subject:"\[galaxy\-user\] Problem"

Re: [galaxy-user] problem with scientific notation sorting and filtering in galaxy

2014-01-31 Thread Dave Clements

Hi Douglas,

I encourage you and anyone else that has encountered this error to up-vote
this issue in the Galaxy Trello board:

  https://trello.com/c/QZlmb0Yf

That will help us prioritize work.  Thanks for reporting this.

Dave C


On Thu, Jan 30, 2014 at 10:24 AM, Douglas Cavener  wrote:

> I have found that numbers in scientific notation (e.g 9.8E-9) are
> incorrectly sorted or filtered by Galaxy. Looks like the negative exponent
> is ignored and so if you sorting something like P values (see example
> below) then you find these ordered above P=1 instead at the other end of
> the list where P is near zero. In the example below a KEGG list is ordered
> on column 5 in asending order by galaxy. If you scroll to the bottom of the
> list, however, you will see the smallest numbers all of which are in
> scientific notation. I should note that I can can copy this into excel and
> excel will properly sort scientific notation. So this seems to be a
> specific problem with Galaxy. I found this problem with both filtering and
> sorting functions of Galaxy.
> Doug Cavener
>
> 410.53261.00.025cfa04146=Peroxisome390.5325 
> 1.00.038cfa04640=Hematopoietic
> cell lineage290.59131.00.044cfa00980=Metabolism of xenobiotics by
> cytochrome P450 220.63101.00.16cfa00140=Steroid hormone biosynthesis28
> 0.56191.00.27cfa05204=Chemical carcinogenesis 
> 110.8531.00.33cfa00511=Other
> glycan degradation250.57161.00.52cfa00600=Sphingolipid metabolism 9
> 0.9021.00.74cfa00740=Riboflavin 
> metabolism230.58141.00.79cfa00380=Tryptophan
> metabolism 150.6861.00.96cfa04977=Vitamin digestion and absorption22
> 0.56171.00.00017cfa00071=Fatty acid metabolism 
> 220.56171.00.00017cfa05150=Staphylococcus
> aureus infection260.53271.00.00017cfa00982=Drug metabolism - cytochrome
> P450 490.44421.00.00018cfa04142=Lysosome560.42471.00.00024cfa04630=Jak-STAT
> signaling pathway 340.48351.00.00026cfa03320=PPAR signaling pathway130.685
> 1.00.00027cfa00531=Glycosaminoglycan degradation 
> 200.56211.00.00043cfa04975=Fat
> digestion and absorption220.54241.00.00043cfa00830=Retinol metabolism 19
> 0.56201.00.00053cfa00565=Ether lipid 
> metabolism140.6.00.00092cfa00591=Linoleic
> acid metabolism 200.53281.00.0011cfa02010=ABC transporters220.50321.0
> 0.0015cfa00280=Valine, leucine and isoleucine degradation 330.1.0
> 0.0020cfa04974=Protein digestion and 
> absorption150.56211.00.0022cfa03440=Homologous
> recombination 140.56191.00.0028cfa00650=Butanoate metabolism350.42481.0
> 0.0035cfa05323=Rheumatoid arthritis 160.52311.00.0043cfa00350=Tyrosine
> metabolism160.52311.00.0043cfa05320=Autoimmune thyroid disease 120.57151.0
> 0.0044cfa00592=alpha-Linolenic acid 
> metabolism150.52301.00.0054cfa00760=Nicotinate
> and nicotinamide metabolism 210.47391.00.0054cfa05144=Malaria840.36661.0
> 0.0059cfa04080=Neuroactive ligand-receptor interaction 
> 160.48331.00.0091cfa05143=African
> trypanosomiasis120.52291.00.011cfa00340=Histidine metabolism 140.48340.99
> 0.015cfa05330=Allograft rejection90.56181.00.015cfa04614=Renin-angiotensin
> system 31.011.00.021cfa00780=Biotin 
> metabolism350.38560.990.021cfa00240=Pyrimidine
> metabolism15 0.44430.990.030cfa04940=Type I diabetes mellitus110.48360.99
> 0.032cfa00563=Glycosylphosphatidylinositol(GPI)-anchor biosynthesis 290.38
> 540.980.032cfa04512=ECM-receptor 
> interaction200.41500.980.034cfa04622=RIG-I-like
> receptor signaling pathway 90.50320.990.037cfa00100=Steroid biosynthesis10
> 0.48370.990.042cfa04950=Maturity onset diabetes of the young 70.54230.99
> 0.042cfa03450=Non-homologous end-joining60.55220.990.055cfa00430=Taurine
> and hypotaurine metabolism 60.55220.990.055cfa00790=Folate biosynthesis22
> 0.38580.970.060cfa05140=Leishmaniasis 120.43460.970.062cfa00512=Mucin
> type O-Glycan biosynthesis30.7540.990.068cfa00061=Fatty acid biosynthesis
> 30.7540.990.068cfa00232=Caffeine metabolism230.37620.960.070cfa04115=p53
> signaling pathway 290.36640.960.071cfa00564=Glycerophospholipid metabolism
> 80.47380.980.071cfa00120=Primary bile acid biosynthesis 
> 200.38590.960.074cfa00561=Glycerolipid
> metabolism190.38570.960.076cfa04612=Antigen processing and presentation 48
> 0.34740.950.076cfa05152=Tuberculosis180.38530.960.077cfa00510=N-Glycan
> biosynthesis 21.011.00.077cfa00290=Valine, leucine and isoleucine
> biosynthesis160.39520.960.079cfa00500=Starch and sucrose metabolism 160.39
> 520.960.079cfa04621=NOD-like receptor signaling 
> pathway120.41490.960.080cfa00410=beta-Alanine
> metabolism 70.47390.970.093cfa00604=Glycosphingolipid biosynthesis -
> ganglio series330.34720.940.094cfa05146=Amoebiasis 
> 80.44410.960.097cfa00900=Terpenoid
> backbone biosynthesis40.57150.980.099cfa00460=Cyanoamino acid metabolism 4
> 0.57150.980.099cfa00750=Vitamin B6 
> metabolism120.40510.950.10cfa00052=Galactose
> metabolism 120.40510.950.10cfa00983=Drug metabolism - other enzymes90.4346
> 0.960.10cfa00040=Pentose and glucuronate interconversions 
> 50.50320.970.11cfa04122=Su

