experiments, giving a superficially similar
appearance. Such cases can, however, easily be distinguished by
comparing UV images with visible light images because the protein
coating is outside the salt crystal.


(17) Pusey, M.; Forsythe, E.; Achari, A. Methods Mol. Biol. 2008,
426, 377–385.



On 11 February 2013 09:37, Ganesh Natrajan ganesh.natra...@ibs.fr wrote:

 Dear Amro,

 What you could try is this. Make a solution of 0.5 % (w/v) commassie 
 brilliant blue in 10% (v/v) ethanol in water. Pipet 1 ul of this into your 
 drop and close the cover slip. If the crystals are protein, they should turn 
 blue after some time (typically 30 mins). Salt crystals will not turn blue as 
 they are not stained by commassie.

 You could also try using Hampton's Izit crystal dye for this, but the problem 
 I have faced with it is that the izit itself crystallizes (gives lovely blue 
 crystals) under certain buffer conditions.

 cheers

 Ganesh






 Hallo my colleagues.
  i hope every one doing ok . i did screening since two weeks . i noticed 
 today this crystals. i don`t know either it salt or protein crystal . my 
 protein has zero tryptophan so i could distinguish by UV camera.
 the condition was conditions:
 0.1M SPG buffer pH 8 and 25%PEG 1500. in addition to Nickle chlorid 1mM.


 best regards
 Amr











--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] protein crystals or salt crystals

[Patrick Shaw Stewart]

Good morning Frank

On a related idea, do you typically use a limited number of buffers
(buffer plus salt) for the final purification step of your proteins?

If so, do you have a chart of where salt crystals may appear in the screens
that you use most often?  Could you put that chart on your web site to help
the community?

People could pick one of your standard buffer mixes to make their lives
easier later on.

Best wishes

Patrick





On 8 February 2013 07:18, Frank von Delft frank.vonde...@sgc.ox.ac.ukwrote:

  Test the diffraction - that's the only way.  But given the other junk in
 the drop, chances are they're salt.

 (And don't post 5Mb attachments, please.)


 On 07/02/2013 22:24, amro selem wrote:





  Hallo my colleagues.
   i hope every one doing ok . i did screening since two weeks . i noticed
 today this crystals. i don`t know either it salt or protein crystal . my
 protein has zero tryptophan so i could distinguish by UV camera.
  the condition was conditions:
  0.1M SPG buffer pH 8 and 25%PEG 1500. in addition to Nickle chlorid 1mM.


  best regards
 Amr










-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] To cryo or not to cryo...

[Patrick Shaw Stewart]

Yuri

Whatever happens, keep the remains of the crystal to make a seed-stock
after data collection.

You can also try making a seed stock from the rest of the drop, even if you
can't see crystals, and even if it has dried up.

Use part of your seed-stock to seed into one or more *random screens*

You can make the seed stock by suspending crushed crystals in the reservoir
solution that gave the original hit (preferably taken from the original
plate as it may have dried out a bi9t).

Patrick


Allan D’Arcy, Frederic Villarda, May Marsh.  'An automated
microseed matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007), 550–554.
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652



On 1 December 2012 09:22, Yuri Pompeu yuri.pom...@ufl.edu wrote:

 Dear community,
 I have what seems to be a pretty decent single crystal that grew from a
 screen set up 2 weeks ago.
 I am trying to reproduce it but so far I have not succeeded. I am however
 afraid the crystal that did form will start to deteriorate. So this brings
 me to dilemma, I feel like I should try and mount this crystal and shoot
 it. But since I only have 1 sample, I do not want to mess this up...  I am
 inclined to try cryo conditions, but I am afraid the addition of a cryo
 such as glycerol could destroy the little guy.
 The crystal formed in 30% PEG 4000, 0.1M NaCitrate pH5.6 and 0.2M NH4AcO,
 I wonder if this is a cryo condition already?
 Any suggestions would be appreciated.

 best,




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Equilibrium Relative Humidity matching

[Patrick Shaw Stewart]

Matt, how well does it work in practice?  Did you check the colligative
predictions against the measurements that you originally made?

I agree that the PEG has virtually no effect on the drop equilibration.
This can be seen in comparisons of batch and v.d. e.g.
http://www.douglas.co.uk/convert.htm.  Therefore I always thought that
equilibration in high-PEG experiments was driven by any salts that may be
present - including the salt in the protein, which is easy to overlook.  I
remember a paper by Luft and De Titta about chaperone salts.

However, unless you know the relative effects of different salts, the
result is hard to predict!


On 23 November 2012 16:05, Boaz Shaanan bshaa...@exchange.bgu.ac.il wrote:





 *Boaz Shaanan, Ph.D.
 Dept. of Life Sciences
 Ben-Gurion University of the Negev
 Beer-Sheva 84105
 Israel

 E-mail: bshaa...@bgu.ac.il
 Phone: 972-8-647-2220  Skype: boaz.shaanan
 Fax:   972-8-647-2992 or 972-8-646-1710*
 **
 **
 *

 *
   --

  This leads to a counter-intuitive observation - it is only the number
 of molecules in solution that affect the RH and not the type of
 molecule/ion - therefore one molecule of glycerol has the same contribution
 as a chloride ion or anything else.  This means that there is no effect
 for charge etc.  What does matter is how many species the salt dissociates
 into - this means that a given concentration of sodium malonate (3
 species) will have a lower RH than ammonium sulphate (2 species (NH4+ and
 (NH4SO4)-) and not 3 as might be expected).

 This means that relatvie humidity is a colligative property:
  http://en.wikipedia.org/wiki/Colligative_properties

  Doesn't it? So it should not be too surprising.

Boaz

 On 22/11/2012 18:32, Patrick Shaw Stewart wrote:


  Matt

  My old Rubber Book (Handbook of Physics and Chemistry, 1976) has a
 table (attached) showing the lowering of vapor pressure by salts in
 aqueous solution, taken from the Smithsonian Tables.

  I've never been able to make any sense of it in terms of cations,
 anions, valency, or charge density (position in Hofmeister series), whether
 concentrations are expressed as M or N solutions.

  For example, of the salts mentioned on your website, MgSO4 seems to be
 anomalous.

  My spreadsheet also has a little converter that my colleague wrote many
 years ago to convert vapor diffusion conditions to batch.  This might be of
 interest to people who have to work in batch, e.g. people making crystals
 for X-FEL data collection.  You can download it as a program from
 http://www.douglas.co.uk/vdtomb/vdtomb.htm - it seems to work pretty well.

  Best wishes

  Patrick





 On 22 November 2012 12:11, Matthew Bowler mbow...@embl.fr wrote:

 Dear All,
 after a few requests, I have now added equations to the online
 calculator that uses Raoult's law to calculate the relative humidity
 equilibria for precipitant solutions (see http://go.esrf.eu/RH). The new
 equations (4 and 5) allow the calculation of salt concentrations that will
 be in equilibrium with a certain PEG or other molecule solution - this will
 allow slow and controlled dehydration experiments to be designed in vapour
 diffusion plates, by slowly increasing the salt concentration in the
 reservoir above the equilibrium and thereby reducing the amount of water in
 the crystallisation drop by a controlled amount.   Hope it is useful,
 cheers, Matt.

 --
 Matthew Bowler
 Synchrotron Science Group
 European Molecular Biology Laboratory
 BP 181, 6 rue Jules Horowitz
 38042 Grenoble Cedex 9
 France
 ===
 Tel: +33 (0) 4.76.20.76.37
 Fax: +33 (0) 4.76.88.29.04

 http://www.embl.fr/
 ===




  --
  patr...@douglas.co.ukDouglas Instruments Ltd.
  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
  Directors: Peter Baldock, Patrick Shaw Stewart

  http://www.douglas.co.uk
  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
  Regd. England 2177994, VAT Reg. GB 480 7371 36


 --
 Matthew Bowler
 Synchrotron Science Group
 European Molecular Biology Laboratory
 BP 181, 6 rue Jules Horowitz
 38042 Grenoble Cedex 9
 France
 ===
 Tel: +33 (0) 4.76.20.76.37
 Fax: +33 (0) 4.76.88.29.04
 http://www.embl.fr/
 ===




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Glass Capillaries

[Patrick Shaw Stewart]

The Triana range of capillaries are very easy to use for screening etc


On 12 November 2012 16:13, Michael Roberts mrobert...@talktalk.net wrote:

 Dear All,

 I would be interested to learn of other crystallographers' experience in
 their use of glass capillaries for protein crystal growth and X-ray
 diffraction clarity.
 There are many types of glass available - quartz, soda glass,
 borosilicate, etc. Are there specific types which people prefer for best
 results overall?

 Best wishes,

 Michael Roberts




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Problems in crystallization

[Patrick Shaw Stewart]

Eva

Yes batch under oil will solve the problem.  We regularly used to
crystallize conditions with high levels of MPD under oil without difficulty.

I agree that the protein might be reducing the surface tension, but I've
never heard of such a strong effect.  Maybe the protein is unstable and
wants to denature onto the surface of the plate.

Is it possible that you have any low-molecular-weight organics in your
protein sample?

You could try the UV-compatible versions of crystallization plates
because they're more hydrophobic than the regular PS ones.  The
polypropylene ones are even more hydrophobic, similar to siliconized glass.

Salt precipitants will tend to reduce drop spreading, PEG to increase it.
 It's partly a matter of surface tensions, partly of the affinity of the
ingredients for the plastic/glass.  The air-liquid interface energy
competes with the liquid-solid interface energy.

Patrick




On 7 November 2012 13:41, anna anna marmottalb...@gmail.com wrote:

 Why don't you try batch under oil?

 2012/11/7 Eva Bligt-Lindén eva.bl...@abo.fi

 Dear ccp4 users,

 I have a problem in the crystallization of my target protein. Whenever I
 set up a vapour diffusion experiment, either hanging or sitting drops, the
 drops spread out. The surface tension is completely lost in 80-90% of the
 droplets. Have any one experienced something similar? What could be the
 reason for this strange behaviour? I have tried three different commercial
 screens with 96 condition each and there is no difference between the
 screens. There is no difference between manual or robotic setups either.
 The protein buffer is 40 mM Tris, 2 mM MgCl2 buffer, pH 7.4. The buffer
 controls are all ok.

 Kind regards,
 Eva

 __**__

 Eva Bligt-Lindén (M.Sc.)
 PhD student
 Structural Bioinformatics Laboratory

 Department of Biosciences,
 Åbo Akademi University
 BioCity, Tykistökatu 6A
 FI-20520 Turku
 Finland





-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] inflluence of pH for crystallization on protein 3-D structure

[Patrick Shaw Stewart]

Acoot

You may be interested in some data-mining that we did a few years ago

http://www.douglas.co.uk/PDB_data.htm#Acid-base

We didn't see any obvious correlations


On 28 October 2012 03:00, Acoot Brett acootbr...@yahoo.com wrote:

 Dear All,

 A protein crystal can be got at pH 5 or 8, or a pH with much extreme
 value. What will be the relatively extreme pH value to get the crystal on
 the protein structure solved based on the crystal got? I mean usually we
 regard the physiological pH as 7. If a crystal was got at pH 5, the
 structure solved may be different from the protein structure at pH 7. But
 it seems there is rarely analysis on the discrepancy of the protein
 structures when publishing 3-D structure with the protein crystal got at
 relatively extreme pH.

 I am looking forward to getting your comment on it.

 Cheers,

 Acoot




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Stabilization of crystals and ligand exchange

[Patrick Shaw Stewart]

I say (of course I would!) why not try co-crystallization with random
microseeding using the crystals with the original ligand?

It usually allows you to control the number of crystals per drop too


On 18 October 2012 15:59, Dmitry Rodionov d.rodio...@gmail.com wrote:

 Hi Sabine,

 Glutaraldehyde crosslinking worked pretty good for various soaks in my
 experience.

 J. Appl. Cryst. (1999). 32, 106-112[ doi:10.1107/S002188989801053X ]
 A gentle vapor-diffusion technique for cross-linking of protein crystals
 for cryocrystallography
 C. J. Lusty

 Best regards,
 Dmitry

 On 2012-10-17, at 12:26 PM, Sabine Schneider wrote:

  Hi everyone,
 
  I am trying to get the structure of a protein-ligand complex were I need
 to exchange the ligand which it co-crystallises nicely with.
  Problem: either they crack, disolve, turn brown,...  OR they still look
 very nice, well shaped but do not show a single reflection at the
 synchrotron!!!
 
 
  Here is what I tried so far:
 
  1) initially stabilising with higher precipitant (here PEG1500) before
 slowly transferring (*) it to the ligand-removal solution (= artifical
 mother liquor with higher PEG, ethylen glycol or glucose, but without
 initial ligand)
 
  (*) by slow exchange I mean : initially mixing drop solution with
 stabilising/ligand-removal solution and adding it back to the drop stepwise
 before fully transferring it. Or calculation wise I have fully exchange the
 solution to the new solution
 
  2) here I let them ist over night (if they did not disolve, crack or
 whatever)
  3) slow exchange transfer to the artificial ML with the new ligand
 (10mM), left them over night and directly froze them
 
  'Best' so far (crystals still looking nice but no reflection...) was
 slow exchange into higher PEG, than to higher PEG with ethylenglycol (30%
 and also adding ethylenglycol to the reservoir), let them sit for over
 night, before again slow exchange to the solution with the new ligand in
 higher PEG and 30% ethylen glycol.
 
  As I said here the crystals keep shape, but don't diffract at all
 anymore. Just freezing them with 30% ethylen glycol they diffract nicely to
 2.5A on a home source. But already after step one they are sometimes not
 happy anymore.
 
  Co-crystallisation failed since when I add the ligand, which is not that
 soluble to the purified protein, everything crashed out of solution. I am
 thinking about to test adding the ligand to the diluted protein and
 concentrate it together. But I don't have that much ligand, since the
 synthesis is quite tedious The ligand can be dissolved in 30%
 ethylenglycol to ~50mM
 
  Thus I was wondering if someone has done successfully ligand exchange
 with glutaraldehyd stabilised xtals?
  Or any ideas how to stabilise them? I appreciate any ideas or comments!
 
  Sorry for the lengthy email!
 
  Best,
  Sabine




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] Plate crystals

[Patrick Shaw Stewart]

Jahan

It sounds as though the protein crystallizes well, so microseeding (done
the right way) is very likely to solve the problem.  Make a strong seed
stock with as much crystalline material as possible from several wells,
including different hits if possible.  Just mix them all together, but keep
PEG conditions separate from salt conditions (or you will get two layers).
 Make a set of serial dilutions from neat up to 1 in 100,000 and freeze
them at -80.  You need to seed into *random screens*, so that you can pick
up new conditions.  Then you should optimize two or three new conditions by
using the diluted seed stock.  For example, if you estimate that there are
1000 crystals in the drop, you use the 1:1000 dilution.

For info and references see http://www.douglas.co.uk/mms.htm


On 15 October 2012 23:01, Jahan Alikhajeh ja...@graduate.org wrote:


 Dear Friends,

 I am trying to crystalize a 70 kDa nasty protein but I got plate shape
 crystals with high mosaicity and useless diffraction (up to 4A).
 I tried to improve/optimize crystallization but either I got the same or
 nothing. I tried seeding but I had so many crystals without any
 improvement. Does anyone have better idea than routine optimization method
 in the lab? Thanks in advance.

 Jahan




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] off topic: reproducing hits from organic solvents

[Patrick Shaw Stewart]

Peter

We make a 96-well plate that was originally made for microbatch-under-oil,
which has a large moat or well around the whole plate.

My old friend Lesley Haire had a lot of success with this plate for a
condition that contained isopropanol.

She set up the drops without isoprop, covered them with Al's Oils (silicone
mixed with paraffin oil from Hampton Research), then put water containing
the appropriate concentration of isoprop in the moat (in her case 10 - 20%).

THe isoprop diffused through the oil and into the drops.  Since the oil is
also saturated with isoprop it makes a very good barrier and stops the
isoprop from evaporating from the drops when you harvest your crystals.

As Lesley pointed out you can even set up a random screen without
isopropanol, then diffuse the isopropanol in afterwards.

Let me know if you - or anyone else - would like some samples of the
plate.  Unfortunately it won't fit on a Mosquito, but you can use it by
hand, see ref below.

Regarding your question below, bear in mind that water and oil can both go
through plastic tubes (slowly).

I hope it works for you

Patrick


Refs and info:
See http://www.douglas.co.uk/winner1.htm
http://www.douglas.co.uk/vb.htm
*Nature* *431* (2004), pp 481-485.



On 3 October 2012 17:37, Peter Hsu hsuu...@u.washington.edu wrote:

 Hi all,

 I recently got some hits from a Mosquito grown at 18C with PEG4000 and 10%
 propanol. I've tried reproducing these hits using the standard 24 well
 format with no success, even with playing with PEG and propanol
 concentrations. The initial screening solution was from a kit that's been
 sitting in the cold room for the better part of 2 years. Does anyone here
 have any tips or tricks in reproducing crystals grown from organic solvents?

 Many thanks in advance,

 Peter




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic: Best Scripting Language

[Patrick Shaw Stewart]

Like most computer users and many scientists I don't write scripts to
organize or analyse my data unless I get desperate.  I've used both Python
and Perl a few years ago, but it would take quite a lot of time and effort
and staring at on-line tutorials to get back into either of them right now.
 So I end up using massive Excel files that kind of work, but are a pain.
 I've noticed that quite a few structural biologists have the same problem.

I've never understood why there can't be a simple programming language that
is completely self-explanatory bercause it uses English sentences.  Our
robot scripting language uses syntax like

Dispense 0.5 * DropVol ul to TargetWells using ProteinSyringe

That is pretty obvious.


So why can't I have a language where I can write


Carry_out_a_sequence_where

x is 1 to 10

with_step_size 1 :

if
age of person(x) is_greater_than 50
then
print name of person(x) is an old man (or woman) .

Repeat_for_next x .


?


I don't care if it's efficient (anything is efficient compared to Excel) or
if it's easy to write big programs in.  All I care about is that it's easy
to get going.

Later on I can learn to write simply Sequence instead of
Carry_out_a_sequence_where.  I could click a button that would make the
replacement to make my code more compact and readable to a trained eye.
 And of course  is_greater_than  could be written as   .