[galaxy-user] problem with scientific notation sorting and filtering in galaxy

2014-01-31 Thread Douglas Cavener

I have found that numbers in scientific notation (e.g 9.8E-9) are incorrectly 
sorted or filtered by Galaxy. Looks like the negative exponent is ignored and 
so if you sorting something like P values (see example below) then you find 
these ordered above P=1 instead at the other end of the list where P is near 
zero. In the example below a KEGG list is ordered on column 5 in asending order 
by galaxy. If you scroll to the bottom of the list, however, you will see the 
smallest numbers all of which are in scientific notation. I should note that I 
can can copy this into excel and excel will properly sort scientific notation. 
So this seems to be a specific problem with Galaxy. I found this problem with 
both filtering and sorting functions of Galaxy. 
Doug Cavener

41  0.5326  1.0 0.025   cfa04146=Peroxisome
39  0.5325  1.0 0.038   cfa04640=Hematopoietic cell 
lineage
29  0.5913  1.0 0.044   cfa00980=Metabolism of 
xenobiotics by cytochrome P450
22  0.6310  1.0 0.16cfa00140=Steroid hormone 
biosynthesis
28  0.5619  1.0 0.27cfa05204=Chemical carcinogenesis
11  0.853   1.0 0.33cfa00511=Other glycan 
degradation
25  0.5716  1.0 0.52cfa00600=Sphingolipid metabolism
9   0.902   1.0 0.74cfa00740=Riboflavin metabolism
23  0.5814  1.0 0.79cfa00380=Tryptophan metabolism
15  0.686   1.0 0.96cfa04977=Vitamin digestion and 
absorption
22  0.5617  1.0 0.00017 cfa00071=Fatty acid metabolism
22  0.5617  1.0 0.00017 cfa05150=Staphylococcus aureus infection
26  0.5327  1.0 0.00017 cfa00982=Drug metabolism - cytochrome 
P450
49  0.4442  1.0 0.00018 cfa04142=Lysosome
56  0.4247  1.0 0.00024 cfa04630=Jak-STAT signaling pathway
34  0.4835  1.0 0.00026 cfa03320=PPAR signaling pathway
13  0.685   1.0 0.00027 cfa00531=Glycosaminoglycan degradation
20  0.5621  1.0 0.00043 cfa04975=Fat digestion and absorption
22  0.5424  1.0 0.00043 cfa00830=Retinol metabolism
19  0.5620  1.0 0.00053 cfa00565=Ether lipid metabolism
14  0.6111  1.0 0.00092 cfa00591=Linoleic acid metabolism
20  0.5328  1.0 0.0011  cfa02010=ABC transporters
22  0.5032  1.0 0.0015  cfa00280=Valine, leucine and isoleucine 
degradation
33  0.4444  1.0 0.0020  cfa04974=Protein digestion and 
absorption
15  0.5621  1.0 0.0022  cfa03440=Homologous recombination
14  0.5619  1.0 0.0028  cfa00650=Butanoate metabolism
35  0.4248  1.0 0.0035  cfa05323=Rheumatoid arthritis
16  0.5231  1.0 0.0043  cfa00350=Tyrosine metabolism
16  0.5231  1.0 0.0043  cfa05320=Autoimmune thyroid disease
12  0.5715  1.0 0.0044  cfa00592=alpha-Linolenic acid metabolism
15  0.5230  1.0 0.0054  cfa00760=Nicotinate and nicotinamide 
metabolism
21  0.4739  1.0 0.0054  cfa05144=Malaria
84  0.3666  1.0 0.0059  cfa04080=Neuroactive ligand-receptor 
interaction
16  0.4833  1.0 0.0091  cfa05143=African trypanosomiasis
12  0.5229  1.0 0.011   cfa00340=Histidine metabolism
14  0.4834  0.990.015   cfa05330=Allograft rejection
9   0.5618  1.0 0.015   cfa04614=Renin-angiotensin system
3   1.0 1   1.0 0.021   cfa00780=Biotin metabolism