Any intelligent school-child could understand it too, which would be
fantastic here in the UK where kids aren't taught to program any more.

Does such a language exist?





On 13 September 2012 17:08, James Stroud xtald...@gmail.com wrote:


 On Sep 13, 2012, at 3:24 AM, Tim Gruene wrote:

 I have the impression that
 python programmers spend a lot of effort in trying to convince others
 that python is a good choice. Why bother rather than let people make
 their own decision?


 Someone asked.

 Plus, python programmers put no more effort than any other programmer.
 It's just that python has more advocates (for good reason) so the apparent
 effort is amplified.

 Don't hate us because our preferred programming language is beautiful.

 James

 --
 James Stroud

 http://www.jamesstroud.com




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improving microcrystals

[Patrick Shaw Stewart]

Samuel

Clearly you should try the rMMS random microseeding approach where
you add a seed stock made from the spherulites to a random screen.


See refs:

Acta Crystallographica section D63 (2007), 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652
Cryst. Growth Des., 2011, 11 (8), pp 3432–3441. On-line at
http://pubs.acs.org/doi/abs/10.1021/cg2001442.
http://www.douglas.co.uk/SER-CAT09_1.html



On 25 August 2012 02:11, Samuel Johnson samueljohnson...@yahoo.in wrote:

 Hi everyone,

   I have been working on a protein for the past year. After a 
 number of trials at crystallizing the protein i have identified conditions 
 for getting spherulites/micro-crystaline material under micro batch method. I 
 have confirmed that the crystalline material is protein, by using Izit-dye 
 test. The condition is 50mM CaCl2, Mes pH 6.5 and 40% PEG 400. I will be 
 happy to get suggestions on improving conditions to obtain single crystals. I 
 have already tried varying a number of parameters like salt, precipitant 
 concentration and buffer pH but that didn't help.

 Thanks.




--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improvement in crystal quality

[Patrick Shaw Stewart]

Niks

Seeding often works very well with needles.  But start with seeding in
RANDOM SCREENS, i.e. rMMS


References -

Allan D’Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007) 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

**Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Random Microseeding: A Theoretical and
Practical Exploration of Seed Stability and Seeding Techniques for
Successful Protein Crystallization'.  Cryst. Growth Des., 2011, 11 (8), pp
3432–3441. On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442

*Chatty article that I wrote for SerCat newsletter in 2009*:
http://www.douglas.co.uk/SER-CAT09_1.html

*A bit of theory*:  http://www.douglas.co.uk/mms.htm

*Procedure*:  http://www.douglas.co.uk/MMS_proc.htm

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal growth
with minimal chemical bias.' Acta Crystallographica Section D66 (2010)
568-576. On-line at http://scripts.iucr.org/cgi-bin/paper?S0907444910005512

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and Gary
L. Gilliland. 'Promoting crystallization of antibody–antigen complexes via
microseed matrix screening.' Acta Crystallographica Section D66 (2010)
927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf




On 24 July 2012 14:40, Niks nik...@gmail.com wrote:

 Dear All,

 I am trying to crystallize a recombinant dehydrogenase protein. Got five
hits in PEG ION Screen from Hamptons (20% PEG 3350 with 0.2M Sodium
Acetate, 0.2M Potassium acetate, 0.2M ammonium acetate, 0.2M sodium formate
and 0.2M Potassium Chloride) after two days.
 Crystals looks like needles most of time, sometime broader needles
(Pictures attached). UV crystal scanner says those are protein crystals,
but when we tried to pick up one and shoot at room temperature, diffraction
patterns looks like similar like of  powder diffraction (picture attached).
 I have tried 50 of the 96 additives(whichever I can arrange of) mentioned
in the additive screen from Hamptons . I have tried detergent screen from
Hamptons (this time original screen solutions). I have tried incubating the
plate at 28degrees as well as 10degrees, Though waiting for 10degree
results but one drop  showed needles again after normal two days of growth
period.
 I tried to slow down the supersaturation by adding 100ul of 1:1 ratio of
silicon oil and paraffin oil over the 1ml of well solution. This time no
crystals but some precipitation.

 If anyone spare any word of wisdom to improve these crystal quality, I
will be very grateful.
 If seeding is the only obvious thing to try, any reference for the
seeding procedure will be highly appreciated.

 Thanks very much
 Nishant Varshney
 PhD student,
 National Chemical Laboratory,Pune,India
 --
 The most difficult phase of  life is not when No one understands you;It
is when you don't understand yourself




--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] Punctuation etc.

[Patrick Shaw Stewart]

Could I make a request?

Could people who ask questions to the bb possibly lay out their questions
clearly, capitalize the word I and use the correct punctuation such as
question marks?

It makes it so much easier to read, and - this is more important -  you
will get more helpful responses if you help people to understand what
you're asking.

Giving your message a meaningful title is also very helpful!

Best wishes to all,

Patrick


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Crystallization with antibody

[Patrick Shaw Stewart]

Try seeding the complex with the crystals that you have.  If you have
crystals of both proteins, crush them and mix them together.  Suspend
the seeds in whichever reservoir solution has the least salt in it*
(or suspend in 50% PEG**) .  Use random Microseed Matrix Screening
(rMMS) i.e. microseeding into random screens***.

rMMS with crystals of one component of a complex has successfully
given crystals of the complex in the past.  It's very quick and easy
to try with a robot or by hand.


*Radaev and Sun, J. Appl. Cryst. (2002). 35, 674-676
** Cryst. Growth Design (2011) 11(8), 3432-3441
*** D’Arcy et al. Acta Cryst. (2007). D63 550-554
 http://www.douglas.co.uk/MMS_proc.htm



On 28 June 2012 13:25, Theresa Hsu theresah...@live.com wrote:
 Dear crystallographers

 Trying to crystallize a membrane protein complex of 100 kDa with a soluble 
 protein of 20 kDa which is interact with the membrane protein. So far, no 
 co-crystals in  200 conditions. Some conditions gave crystals but mass spec 
 of crystals show only either one protein present. I am thinking of antibody 
 but don't know where to start. Can I use the anti-His tag antibody?

 Thank you.



--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] zinc with HEPES/seeding

[Patrick Shaw Stewart]

It sounds as though microseeding worked very well, but the crystals are
still growing far too quickly.

Try diluting the protein and/or the reservoir solution to half the concs
you are using or lower.

To have enough protein you need larger drops, say 500 + 500 + 200 by hand
if you can't do it with the Phoenix (wrong robot of course ;)  Dispense the
seed with a Hamilton syringe, rinsing the needle in the reservoirs before
adding to the drops.

You could also try using large volumes, say 4 ul total, with dilute
ingredients, and make a small hole in the tape with a pin to let the wells
slowly dry out.



On 11 May 2012 18:35, Rajesh Kumar ccp4...@hotmail.com wrote:


 Dear Patrick,

 You along with others had made some suggestions last time. May be its a
 good time to update.

 With classical screening, I got a crystal like appearances/shower with
 HEPES 7.5 and LiSo4 1.5M.  Trying to vary the pH of Hepes or using Tris and
 with different conc of Lithium I could only get very very thin needles
 which shower and difficult to pick even with 0.05 loop. changing conc of
 protein, salt, adding oil on well, changing drop ratio, adding 5% PEGs,
 glycerol, ethylene glycol, didnt reduce shower.

  I prepared the seeds from 7.6 ph and 1.25 M Liso4 conditions and MMS
 screened with all the 4 screens (Qiagen procomplex, classic, peg, JCSG)
 100nl+100nL+50nL seeds using Phoenix.

 Got several nice hits which very good size individual crystals in
 conditions with 30% glycerol and 14% Isopropanol, 20% PEG8K, 30 PEG400.
 When I optimized them I got beautiful crystals and tried at ALS 5.0.3 but
 no spots. I tried picking crystals from 30 min to 4 hrs to 4 days after
 plates were set and there was no luck. Crystals started to appear from 20
 min onwards and keep growing in next couple of hours.  I thought of trying
 dehydration but they were already in dehydrating conditions them selves. I
 wanted to ask if anyone ever failed with MMS but thought not
 waste others time on this. Cross seeding to full length protein and Se met
 protein also gave beautiful crystal but again no diffraction. I have not
 checked SeMet as they were bit small.

  I am still open to ideas if you have any thing on seeding. I did try in
 microbatch and hanging drop as well (1.5 ul protein+ 1.4ul reservor+ 0.4 ul
 seeds, same as sitting drop which gave me very good looking crystals) but I
 didn't get any thing.  I tried streaking with reduced LiSO4 to 1.1 M but
 it didn't give me anything.

 Currently, I am making entropy mutations,  new constructs
 of different lengths to solve the above problem.

 I still want to improve this condition with needles, because I collected a
 4.5A data on one of the needle (just one). I need phases. I have sent some
 Iodide soaks to synchotron (yet to collect data) but manipulating these
 crystal drops with more than 100 tiny needles with a tough membrane on it
 has been frustrating as I end up loosing several drops  to just to fish out
 1-2 needles. I am ready to try   if there any trick left.

 Thanks for lots and lots of help.

 Regards,
 Rajesh
 --
 Date: Fri, 11 May 2012 18:09:54 +0100
 Subject: Re: [ccp4bb] zinc with HEPES
 From: patr...@douglas.co.uk
 To: ccp4...@hotmail.com

 Rajesh

 How did you do the MMS?  By hand or with a robot, and what screens did you
 use?

 and why did you change to HEPES out of interest?

 Patrick


 On 11 May 2012 18:05, Rajesh Kumar ccp4...@hotmail.com wrote:

  The rationale was to see if Zn could make differences in crystal
 morphology. This is because the protein has CxxC and CxxH similar to a zinc
 finger motif.
 All my efforts, additive screening, MMS, streaking, micro batch, hanging
 drop, changing drop ratio, drop shape, did not help me to either increase
 thickness  or change the shape of very very thin needle crystals.
 Yes, I will try very less, 50uM.
 Thanks for helping me to understand.
 Rajesh

  Date: Fri, 11 May 2012 12:53:53 -0400
  Subject: Re: [ccp4bb] zinc with HEPES
  From: liehy...@gmail.com
  To: ccp4...@hotmail.com
 
  Rajesh,
  10mM zinc seems a bit too high. I normally used it at 50uM conc.
  ray
 
  On Fri, May 11, 2012 at 12:26 PM, Rajesh Kumar ccp4...@hotmail.com
 wrote:
   Dear All,
  
   This question sounds simple but I dont know the answer.
   I was preparing a 24 well crystal screen. When I try to use 10 mM
  ZnSO4
   with HEPES (pH 7.6) buffer it precipitates. I tried both ZnCl2 and Zn
   acetate the effect is same.
   I dont know why this Zn in not compatible with HEPES.
   Could you please tell me why is this?
   I appreciate your help.
  
   Thanks
   Rajesh




 --
  patr...@douglas.co.ukDouglas Instruments Ltd.
  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
  Directors: Peter Baldock, Patrick Shaw Stewart

  http://www.douglas.co.uk
  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
  Regd. England 2177994, VAT Reg. GB 480 7371 36




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd

Re: [ccp4bb] Off-topic: Supplying PDB file to reviewers

[Patrick Shaw Stewart]

When I hear of a reviewer holding up a publication and then publishing
something similar, my first reaction is fury and I feel the case should be
investigated and this immoral individual should be exposed.  However I can
see that there are many shades of gray here.  We're all biased in that we
tend to ignore information that conflicts with our previous cherished
beliefs and focus on things that confirm them.  So it can take a long time
to change your mind - sometimes months.  This can lead to indecision and
delays, but in retrospect we tend to think that we would have come to those
conclusions in any case so there's no harm in using the info.

People with a strong sense of duty will get the review done quickly and
make sure that they don't take advantage of the data, but I can see that it
can be tempting.

I think the idea of getting reviewers to sign a piece of paper saying that
there is no immediate conflict of interest i.e. they are not about to
publish something similar, is a good one.  The author could prepare simple
statement describing the topics covered (not the abstract which gives, or
should give, the conclusions).  Then it's not a matter of proving that the
reviewer cheated, only that they had the opportunity to cheat.

I always communicate freely with the editors, e.g. telling them why I don't
want such-and-such to review the paper.  Wouldn't it be possible simply to
ask the editor to check that the reviewer asking for co-ordinates etc is
not close to publishing something that could benefit from the data?

I don't think it's a good idea for reviewers' names to be visible because
that would mean that we would all have to do a far more professional job of
the review.  (I'm not a career scientist but I've been asked to review a
few papers.)

I also agree with those who say that this competitive focus on high impact
journals etc. stifles creativity, is inefficient and gives poor value for
money.

Just some thoughts - probably stating the obvious

Patrick



On 20 April 2012 01:18, Edward A. Berry ber...@upstate.edu wrote:

 Bosch, Juergen wrote:

 To pick a bit on George's point with MR  citation.

 Here's how you can read it in the paper from your favourite competitor:

 A homology model was generated using [fill in any program for ab initio
 prediction] and subsequently used for molecular replacement with Molrep.
 The structure was refined to an Rwork of 21% and Rfree of 24 %.

  Or maybe the structure was solved by MIR, using a lot of heavy atom data
 that
 they had been unable to solve until a fortuitous MR result gave phases
 which
 located the heavy atoms -- No, No, it was that new improved version of
 autosol!
 Anyway, who cares how the heavy atoms were located- the structure was
 solved
 entirely using their data and they have the raw data (image files even) to
 prove it. It was just bad luck with the derivatives that kept them from
 solving it 6 months earlier. They really deserve to have the first
 publication!






-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Unable to reproduce robot tray hits in hand trays

[Patrick Shaw Stewart]

Hi Matt

Rajesh asked a similar question last week, below

Essentially, you have to *reduce *the protein concentration when you scale
up because you lose proportionally more protein from smaller drops.

This usually works very well and we see no reason to use more than 0.3 +
0.3 for initial screening.

There's a page on our web site which explains this in much more detail, see
http://www.douglas.co.uk/Scaling_Up.htm

Best wishes

Patrick


-- Forwarded message --
From: Patrick Shaw Stewart patr...@douglas.co.uk
Date: 19 March 2012 22:29
Subject: Re: [ccp4bb] microseeding
To: Rajesh kumar ccp4...@hotmail.com, ccp4bb@jiscmail.ac.uk



Rajesh

If you set up the volumes you suggest you will probably get precipitation.
This is counterintuitive until you realize that (as Ed says) you will be
losing a lot of protein with those small drops.  When you scale up the
surface area to volume ratio is lower, so a smaller proportion of the
protein is lost.  Therefore you go *up* on the phase diagram and get
precipitation or very small crystals.

Normally halving the amount of protein for the hits from 200 nl drops works
(suggesting that half the protein is lost from such small drops).  Try say
500+1000+500 (don't reduce the volume of seed stock because the solution
that you suspended the crystals in may be important).  Or dilute the
protein and use 1000+1000+500.

For the hits from the 450 nl drops you could reduce or dilute the protein
by say 25.%.

Or make plenty of seed-stock and try seeding into a random screen again
with larger drops, say 1.5+1+0.5 ul

Those tiny crystals should be good for seeding, don't worry about that
(provided they are protein of course).

Streak seeding may work but bear in mind that roughly a third of the
precipitant comes from the seed stock in your 250 nl drops.

You can add the seed stock with a syringe and needle if you don't have
suitable robot ;)

Experience and data-mining suggests that increasing the salt precipitant
(in high-salt drops) or salt additive (in PEG drops) by around 50% may be
helpful too when scaling up - I'm not sure why this works.

Good luck

Patrick






For the hits in the 250 nl drops you are probably losing

On 19 March 2012 20:31, Rajesh kumar ccp4...@hotmail.com wrote:

 Dear All,

 I have few papers in hand which  explain me about microseeding, matrix
 microseeding, and cross seeding.
 I have also read few earlier threads and some more literature in google.
 Using Phoenix robot, I did a matrix micro-seeding and matrix cross
 seeding. I have few hits with this.
 In 96 well I used 100+100+50 nL and 200+200+50 nl (protein+screen+seed) in
 separate expts.
 I have hard time to plan to translate this 96 sitting drop well plate to
 24 well plate to refine the conditions to get better crystals. only 1-2
 hits are small crystals and they are tiny.

  I wonder in 24 well plate, if I should do-
 1)  for Example 500+500+50nl (I am sure I cant add less that 500
 nL precisely)
 2) to a drop of 500+500 nL do microseeding/streaking with a hair

 I appreciate if you could advise and share some practical ways to further
 my experiment.

 Thanks in advance
 Regards,
 Rajesh




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] microseeding

[Patrick Shaw Stewart]

Rajesh

If you set up the volumes you suggest you will probably get precipitation.
This is counterintuitive until you realize that (as Ed says) you will be
losing a lot of protein with those small drops.  When you scale up the
surface area to volume ratio is lower, so a smaller proportion of the
protein is lost.  Therefore you go *up* on the phase diagram and get
precipitant or very small crystals.

Normally halving the amount of protein for the hits from 200 nl drops works
(suggesting that half the protein is lost from such small drops).  Try say
500+1000+500 (don't reduce the volume of seed stock because the solution
that you suspended the crystals in may be important).  Or dilute the
protein and use 1000+1000+500.

For the hits from the 450 nl drops you could reduce or dilute the protein
by say 25.%.

Or make plenty of seed-stock and try seeding into a random screen again
with larger drops, say 1.5+1+0.5 ul

Those tiny crystals should be good for seeding, don't worry about that
(provided they are protein of course).

Streak seeding may work but bear in mind that roughly a third of the
precipitant comes from the seed stock in your 250 nl drops.

You can add the seed stock with a syringe and needle if you don't have
suitable robot ;)

Experience and data-mining suggests that reducing the salt precipitant (in
high-salt drops) or salt additive (in PEG drops) by around 50% may be
helpful too when scaling up - I'm not sure why this works.