35  0.3856  0.990.021   cfa00240=Pyrimidine metabolism
15  0.4443  0.990.030   cfa04940=Type I diabetes mellitus
11  0.4836  0.990.032   
cfa00563=Glycosylphosphatidylinositol(GPI)-anchor biosynthesis
29  0.3854  0.980.032   cfa04512=ECM-receptor interaction
20  0.4150  0.980.034   cfa04622=RIG-I-like receptor signaling 
pathway
9   0.5032  0.990.037   cfa00100=Steroid biosynthesis
10  0.4837  0.990.042   cfa04950=Maturity onset diabetes of the 
young
7   0.5423  0.990.042   cfa03450=Non-homologous end-joining
6   0.5522  0.990.055   cfa00430=Taurine and hypotaurine 
metabolism
6   0.5522  0.990.055   cfa00790=Folate biosynthesis
22  0.3858  0.970.060   cfa05140=Leishmaniasis
12  0.4346  0.970.062   cfa00512=Mucin type O-Glycan 
biosynthesis
3   0.754   0.990.068   cfa00061=Fatty acid biosynthesis
3   0.754   0.990.068   cfa00232=Caffeine metabolism
23  0.3762  0.960.070   cfa04115=p53 signaling pathway
29  0.3664  0.960.071   cfa00564=Glycerophospholipid metabolism
8   0.4738  0.980.071   cfa00120=Primary bile acid

Re: [galaxy-user] problem uploading files

2014-01-21 Thread Jennifer Jackson


Hello Emmanuelle,

I just tested FTP upload and is was fine. The problem is the server 
name, it is now: usegalaxy.org


Same credentials, email and password.

It is difficult to diagnose the URL loading method issue without an 
example. If this is still a problem today, you can send a URL and we can 
provide feedback.


https://wiki.galaxyproject.org/Support#Loading_data

Best,

Jen
Galaxy team

On 1/21/14 3:54 AM, Emmanuelle Lerat wrote:

Hello everyone

I am trying to upload files on galaxy main since yesterday and I can't 
get it work.


The files I want to upload are RNAseq fastq files from ENCODE (about 8 
Go in size). So I first tried to use the http address of the files. 
The job is running forever but without finishing and without error 
message.


I also tried using FTP but in that case, I could not connect to the 
main.g2.bx.psu.edu server (I get the message "ECONNREFUSED - 
Connection refused by server"). I am using my email address as login 
(the same as for galaxy login) and the same password.


Do I do something wrong or is there a global problem?

Thank you in advance for your help.

Sincerely

Emmanuelle




--
Jennifer Hillman-Jackson
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem uploading files

2014-01-21 Thread Emmanuelle Lerat


Hello everyone

I am trying to upload files on galaxy main since yesterday and I can't 
get it work.


The files I want to upload are RNAseq fastq files from ENCODE (about 8 
Go in size). So I first tried to use the http address of the files. The 
job is running forever but without finishing and without error message.


I also tried using FTP but in that case, I could not connect to the 
main.g2.bx.psu.edu server (I get the message "ECONNREFUSED - Connection 
refused by server"). I am using my email address as login (the same as 
for galaxy login) and the same password.


Do I do something wrong or is there a global problem?

Thank you in advance for your help.

Sincerely

Emmanuelle


--
Dr. Emmanuelle LERAT, CR1 CNRS, HDR

Laboratoire Biometrie et Biologie Evolutive
Universite Claude Bernard - Lyon 1
UMR-CNRS 5558 - Bat. Mendel
43 bd du 11 novembre 1918
69622 Villeurbanne cedex
France

Phone: 33+ 4.72.43.29.18
Fax:   33+ 4.72.43.13.88

http://lbbe.univ-lyon1.fr/-Lerat-Emmanuelle-.html

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem reimporting histories

2013-12-18 Thread Jennifer Jackson


Hello,

Yes, this is sometimes problematic. You may have seen this, but a 
discussion about this same topic took place on the galaxy-...@bx.psu.edu 
mailing list earlier. It has more details about why this can occur. 
Also, please try the work-around Jeremy suggests and see if that helps.

http://lists.bx.psu.edu/pipermail/galaxy-dev/2013-December/017773.html

Take care,

Jen
Galaxy team

On 12/18/13 4:48 AM, Alessandro Ogier wrote:

Dear galaxy users,

here at European Institute of Oncology we're deploying a brand new 
galaxy install, but facing problems with history (re)importing.


We have configured a galaxy running on one node where users took a 
"sneek peek" on features while developing a real deployment on nfs and 
cluster integration. Now I have to migrate histories to new galaxy 
install, I'm doing that on behalf my users because we choose to 
integrate with an apache proxy that does reverse proxying and ldap 
authentication.


Yesterday I produced four tar.gz for a user, placed on a temporary 
webserver and then proceeded with reimport on new instance: two where 
reimported, two not.


All those files are relatively small (from 1MB to 13MB), and no clues 
from galaxy debug log:


SUCCESSFUL ONE:

galaxy.jobs DEBUG 2013-12-18 13:29:32,718 (354) Working directory for 
job is: /srv/galaxy/galaxy-dist/database/job_working_directory/000/354
galaxy.jobs.handler DEBUG 2013-12-18 13:29:32,738 (354) Dispatching to 
local runner
galaxy.jobs DEBUG 2013-12-18 13:29:32,826 (354) Persisting job 
destination (destination id: local)

galaxy.jobs.handler INFO 2013-12-18 13:29:32,864 (354) Job dispatched
galaxy.jobs.runners.local DEBUG 2013-12-18 13:29:33,151 (354) 
executing: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py 
http://debian.ieo.eu/drosano/dalia-37.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpLAAF5z --url
galaxy.jobs DEBUG 2013-12-18 13:29:33,326 (354) Persisting job 
destination (destination id: local)
galaxy.jobs.runners.local DEBUG 2013-12-18 13:29:34,451 execution 
finished: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py 
http://debian.ieo.eu/drosano/dalia-37.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpLAAF5z --url

galaxy.jobs DEBUG 2013-12-18 13:29:34,644 job 354 ended
galaxy.datatypes.metadata DEBUG 2013-12-18 13:29:34,644 Cleaning up 
external metadata files


UNSUCCESSFUL ONE:

galaxy.jobs DEBUG 2013-12-18 13:30:42,824 (392) Working directory for 
job is: /srv/galaxy/galaxy-dist/database/job_working_directory/000/392
galaxy.jobs.handler DEBUG 2013-12-18 13:30:42,844 (392) Dispatching to 
local runner
galaxy.jobs DEBUG 2013-12-18 13:30:42,934 (392) Persisting job 
destination (destination id: local)

galaxy.jobs.handler INFO 2013-12-18 13:30:42,963 (392) Job dispatched
galaxy.jobs.runners.local DEBUG 2013-12-18 13:30:43,236 (392) 
executing: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py 
http://debian.ieo.eu/drosano/dalia-138.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpH8buNE --url
galaxy.jobs DEBUG 2013-12-18 13:30:43,400 (392) Persisting job 
destination (destination id: local)
galaxy.jobs.runners.local DEBUG 2013-12-18 13:30:47,524 execution 
finished: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py 
http://debian.ieo.eu/drosano/dalia-138.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpH8buNE --url

galaxy.jobs DEBUG 2013-12-18 13:30:47,711 job 392 ended
galaxy.datatypes.metadata DEBUG 2013-12-18 13:30:47,712 Cleaning up 
external metadata files



sorry for line wraps, I also attached logs.

I cloned your repository on my development machine to try to 
recreate/debug this issue but unfortunately this time I'm unable to 
import successfully any history (plain galaxy instance, sqlite, no ext 
user, no job_conf, either default and stable branches).


I'm attaching the new galaxy instance universe_wsgi.ini and 
job_conf.xml, as you can see they are pretty straight-forward.