Good luck

Patrick






For the hits in the 250 nl drops you are probably losing

On 19 March 2012 20:31, Rajesh kumar ccp4...@hotmail.com wrote:

  Dear All,

 I have few papers in hand which  explain me about microseeding, matrix
 microseeding, and cross seeding.
 I have also read few earlier threads and some more literature in google.
 Using Phoenix robot, I did a matrix micro-seeding and matrix cross
 seeding. I have few hits with this.
 In 96 well I used 100+100+50 nL and 200+200+50 nl (protein+screen+seed) in
 separate expts.
 I have hard time to plan to translate this 96 sitting drop well plate to
 24 well plate to refine the conditions to get better crystals. only 1-2
 hits are small crystals and they are tiny.

  I wonder in 24 well plate, if I should do-
 1)  for Example 500+500+50nl (I am sure I cant add less that 500
 nL precisely)
 2) to a drop of 500+500 nL do microseeding/streaking with a hair

 I appreciate if you could advise and share some practical ways to further
 my experiment.

 Thanks in advance
 Regards,
 Rajesh




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Membrane Protein Crystallization Plates

[Patrick Shaw Stewart]

Yuri

I know this isn't quite what you're asking, but it's helpful to use the COC
(UV permeable) version of plates if you're crystallizing samples that
contain detergent.  It's just that the drops tend to spread very thinly if
you use the normal polystyrene PS plates.  The COC is more hydrophobic.
 (On the other hand we prefer PS plates for normal proteins with no
detergent.)

Patrick


On 25 February 2012 20:35, Yuri Pompeu yuri.pom...@ufl.edu wrote:

 Hello Everyone,
 I am considering the purchase of crystallization plates for membrane
 proteins.
 I would love to hear what some of the community thinks or has experienced
 with these.
 Particulalrly the monoolein and monoolein/cholesterol coated plates ( I am
 not sure I can mention the vendor here but it should not matter)
 So fire away. Is it worth it? Any succes stories? Bad experiences?
 I appreciate the input
 Best,
 Yuri




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Desalting columns

[Patrick Shaw Stewart]

We did some data mining from remark 280 of the PDB in 2004.  Of the 1000
entries that listed [protein], 46 proteins were crystallized below 3.1
mg/ml.  See table 3 at  http://www.douglas.co.uk/PDB_data.htm .

Patrick



On 27 February 2012 16:25, Bernhard Rupp (Hofkristallrat a.D.) 
hofkristall...@gmail.com wrote:

 Why, in the first place, do you feel an urge  to concentrate your protein
 above 3 mg/ml ?

 ** **

 For crystallization, the concentration needs to be 

 **a)  **high enough to achieve supersaturation, meaning close enough
 to the maximum solubility in a given buffer so that the precipitant can
 drive the system in to supersaturation, preferably of a level where
 homogenous nucleation can occur (or you micro-seed, if necessary)

 **b)  **high enough that sufficient material for crystals of
 acceptable size to grow is in the drop, which is generally the case, lest
 micro-crystal showers happen.

 ** **

 There is ample evidence for proteins crystallizing below 3 mg/ml.

 ** **

 The often quoted PDB/BMCD average of somewhere around 10 mg/ml is biased
 towards highly soluble, smaller (lower hanging fruit) proteins.

 ** **

 Sometimes the shape of a distribution matters ;-)

 ** **

 BR

 ** **

 *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of 
 *Sangeetha
 Vedula
 *Sent:* Monday, February 27, 2012 8:02 AM
 *To:* CCP4BB@JISCMAIL.AC.UK
 *Subject:* [ccp4bb] Desalting columns

 ** **

 Dear bb users,

 I am trying to crystallize a ~320 kDa protein that crashes out if
 concentrated past about 3 mg/mL.

 I would like to try to exchange it into various buffer-salt-additive
 combinations to see which buffer works. For a starting point, I'd like to
 use desalting colums.

 Does anyone have suggestions for good buffer exchange and sample recovery?
 I woud like to load about 250 uL onto each column.

 Thanks a lot!

 Best regards,

 Sangeetha.




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Dye for protein affinity measurement

[Patrick Shaw Stewart]

Jiahong

Thermo sells a series of kits called DyLight Fluor for fluorescent
labelling of antibodies or other proteins.  They have everything you need
and they're very convenient and easy to use.  You can pick the excitation
and emission wavelength.  If you label both A and B (or C) with different
colors you will be able to see if both are in your crystals (assuming
crystallization is part of your approach).

You need only label a small percentage of your protein or peptide to see
whether the protein is present in a crystal.

Patrick


http://en.wikipedia.org/wiki/DyLight_Fluor

Forsythe, E.L., Achari, A., and Pusey, Marc L. (2006),  Trace Fluorescent
Labeling for High Throughput Crystallography, Acta Cryst. D62, 339-346.

We used DyLight 350 NHS Ester to check we had protein crystals - see
methods section of *Cryst. Growth Des.*, 2011, *11* (8), pp 3432–3441




2012/2/8 Jiang Jiahong jiang_jiah...@126.com

  Dear all,
 I am looking for some kind of dye for protein affinity comparison, but do
 not know which to choose.

 I know  protein A can contact B to form a complex,now I hope to find
 something simiar with A to act as an inhibitor to block the process of A-B
 complex formation. Maybe a short peptide, a segment of protein A or even
 some organic molecule.

 Because here is a poor access to ITC nor Biacore, I can only rely on some
 dye to check the competence between A and inhibitor candidates.

 If any one can offer any suggestions. That would be so grateful! Any
 way,thank kind-hearted people in advance!

 Regards
  Jiahong







-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] No diffraction

[Patrick Shaw Stewart]

Theresa

You should also try microseeding into *random screens *by making a seed
stock with the crystals that you have, to use with both microbatch and
vapor diffusion experiments.  You will often pick up new and better
conditions and you're more likely to get well-formed crystals right out of
the screens.

I hope it works

Patrick

_

Refs: Allan D’Arcy, Frederic Villarda, May Marsh. An automated microseed
matrix-screening method for protein crystallization.  Acta
Crystallographica section D 63 (2007), 550–554.

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and Gary
L. Gilliland. 'Promoting crystallization of antibody–antigen complexes via
microseed matrix screening.' Acta Crystallographica Section D 66 (2010)
927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal growth
with minimal chemical bias.' Acta Crystallographica Section D 66 (2010)
568-576.

Gregory Ireton and Barry Stoddard.  'Microseed matrix screening to improve
crystals of yeast cytosine deaminase'.  Acta Crystallographica section D60
(2004) 601–605.

Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Random Microseeding: A Theoretical and
Practical Exploration of Seed Stability and Seeding Techniques for
Successful Protein Crystallization'. Cryst. Growth Des., 2011, 11 (8), pp
3432–3441. On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442.  * If
you don't have a subscription to Crystal Growth and Design, click
**here*http://www.douglas.co.uk/mms.htm#CGDFreeCopy
* to obtain a free copy (we're limited to 50 downloads in the first year).*



On 26 January 2012 15:33, Theresa H. Hsu theresah...@live.com wrote:

 Dear crystallographers

 I have a protein of 90 kDa forming dimers. Crystals formed with microbatch
 and vapor diffusion method in 24 hours but no diffraction at home source.
 Dissolved crystals was confirmed to be the protein with mass spec.

 Any suggestions to improve diffraction would be welcome.

 Thanking you in advance.

 Theresa




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Disappearing crystals

[Patrick Shaw Stewart]

 


 --
 Enrico A. Stura D.Phil. (Oxon) ,Tel: 33 (0)1 69 08 4302 Office
 Room 19, Bat.152,   Tel: 33 (0)1 69 08 9449Lab
 LTMB, SIMOPRO, IBiTec-S, CE Saclay, 91191 Gif-sur-Yvette,   FRANCE

 http://www-dsv.cea.fr/en/institutes/institute-of-biology-and-technology-saclay-ibitec-s/unites-de-recherche/department-of-molecular-engineering-of-proteins-simopro/molecular-toxinology-and-biotechnology-laboratory-ltmb/crystallogenesis-e.-stura
 http://www.chem.gla.ac.uk/protein/mirror/stura/index2.html
 e-mail: est...@cea.fr Fax: 33 (0)1 69 08 90 71




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] IUCr committees, depositing images

[Patrick Shaw Stewart]

Could you perhaps use the principle of capture storage that is used by
wild-life photographers with high-speed cameras?

The principle is that the movie is written to the same area of memory,
jumping back to the beginning when it is full (this part is not essential,
but it makes the principle clear).  Then, when the photographer takes his
finger off the trigger, the last x seconds is permanently stored.  So you
keep your wits about you, and press the metaphorical store button just *after
*you have got the movie in the can so to speak

Just a thought

Patrick


On Wed, Oct 26, 2011 at 2:18 PM, John R Helliwell jrhelliw...@gmail.comwrote:

 Dear Frank,
 re 'who will write the grant?'.

 This is not as easy as it sounds, would that it were!

 There are two possible business plans:-
 Option 1. Specifically for MX is the PDB as the first and foremost
 candidate to seek such additional funds for full diffraction data
 deposition for each future PDB deposiition entry. This business plan
 possibility is best answered by PDB/EBI (eg Gerard Kleywegt has
 answered this in the negative thus far at the CCP4 January 2010).

 Option 2 The Journals that host the publications could add the cost to
 the subscriber and/or the author according to their funding model. As
 an example and as a start a draft business plan has been written by
 one of us [JRH] for IUCr Acta Cryst E; this seemed attractive because
 of its simpler 'author pays' financing. This proposed business plan is
 now with IUCr Journals to digest and hopefully refine. Initial
 indications are that Acta Cryst C would be perceived by IUCr Journals
 as a better place to start considering this in detail, as it involves
 fewer crystal structures than Acta E and would thus be more
 manageable. The overall advantage of the responsibility being with
 Journals as we see it is that it encourages such 'archiving of data
 with literature' across all crystallography related techniques (single
 crystal, SAXS, SANS, Electron crystallography etc) and fields
 (Biology, Chemistry, Materials, Condensed Matter Physics etc) ie not
 just one technique and field, although obviously biology is dear to
 our hearts here in the CCP4bb.

 Yours sincerely,
 John and Tom
 John Helliwell  and Tom Terwilliger

 On Wed, Oct 26, 2011 at 9:21 AM, Frank von Delft
 frank.vonde...@sgc.ox.ac.uk wrote:
  Since when has the cost of any project been limited by the cost of
  hardware?  Someone has to implement this -- and make a career out of it;
  thunderingly absent from this thread has been the chorus of volunteers
 who
  will write the grant.
  phx
 
 
  On 25/10/2011 21:10, Herbert J. Bernstein wrote:
 
  To be fair to those concerned about cost, a more conservative estimate
  from the NSF RDLM workshop last summer in Princeton is $1,000 to $3,000
  per terabyte per year for long term storage allowing for overhead in
  moderate-sized institutions such as the PDB.  Larger entities, such
  as Google are able to do it for much lower annual costs in the range of
  $100 to $300 per terabyte per year.  Indeed, if this becomes a serious
  effort, one might wish to consider involving the large storage farm
  businesses such as Google and Amazon.  They might be willing to help
  support science partially in exchange for eyeballs going to their sites.
 
  Regards,
 H. J. Bernstein
 
  At 1:56 PM -0600 10/25/11, James Stroud wrote:
 
  On Oct 24, 2011, at 3:56 PM, James Holton wrote:
 
  The PDB only gets about 8000 depositions per year
 
  Just to put this into dollars. If each dataset is about 17 GB in
  size, then that's about 14 TB of storage that needs to come online
  every year to store the raw data for every structure. A two second
  search reveals that Newegg has a 3GB hitachi for $200. So that's
  about $1000 / year of storage for the raw data behind PDB deposits.
 
  James
 
 



 --
 Professor John R Helliwell DSc




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein melting temperatures

[Patrick Shaw Stewart]

I actually think you *can *make comparisons between different proteins.  We
heard a very nice talk by Jose Marquez about exactly this at the RAMC
meeting recently.

Basically, 45C seemed to be the dividing line.  If your protein melts below
this it's a bad sign for crystallization and may point to setting up your
crystallization experiments at lower temperatures.

Patrick



On Thu, Sep 23, 2010 at 6:04 PM, Anastassis Perrakis a.perra...@nki.nlwrote:

 **

 Hello -

 The excellent paper of McCrary, uses differential scanning
 calorimetry, which will give an absolute measure of thermostability.

 Using Thermofluor I would be afraid you can only assess the relative
 thermostability of one protein in different conditions.
 As your fluorescence reporter would interact differently with exposed
 hydro[hobic patches in different proteins, I would be a bit more careful
 in comparing the Thermofluor results between different proteins ... I
 am not aware of anyone correlating differential scanning calorimetrywith
 Thermofluor data, but I must admit I have not looked up that
 literature recently.

 A.


 On 23 Sep 2010, at 18:40, Philippe DUMAS wrote:

  Le 23/09/2010 17:28, Raji Edayathumangalam a écrit :
 
  Raji
  I suggest having a look to this paper:
  McCrary et al. J. Mol. Biol. 264(1996) 784
  where you will find an interesting study on protein stability and an
  interesting comparison with other proteins.
  Philippe Dumas
 
  Hi Folks,
 
  Sorry for the pre-xtallo question; pre-xtallo right now, but hoping
  to
  take my protein the xtallo way one of these days!
 
  I am currently performing Thermofluor assays with my protein and the
  results show that the Tm is ~45C.  I am looking for some examples of
  proteins and their melting temperatures so that I can gauge where my
  protein falls in the spectrum of unstable-to-stably folded. For
  example, the melting temperature of some forms of lysozyme is 73.8C
  (very stable, I suppose).
 
  Just need a sense for whether my protein is considered unstable or
  somewhat stable. Please could you share some examples.
 
  Many thanks.
  Raji
 
  ---
  Raji Edayathumangalam
  Joint Research Fellow
  Harvard Medical School/
  Brigham and Women's Hospital
  Brandeis University
 
 
  McCrary-JMB264(1996)784.pdfp_dumas.vcf




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein melting temperatures

[Patrick Shaw Stewart]

Susan and everyone,

I should apologise for any confusion that I may have caused.

Rajiv actually asked his question a year ago, and I accidentally replied to
it a year too late!

It's an interesting question though

Patrick

On Wed, Sep 28, 2011 at 5:03 PM, Linda Schuldt lschu...@mb.au.dk wrote:

 **

 Dear Raji,

 what exactly do you mean when you say the melting temperature is 45deg.
 Did you only test one buffer, or did you test many buffers and 45deg is
 the most stable one? If you have only tested one buffer you should run a
 screen testing different buffer systems (pH) and e.g. NaCl concentration
 and glycerol concentrations (or ligands, if your proteins binds any). Then
 you identify the buffer which is stabilizing your protein the most. I have
 seen big impacts on protein stability and crystallization when optimizing
 my buffers like this.

 I think you should not only consider the melting temperature alone, but
 also how the curve looks like. Do you get a high initial flourescence
 (which often indicates partially unfolded protein or hydrophobic patches)
 or do you have very low initial flourescence (which is a good sign for
 compact protein). Another thing to look at is if your transition is sharp
 (the steeper the better). Taking all this together you can judge if your
 protein is happy or not.

 Hope this helps you!

 Linda

 Patrick Shaw Stewart wrote:
  I actually think you *can *make comparisons between different proteins.
  We
  heard a very nice talk by Jose Marquez about exactly this at the RAMC
  meeting recently.
 
  Basically, 45C seemed to be the dividing line.  If your protein melts
  below
  this it's a bad sign for crystallization and may point to setting up your
  crystallization experiments at lower temperatures.
 
  Patrick
 
 
 
  On Thu, Sep 23, 2010 at 6:04 PM, Anastassis Perrakis
  a.perra...@nki.nlwrote:
 
  **
 
  Hello -
 
  The excellent paper of McCrary, uses differential scanning
  calorimetry, which will give an absolute measure of thermostability.
 
  Using Thermofluor I would be afraid you can only assess the relative
  thermostability of one protein in different conditions.
  As your fluorescence reporter would interact differently with exposed
  hydro[hobic patches in different proteins, I would be a bit more careful
  in comparing the Thermofluor results between different proteins ... I
  am not aware of anyone correlating differential scanning calorimetrywith
  Thermofluor data, but I must admit I have not looked up that
  literature recently.
 
  A.
 
 
  On 23 Sep 2010, at 18:40, Philippe DUMAS wrote:
 
   Le 23/09/2010 17:28, Raji Edayathumangalam a écrit :
  
   Raji
   I suggest having a look to this paper:
   McCrary et al. J. Mol. Biol. 264(1996) 784
   where you will find an interesting study on protein stability and an
   interesting comparison with other proteins.
   Philippe Dumas
  
   Hi Folks,
  
   Sorry for the pre-xtallo question; pre-xtallo right now, but hoping
   to
   take my protein the xtallo way one of these days!
  
   I am currently performing Thermofluor assays with my protein and the
   results show that the Tm is ~45C.  I am looking for some examples of
   proteins and their melting temperatures so that I can gauge where my
   protein falls in the spectrum of unstable-to-stably folded. For
   example, the melting temperature of some forms of lysozyme is 73.8C
   (very stable, I suppose).
  
   Just need a sense for whether my protein is considered unstable or
   somewhat stable. Please could you share some examples.
  
   Many thanks.
   Raji
  
   ---
   Raji Edayathumangalam
   Joint Research Fellow
   Harvard Medical School/
   Brigham and Women's Hospital
   Brandeis University
  
  
   McCrary-JMB264(1996)784.pdfp_dumas.vcf
 
 
 
 
  --
   patr...@douglas.co.ukDouglas Instruments Ltd.
   Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
   Directors: Peter Baldock, Patrick Shaw Stewart
 
   http://www.douglas.co.uk
   Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
   Regd. England 2177994, VAT Reg. GB 480 7371 36
 






 ***
 Dr. Linda Schuldt
 Department of Molecular Biology
 University of Aarhus
 Science Park
 Gustav Wieds Vej 10c
 DK-8000 Århus C
 Denmark




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] neutron data measurement

[Patrick Shaw Stewart]

 Third, the size of crystal needed for successful neutron diffraction is
right at the limit of the size of crystal that can be successfully
flash-cooled without inducing excess mosaicity.

Can't the crystal be flash-cooled at high pressure? The inventors of the
Crystal Harp in Zurich use a machine that does this automatically for cryo
e.m., which many universities already have.