What I'm asking to you : which is the correct way for debugging this 
sort of things ? No luck putting some debugging code in


  * lib/galaxy/tools/actions/history_imp_exp.py
  * lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py


maybe I'm missing something ...

also, I'd like to contribute some patch on a couple of minor glitches 
I found, but I'll write to -dev list for that



Thank you, and thanks for this great tool :) ciao


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your s

[galaxy-user] problem reimporting histories

2013-12-18 Thread Alessandro Ogier


Dear galaxy users,

	here at European Institute of Oncology we're deploying a brand new 
galaxy install, but facing problems with history (re)importing.


We have configured a galaxy running on one node where users took a 
"sneek peek" on features while developing a real deployment on nfs and 
cluster integration. Now I have to migrate histories to new galaxy 
install, I'm doing that on behalf my users because we choose to 
integrate with an apache proxy that does reverse proxying and ldap 
authentication.


Yesterday I produced four tar.gz for a user, placed on a temporary 
webserver and then proceeded with reimport on new instance: two where 
reimported, two not.


All those files are relatively small (from 1MB to 13MB), and no clues 
from galaxy debug log:


SUCCESSFUL ONE:

galaxy.jobs DEBUG 2013-12-18 13:29:32,718 (354) Working directory for 
job is: /srv/galaxy/galaxy-dist/database/job_working_directory/000/354
galaxy.jobs.handler DEBUG 2013-12-18 13:29:32,738 (354) Dispatching to 
local runner
galaxy.jobs DEBUG 2013-12-18 13:29:32,826 (354) Persisting job 
destination (destination id: local)

galaxy.jobs.handler INFO 2013-12-18 13:29:32,864 (354) Job dispatched
galaxy.jobs.runners.local DEBUG 2013-12-18 13:29:33,151 (354) executing: 
export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py http://debian.ieo.eu/drosano/dalia-37.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpLAAF5z --url
galaxy.jobs DEBUG 2013-12-18 13:29:33,326 (354) Persisting job 
destination (destination id: local)
galaxy.jobs.runners.local DEBUG 2013-12-18 13:29:34,451 execution 
finished: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py http://debian.ieo.eu/drosano/dalia-37.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpLAAF5z --url

galaxy.jobs DEBUG 2013-12-18 13:29:34,644 job 354 ended
galaxy.datatypes.metadata DEBUG 2013-12-18 13:29:34,644 Cleaning up 
external metadata files


UNSUCCESSFUL ONE:

galaxy.jobs DEBUG 2013-12-18 13:30:42,824 (392) Working directory for 
job is: /srv/galaxy/galaxy-dist/database/job_working_directory/000/392
galaxy.jobs.handler DEBUG 2013-12-18 13:30:42,844 (392) Dispatching to 
local runner
galaxy.jobs DEBUG 2013-12-18 13:30:42,934 (392) Persisting job 
destination (destination id: local)

galaxy.jobs.handler INFO 2013-12-18 13:30:42,963 (392) Job dispatched
galaxy.jobs.runners.local DEBUG 2013-12-18 13:30:43,236 (392) executing: 
export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py http://debian.ieo.eu/drosano/dalia-138.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpH8buNE --url
galaxy.jobs DEBUG 2013-12-18 13:30:43,400 (392) Persisting job 
destination (destination id: local)
galaxy.jobs.runners.local DEBUG 2013-12-18 13:30:47,524 execution 
finished: export GALAXY_SLOTS="1"; python 
/srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py http://debian.ieo.eu/drosano/dalia-138.tar.gz 
/srv/galaxy/galaxy-dist/database/tmp/tmpH8buNE --url

galaxy.jobs DEBUG 2013-12-18 13:30:47,711 job 392 ended
galaxy.datatypes.metadata DEBUG 2013-12-18 13:30:47,712 Cleaning up 
external metadata files



sorry for line wraps, I also attached logs.

I cloned your repository on my development machine to try to 
recreate/debug this issue but unfortunately this time I'm unable to 
import successfully any history (plain galaxy instance, sqlite, no ext 
user, no job_conf, either default and stable branches).


I'm attaching the new galaxy instance universe_wsgi.ini and 
job_conf.xml, as you can see they are pretty straight-forward.