On Fri, Sep 23, 2011 at 4:40 PM, Leif Hanson leif.han...@gmail.com wrote:

 This thread caught my attention several days ago and I now have enough time
 to add my two cents worth. These are my own biases and probably do not
 reflect the views of my friends and colleagues at various neutron
 facilities.


 With respect to the size of crystals for neutron diffraction, a good rule
 of thumb is that there should be at least 10exp24 uniformly ordered unit
 cells in a D2O exchanged crystal to have successful diffraction on par
 with rotating anode data measured on a crystal with a tenth the volume.
 Several data sets have been measured from smaller crystals, and
 perdeuteration lowers the volume needed to extract useful information. Most
 of the neutron data has a resolution cutoff of 1.8 to 2.0Å, which permits
 unambiguous placement of deuterons and solvent molecules, especially when
 completing dual refinement of X-ray and neutron data from the same crystal.


 There have been a limited number of low temperature neutron diffraction
 experiments for several reasons. First, of the available neutron beamlines
 for macromolecular data measurement there are only one or two with open flow
 cryostats available, limiting the locations for standard macromolecular
 cryocrystallography. Second, there are a tremendous number of important
 structures that can be done at room temperature. It is difficult to justify
 the time needed for low temperature work to experimental review panels when
 crystals are available to resolve a knotty enzyme mechanism problem. Third,
 the size of crystal needed for successful neutron diffraction is right at
 the limit of the size of crystal that can be successfully flash-cooled
 without inducing excess mosaicity. Most neutron beamlines use some form of
 quasi-Laue data collection strategy. Mosaicities in excess of 0.5º render
 most crystals unusable for neutron data measurement. Remember that a lot of
 uniform unit cells are needed to get a usable diffraction signal from
 neutrons. Often a large flash-cooled cooled crystal appears to have low
 mosaicity when exposed to 0.5mm x-ray beam. However, when placed in the 3mm
 neutron beam, limited streaky low-resolution diffraction appears. It is
 difficult to judge the quality of flash-cooled neutron diffraction sized
 crystal without placing it in the neutron beam. Returning to point 2 it is
 difficult justify the time needed on fishing expedition. So far the only
 large crystals I have been able to flash-cool that met the demands of size
 and crystal perfection had very low solvent content or were grown in high
 levels of cryoprotectant. That said, several critical problems cry out for
 low temp neutron studies so there is every reason to persevere. I would be
 pleased to answer any questions off-line for those of you with more interest
 in neutron cryocrystallography.


 Finally with respect to radiation damage, Benno Schoenborn has had a
 myoglobin crystal in sealed capillary that he has used as a “standard
 candle” for testing neutron beamlines. There has been no discernable
 degradation of the crystal in all the years he has used it. The neutrons
 used for neutron diffraction are ‘cold’ neutrons, usually with energies of 1
 – 10 meV. Damage could come from activated nuclei, but these are usually
 very limited on a molar basis within the crystal. As can be seen with
 Benno’s myoglobin crystal, 30 years of iron activation has yet to produce a
 measurable defect.


 Leif Hanson

 University of Toledo




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Complex seeding

[Patrick Shaw Stewart]

Hi Peter

This idea was discussed at the recent RAMC meeting, and there is at least
one example where it has worked.

Generally, cross-seeding can work as long as you have homology.  See e.g.
 Obmolova et al. Acta Crystallogr. 2010, D66, 927–933.  The same group has
reported seeding a complex with crystals of one of the monomers.

One thing to bear in mind is that there is no point in adding a seed stock
(with e.g. crystals of one of the monomers) if the seed stock destabilizes
your complex.  This is all discussed in great detail and suggestions are
made for finding alternatives in a paper that I mentioned here earlier
(which we published this year) ref below.

Good luck

Patrick

_

“Random Microseeding: A Theoretical and Practical Exploration of Seed
Stability and Seeding Techniques for Successful Protein Crystallization”.
 Shaw Stewart et al, Crystal Growth and Design, 2011, 11 (8), p3432.

On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442





On Wed, Sep 21, 2011 at 6:04 PM, Peter Hsu hsuu...@u.washington.edu wrote:

 Hi all,

 I've been trying to crystallize a 3 protein complex recently with little
 success. However, crystals of each subunit have previously been
 crystallized. I was wondering if any one knows of any literature/experiences
 where people have used seeds from an individual subunit to seed for a
 complex and succeeded? Or is this just a crazy/bad idea?

 Thanks in advance for any input.

 Peter




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] UV imaging of crystals

[Patrick Shaw Stewart]

 microscopes use glass.
  And you can't see 280 nm (and its not good for your eyes)
  so you need some kind of phosphor screen to view the image?
 
 
  Bosch, Juergen wrote:
  I'm replying here to myself :-)
 
  So in an off-board discussion it turns out that the microscope in
 question was a special
  emitted light and not a UV microscope. So real UV microscopes might be
 better for the
  purpose of detecting real crystals.
 
  Sorry for the confusion - had too much sun today :-)
 
  Jürgen
 
  On Sep 15, 2011, at 4:19 PM, Jürgen Bosch wrote:
 
  I once tested such a commercial system in Seattle about 4 years ago. It
 did not impress
  me. In particular the discrimination between salt and protein did not
 work for about 10
  different proteins from which we already had collected data. sure those
 were small
  between 10 and 100 micrometer. Excuse was to few tryptophans
  So in theory it is nice but a cheaper variant might be to add Gfp to
 your protein and
  screen for something green.
  Jürgen
 
  ..
  Jürgen Bosch
  Johns Hopkins Bloomberg School of Public Health
  Department of Biochemistry  Molecular Biology
  Johns Hopkins Malaria Research Institute
  615 North Wolfe Street, W8708
  Baltimore, MD 21205
  Phone: +1-410-614-4742
  Lab: +1-410-614-4894
  Fax: +1-410-955-3655
  http://web.mac.com/bosch_lab/
 
  On Sep 15, 2011, at 16:03, Frank von Delft frank.vonde...@sgc.ox.ac.uk
 wrote:
 
  A while ago I was trying to be cheap, so we played around with it quite
  a bit in the lab. After rediscovering some of the basics of
  signal-to-noise and microscope transmission efficiency and that sort of
  rot, I realised that the commercial systems may not be all that
  ridiculously overpriced after all. Not if one wants to be able to say
  something useful about really really small crystals -- the only ones
  that really matter in the grand scheme of things (big ones are quick to
  test; little ones must first be optimized = money+time).
 
  But maybe I was just being incompetent. Happens.
  phx.
 
 
 
 
  On 15/09/2011 20:50, Andrew Purkiss-Trew wrote:
  Quoting Harman, Christinechristine.har...@fda.hhs.gov:
 
  Hi All,
  I was curious if any of you have tried or even know if it is
  possible to adapt a stereoscope (in my case an Olympus SZX10 model)
  so as to view protein crystals with UV illumination. Basically, I
  want a cheap manual version of what a Rock UV Imager does. I know
  this is probably a crazy dream. However, I would greatly appreciate
  any comments, advice or experience any of you may have.
 
  Molecular Dimension do such an adaptor which fits to existing
 microscopes.
 
  See
  
 http://www.moleculardimensions.com/shopdisplayproducts.asp?id=121cat=X%2DtaLight%3Csup%3E%99%3C%2Fsup%3E+100+%2D+UV+for+Microscope+
 
 
 
  
  This message was sent using IMP, the Internet Messaging Program.
 
  ..
  Jürgen Bosch
  Johns Hopkins University
  Bloomberg School of Public Health
  Department of Biochemistry  Molecular Biology
  Johns Hopkins Malaria Research Institute
  615 North Wolfe Street, W8708
  Baltimore, MD 21205
  Office: +1-410-614-4742
  Lab: +1-410-614-4894
  Fax: +1-410-955-2926
  http://web.mac.com/bosch_lab/
 
 
 
 
 
 





-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Crystals with Organic solvents

[Patrick Shaw Stewart]

Hi Eswar

Firstly, I would certainly try crystal seeding into random screens if
you haven't already tried it.  Refs below.

Secondly, it's very convenient to grow the crystals under oil, and to
soak the organic solvents into the drops, through the oil.  This makes
it much easier to harvest the crystals because the oil becomes
saturated with the solvent and stops it from evaporating when you pick
up the crystals. This approach can be used at the screening stage too.

See Mortuza, et al. High-resolution structure of a retroviral capsid
hexameric amino-terminal domain.  Nature 431 (2004), pp 481-485.  Also
see http://www.douglas.co.uk/winner1.htm

Good luck

Patrick



Allan D’Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007) 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal
growth with minimal chemical bias.' Acta Crystallographica Section D66
(2010) 568-576. On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444910005512

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and
Gary L. Gilliland. 'Promoting crystallization of antibody–antigen
complexes via microseed matrix screening.' Acta Crystallographica
Section D66 (2010) 927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Getting the most out of the random
microseed matrix-screening method in protein crystallization'.  Cryst.
Growth Des., 2011, 11 (8), pp 3432–3441. On-line at
http://pubs.acs.org/doi/abs/10.1021/cg2001442

See also http://www.douglas.co.uk/mms.htm


On Fri, Aug 26, 2011 at 11:55 AM, eswar reddy eswar.uo...@gmail.com wrote:

 Dear All
                     I was working on a Human protein and expression and 
 solubility is good in E.coli  and purification is One step (His-Tag), and i 
 need to cleave the Histag before screens, if not 
 the protein will precipitated and Aggregated, but after trying for 1.2 years 
 i have crystals and they are with Organic solvents, (10 conditions), these 
 crystals are inter grown like broccoli  shaped  and i tried seeding, but it 
 is not successful, and even i tried  with additive screen but the result is 
 the same  is there is any idea to increase the size and shape of 
 my protein crystals.
 Any suggestions will be helpful for me
 Thanks in Advance





--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fab:antigen complex crystallization!!!