What I'm asking to you : which is the correct way for debugging this 
sort of things ? No luck putting some debugging code in


  * lib/galaxy/tools/actions/history_imp_exp.py
  * lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py


maybe I'm missing something ...

also, I'd like to contribute some patch on a couple of minor glitches I 
found, but I'll write to -dev list for that



Thank you, and thanks for this great tool :) ciao
--
Alessandro Ogier
Specialista Reti e Sistemi - Area Ricerca
Direzione ICT Gruppo IEO/CCM

Istituto Europeo di Oncologia
Via Serio, 15 - 20139 Milan, Italy
P +39 02 94375269
M +39 334 6841627 (9am-6am CET)
E alessandro.og...@ieo.eu
W http://www.ieo.it

galaxy.jobs DEBUG 2013-12-18 13:29:32,718 (354) Working directory for job is: /srv/galaxy/galaxy-dist/database/job_working_directory/000/354
galaxy.jobs.handler DEBUG 2013-12-18 13:29:32,738 (354) Dispatching to local runner
galaxy.jobs DEBUG 2013-12-18 13:29:32,826 (354) Persisting job destination (destination id: local)
galaxy.jobs.handler INFO 2013-12-18 13:29:32,864 (354) Job dispatched
galaxy.jobs.runners.local DEBUG 2013-12-18 13:29:33,151 (354) executing: export GALAXY_SLOTS="1"; python /srv/galaxy/galaxy-dist/lib/galaxy/tools/imp_exp/unpack_tar_gz_archive.py http://debian.ieo.eu/drosano/dalia-37.tar.gz /srv/galaxy/galaxy-di

Re: [galaxy-user] Problem with executable file in FastQC

2013-12-09 Thread Jennifer Jackson


HI Jorge,

I am going to assume that you are working with a local instance, but 
please correct us if that is wrong. Going forward, you will want to ask 
local install questions at: galaxy-...@bx.psu.edu, as that is where the 
development community is most active.

Lists: http://wiki.galaxyproject.org/MailingLists
Search: http://galaxyproject.org/search/getgalaxy/

Have you installed the FastQC binary already? This is required. The page 
that Ross sent explains where to obtain binaries and the instructions at 
each site define how to install the 3rd party tools. Here is the page again.

http://wiki.galaxyproject.org/Admin/Tools/Tool%20Dependencies

Help for making sure that paths are correctly set up is here. If you are 
having an error, but the tool is installed, perhaps a path is incorrect. 
Or if is correct, as a first pass: check for symbolic links and change 
them to hard links. Then restart and see if that helps.

http://wiki.galaxyproject.org/Admin/Config/Tool%20Dependencies

The general guidelines are that if you are having tool install problems, 
make sure that the first is fully installed, then that the second is 
organized correctly. If you need help with the second, use the 
galaxy-...@bx.psu.edu mailing list to ask specific questions, being sure 
to include details about the paths/setup you have done so far.


When you are installing tools from the tool shed, these are the 
instructions:

http://wiki.galaxyproject.org/InstallingRepositoriesToGalaxy
http://wiki.galaxyproject.org/Tool%20Shed#Installing.2C_maintaining_and_uninstalling_tool_shed_repositories_within_a_Galaxy_instance

Please be aware that certain tools may only run on larger servers (just 
as they would if used on the line-command), and that configuration for 
certain tools will require a production set-up, also as Ross noted. If 
you are a biologist and want a simpler set up that is scalable, a cloud 
Galaxy can be a great option:

http://usegalaxy.org/cloud
But here are all:
http://wiki.galaxyproject.org/BigPicture/Choices

Hopefully this helps get you going in the right direction,

Jen
Galaxy team
On 12/9/13 5:38 AM, Jorge Braun wrote:
thanks for the information Ross but I'm lost with the guide for the 
fastqc tool. I don't understand how to resolve "missing tool dependecies"



Date: Mon, 9 Dec 2013 22:30:58 +1100
Subject: Re: [galaxy-user] Problem with executable file in FastQC
From: ross.laza...@gmail.com
To: braun_...@hotmail.com
CC: galaxy-user@lists.bx.psu.edu

Hi, Jorge,
Galaxy source includes the Galaxy interfaces but not the third party 
executables for tools like fastqc or bwa. They can be automagically 
installed if you install the tool from a tool shed but at a guess, you 
are working on your desktop with the fastqc tool in a recent clone of 
galaxy? Unfortunately, the tool can't run until you have the fastqc 
software working in a particular way hinted at in the guide for the 
fastqc tool on the page at 
http://wiki.galaxyproject.org/Admin/Tools/Tool%20Dependencies - try 
that please?


There are things to do to make your instance more reliable and stable 
too - eg 
http://wiki.galaxyproject.org/Admin/Config/Performance/ProductionServer





On Mon, Dec 9, 2013 at 9:48 PM, Jorge Braun <mailto:braun_...@hotmail.com>> wrote:


Hi mates!!

I have a problem with Galaxy... FastQC doesn't run because the
file FastQC.py cann't find executable file FastQC.xml. Almost,
that file is in the same directory called rgenetics, (seeing Linux
terminal) .

someone can help me?

thanks and have a nice day :)




___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mail

Re: [galaxy-user] Problem with executable file in FastQC

2013-12-09 Thread Jorge Braun

thanks for the information Ross but I'm lost with the guide for the fastqc 
tool. I don't understand how to resolve "missing tool dependecies"

Date: Mon, 9 Dec 2013 22:30:58 +1100
Subject: Re: [galaxy-user] Problem with executable file in FastQC
From: ross.laza...@gmail.com
To: braun_...@hotmail.com
CC: galaxy-user@lists.bx.psu.edu

Hi, Jorge,Galaxy source includes the Galaxy interfaces but not the third party 
executables for tools like fastqc or bwa. They can be automagically installed 
if you install the tool from a tool shed but at a guess, you are working on 
your desktop with the fastqc tool in a recent clone of galaxy? Unfortunately, 
the tool can't run until you have the fastqc software working in a particular 
way hinted at in the guide for the fastqc tool on the page at 
http://wiki.galaxyproject.org/Admin/Tools/Tool%20Dependencies - try that please?

There are things to do to make your instance more reliable and stable too - eg 
http://wiki.galaxyproject.org/Admin/Config/Performance/ProductionServer

On Mon, Dec 9, 2013 at 9:48 PM, Jorge Braun  wrote:

Hi mates!!

I have a problem with Galaxy... FastQC doesn't run because the file FastQC.py 
cann't find executable file FastQC.xml. Almost, that file is in the same 
directory called rgenetics, (seeing Linux terminal) . 

someone can help me?

thanks and have a nice day :)

  ___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with executable file in FastQC

2013-12-09 Thread Ross

Hi, Jorge,
Galaxy source includes the Galaxy interfaces but not the third party
executables for tools like fastqc or bwa. They can be automagically
installed if you install the tool from a tool shed but at a guess, you are
working on your desktop with the fastqc tool in a recent clone of galaxy?
Unfortunately, the tool can't run until you have the fastqc software
working in a particular way hinted at in the guide for the fastqc tool on
the page at http://wiki.galaxyproject.org/Admin/Tools/Tool%20Dependencies -
try that please?

There are things to do to make your instance more reliable and stable too -
eg http://wiki.galaxyproject.org/Admin/Config/Performance/ProductionServer

On Mon, Dec 9, 2013 at 9:48 PM, Jorge Braun  wrote:

> Hi mates!!
>
> I have a problem with Galaxy... FastQC doesn't run because the file
> FastQC.py cann't find executable file FastQC.xml. Almost, that file is in
> the same directory called rgenetics, (seeing Linux terminal) .
>
> someone can help me?
>
> thanks and have a nice day :)
>
>
>
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with executable file in FastQC

2013-12-09 Thread Jorge Braun

Hi mates!!

I have a problem with Galaxy... FastQC doesn't run because the file FastQC.py 
cann't find executable file FastQC.xml. Almost, that file is in the same 
directory called rgenetics, (seeing Linux terminal) . 

someone can help me?

thanks and have a nice day :)
  ___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem loading BAM into IGV browser - invalid GZIP header error message

2013-12-02 Thread Vosberg, Sebastian

Hey,


after clicking on the appropriate link in the Galaxy history, a new tab 
(without any further content) opens. It is loading until the IGV has completed 
to import the BAM, that's how it always used to work.

IGV is currently the Version 2.3.12, but also other versions are in use. I am 
using a VPN tunnel connection to access the Galaxy system (not Galaxy main).

As I said, in most cases (80-90%) it works without any problems to load BAM 
files into IGV. Unfortunately not for every single sample

Thanks again!

Best,
Sebastian
---

From: Jim Johnson [johns...@umn.edu]
Sent: Friday, November 29, 2013 10:35 PM
To: Vosberg, Sebastian; jrobi...@broadinstitute.org
Cc: galaxy-user@lists.bx.psu.edu
Subject: Re: Problem loading BAM into IGV browser - invalid GZIP header error 
message

Is galaxy returning an html page rather than the desired bam file?

Are you using an nginx or apache  proxy server to your galaxy server?
I think that may be required, in order to view BAM files in IGV directly from 
Galaxy.