[Patrick Shaw Stewart]

Hi Ivan

Did you use microseeding with *random *solutions?

If not see the following paper by Obmolova and Co about exactly this,
microseeding with Fab complexes,
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

For more subtle variations in using microseeding with complexes see
http://pubs.acs.org/doi/abs/10.1021/cg2001442

Good luck

Patrick



On Thu, Jul 28, 2011 at 4:41 AM, xaravich ivan xaravich.i...@gmail.com
wrote:
 Hi everyone,
 I have been trying to crystallize Fab:antigen complex( 50kda:90kDa)
complex
 and initially got needle clusters which after microseeding gave me single
 crystals but they are very small and I could not repeat the results. I
have
 been using HEPES buffer at pH 6.8 to do the final SEC purification step of
 the complex before setting trays.
 I was wondering whether there are some other buffers (that one could
suggest
 eg tris-hcl etc) which have given decent positive results when
crystallizing
 Fab complexes.Though I have gone through individual papers (case by case)
to
 get some idea, It would be great if anyone could direct me to a
 comprehensive literature towards studying the crystatllization conditions
of
 Fab complexes.
  Equally, people who have considerable experience could suggest a list of
 must do steps for such problems which have routinely been practiced in
their
 lab

 Also what is a good storage condition for the excess complex that you want
 to use later?
 I would really appreciate any suggestion,help, direction.
 Thanks
 ivan



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fab:antigen complex crystallization!!!

[Patrick Shaw Stewart]

Ed (and Ivan)

Peter Sun and colleagues published two papers where they show that
crystallization conditions for protein-protein complexes are strongly
biased towards PEG-based rather than high-salt or
organic-solvent-based conditions. This includes antibody-antigen
complexes.

http://www.ncbi.nlm.nih.gov/pubmed/16699187
http://scripts.iucr.org/cgi-bin/paper?do0016

I have heard anecdotally that the same is true of protein-peptide and
protein-small molecule complexes, although I don't know of any
systematic study.

Can anyone shed light on this?

I guess we can look in the Marseilles database

Best wishes to all

Patrick



On Thu, Jul 28, 2011 at 2:32 PM, Ed Pozharski epozh...@umaryland.edu wrote:

 On Thu, 2011-07-28 at 05:07 +0100, Sean Seaver wrote:
  Spoiler - Fabs like ammonium sulfate.

 Not really - in my hands the ammonium sulfate was one hit out of 7.

 While Ivan's question is about Fab complexes with protein antigen, I
 think it brings up a more general question of protein class-dependent
 crystallization bias.  While some general trends exist for classes of
 biopolymers (e.g. MPD is number one precipitant for DNA; protein:DNA
 complexes tend to crystallize in PEG-based conditions), a general idea
 of assigning a preferred precipitant to a protein class is, imho,
 pointless.  Fabs are a good example - one would think that with half of
 the protein more or less the same in all instances some general trends
 should exist.  And perhaps they do, as this

 http://scripts.iucr.org/cgi-bin/paper?S0907444999016224

 seems to suggest.  But alas, Fab crystallization conditions, once you
 look into it, appear to be just as diverse as the same for proteins in
 general.  Crystallization conditions may change radically upon point
 mutation, so why would one expect that a class of proteins sharing some
 50% identity will show unusual love for PEG, ammonium sulfate, sodium
 malonate or any other miracle precipitant?

 Consider this.  Thanks to great engineering at the Douglas Instruments,
 we can routinely set up ~1000 drops for a given protein.  If one of them
 shows a crystalline shower, we celebrate.  To me, the fact that we try
 wrong crystallization conditions 99.9% of the time, proves that any
 attempt to predict crystallization conditions beyond vague things like
 keep pH close to protein pI, sodium malonate is cool, PEG and
 ammonium sulfate are two most successful precipitants in history of
 protein crystallography, etc., is futile.  Time wasted on looking into
 what is the most common precipitant for a particular class of proteins
 is better spent on setting up more trays.

 Cheers,

 Ed.

 --
 Oh, suddenly throwing a giraffe into a volcano to make water is crazy?
     Julian, King of Lemurs



--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] small lysozyme crystals?

[Patrick Shaw Stewart]

James

One thing you should be aware of is that bugs growing in the lysozyme
stock solution can have a dramatic effect on the number and size of
crystals.

(Way, way) back in 1993 when I was in David Blow's lab we noticed an
ageing effect with the lysozyme stock solution; if we dissolved
freeze-dried lysozyme and set up experiments immediately we got a few
large crystals.  If, however, we did exactly the same thing except
that we kept the lysozyme protein stock overnight in an Eppendorf tube
(using a certain batch of tubes), then set up experiments the next
morning, we grew dozens of small crystals.

The effect seemed to be caused by fungi that were growing in the tubes
because fungicides eliminated the effect whereas antibiotics didn't,
see below.

I have often wondered whether people designing e.g. microgravity
experiments that are stored for several days before launching are
aware of this!

Best wishes

Patrick


See http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2142306/

Abstract
This work investigates the influence of storage of lysozyme in
solution on its crystallization. The crystallization of hen egg-white
lysozyme exhibits a storage effect (aging) that depends on the length
of time the lysozyme solution is stored, after dissolving from
freeze-dried powder, before being brought to crystallization
conditions. The number of crystals obtained increases, while their
size decreases, as the solution ages. Observations suggest that this
effect is due to the presence of fungi that multiply in the stored
protein solution. This aging effect was used to control nucleation and
determine the number and size of lysozyme crystals to be formed in a
given sample.

Summary of results
1. Under the particular conditionosf these experiments,
growth of lysozyme crystals depends on thep resence
of a nucleating agent.

2. Aging of lysozyme in solution gives rise to enhanced
nucleation.

3. The aging effect is independent of the source of the
lysozyme powder.

4. Filtration or centrifugation prior to aging does not
eliminate the aging but lessens the number of crystals
grown.

5. The agent responsible for the enhanced nucleation
can be removed by centrifugation or filtration even
after aging has occurred.

6. Desalting increases aging.

7. Aging is prevented by antifungal agents but is not
affected by either class of antibiotics.

8. Aging is eliminated when a filtered solution is stored
in a sterile vial.

9. Nucleation (and consequently the number of crystals
grown) can be controlled by altering the ratio
of freshly filtered and aged protein solution just
prior to crystallization.

On Tue, Jul 26, 2011 at 6:56 PM, James Holton jmhol...@lbl.gov wrote:
 Does anyone out there have a protocol of growing HEWL crystals that are
 all 50-100 microns wide?  I gave this project to a summer student
 recently, thinking it would be easy, but it is turning out to be more
 difficult than I thought.  Keep getting sphereulites instead of small
 crystals.  Yes, I know you can smash a large lysozyme crystal with a
 hammer, but that is not exactly what I was going for.  What I was hoping
 for was a well-defined protocol for growing reference crystals that
 stay evenly illuminated in our x-ray beams as they rotate.  The beam is
 100 um wide.

 I'm sure someone has done this before?

 -James Holton
 MAD Scientist




-- 
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Reproducing crystals.

[Patrick Shaw Stewart]

Jun Yong and Jobichen

(I've mentioned this before, but ) - both of your projects jump out as very
good targets for microseeding with random screens.  This method often gives
extra hits and better crystals because it is more likely that crystals will
grow in the metastable zone.  It often reduces the *need *for optimization.

Read Allan D'Arcy's excellent paper, plus Obmolova et al for a spectacular
example.  Our web site has some recent tips that may help you too.

Good luck

Patrick


D'Arcy, A., Villard, F., Marsh, M. An automated microseed matrix screening
method for protein crystallization, 2007, Acta Crystallographica, D63,
550-554.


G. Obmolova, T. J. Malia, A. Teplyakov, R. Sweet and G. L. Gilliland.
 Promoting crystallization of antibody-antigen complexes via microseed
matrix screening  Acta Cryst. (2010). D66, 927-933


http://www.douglas.co.uk/mms.htm

*
*

On Tue, Apr 12, 2011 at 1:07 PM, Jun Yong Ha j...@princeton.edu wrote:

  Hi all,

 Recently, I produced crystals with MBClass1-64 which contains PEG4000,
 HEPES-Na and NaCl. But, I struggled to reproduce crystals. I tried to set up
 tray with different batch of solution. I got the crystals only from 2008
 solution, but not from fresh ones. I asked technical service of Qiagen, but
 they did not have any stock.

 pH between fresh and old solution is the same. I could reproduce crystals
 with this old solution 100% when setting up.

 Do you have any experience like this? Is PEG4000 degraded or oxidized?

 Please help me.

 Thanks in advance.




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36