JJ



On 11/29/13, 11:00 AM, galaxy-user-requ...@lists.bx.psu.edu wrote:
> Send galaxy-user mailing list submissions to
>   galaxy-user@lists.bx.psu.edu
>
> To subscribe or unsubscribe via the World Wide Web, visit
>   http://lists.bx.psu.edu/listinfo/galaxy-user
> or, via email, send a message with subject or body 'help' to
>   galaxy-user-requ...@lists.bx.psu.edu
>
> You can reach the person managing the list at
>   galaxy-user-ow...@lists.bx.psu.edu
>
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of galaxy-user digest..."
>
>
> HEY!  This is important!  If you reply to a thread in a digest, please
> 1. Change the subject of your response from "Galaxy-user Digest Vol ..." to 
> the original subject for the thread.
> 2. Strip out everything else in the digest that is not part of the thread you 
> are responding to.
>
> Why?
> 1. This will keep the subject meaningful.  People will have some idea from 
> the subject line if they should read it or not.
> 2. Not doing this greatly increases the number of emails that match search 
> queries, but that aren't actually informative.
>
> Today's Topics:
>
> 1. Problem loading BAM into IGV browser - invalid GZIP header
>error message (Vosberg, Sebastian)
> 2. Re: Problem loading BAM into IGV browser - invalid GZIP
>header error message (Jim Robinson)
>
>
> ------
>
> Message: 1
> Date: Fri, 29 Nov 2013 11:04:48 +0100
> From: "Vosberg, Sebastian" 
> To: "galaxy-user@lists.bx.psu.edu" 
> Subject: [galaxy-user] Problem loading BAM into IGV browser - invalid
>   GZIP header error message
> Message-ID:
>   <20854588711e4a489a3ad70c9ba5548a01ae291c4...@xch11.scidom.de>
> Content-Type: text/plain; charset="utf-8"
>
> Dear all,
>
>
> sometimes I encouter a problem trying to load BAM files directly from Galaxy 
> into the IGV browser. First I am starting the IGV browser locally, then 
> clicking on the appropriate BAM file and on "display with IGV _local_" in 
> Galaxy. In most cases it works, but for some reasons not with specific files. 
> The error message says
>
> "Error loading http://_URL-to-file_/galaxy_example.bam: An error occured 
> while accessing http://_URL-to-file_/galaxy_example.bam
> Invalid GZIP header"
>
> What does it mean? And why am I able to download the BAM file and load it 
> from HDD into the IGV?
> The problem comes with all BAM files of one sample cohort, but not with 
> another (but same sample design and workflow used). Rerunning the workflow 
> doesn't help...
>
>
> I would be very thankful for every kind of help!
>
>
> Best,
> Sebastian
>
> Helmholtz Zentrum M?nchen
> Deutsches Forschungszentrum f?r Gesundheit und Umwelt (GmbH)
> Ingolst?dter Landstr. 1
> 85764 Neuherberg
> www.helmholtz-muenchen.de
> Aufsichtsratsvorsitzende: MinDir?in B?rbel Brumme-Bothe
> Gesch?ftsf?hrer: Prof. Dr. G?nther Wess, Dr. Nikolaus Blum, Dr. Alfons Enhsen
> Registergericht: Amtsgericht M?nchen HRB 6466
> USt-IdNr: DE 129521671
>
>
>
> --
>
> Message: 2
> Date: Fri, 29 Nov 2013 09:42:42 -0500
> From: Jim Robinson 
> To: "Vosberg, Sebastian" ,
>   "galaxy-user@lists.bx.psu.edu" 
> Subject: Re: [galaxy-user] Problem loading BAM into IGV browser -
>   invalid GZIP header error message
> Message-ID: <5298a7e2.7000...@broadinstitute.org>
> Content-Type: text/plain; charset=

Re: [galaxy-user] Problem loading BAM into IGV browser - invalid GZIP header error message

2013-11-29 Thread Jim Johnson


Is galaxy returning an html page rather than the desired bam file?

Are you using an nginx or apache  proxy server to your galaxy server?
I think that may be required, in order to view BAM files in IGV directly from 
Galaxy.

JJ



On 11/29/13, 11:00 AM, galaxy-user-requ...@lists.bx.psu.edu wrote:

Send galaxy-user mailing list submissions to
galaxy-user@lists.bx.psu.edu

To subscribe or unsubscribe via the World Wide Web, visit
http://lists.bx.psu.edu/listinfo/galaxy-user
or, via email, send a message with subject or body 'help' to
galaxy-user-requ...@lists.bx.psu.edu

You can reach the person managing the list at
galaxy-user-ow...@lists.bx.psu.edu

When replying, please edit your Subject line so it is more specific
than "Re: Contents of galaxy-user digest..."


HEY!  This is important!  If you reply to a thread in a digest, please
1. Change the subject of your response from "Galaxy-user Digest Vol ..." to the 
original subject for the thread.
2. Strip out everything else in the digest that is not part of the thread you 
are responding to.

Why?
1. This will keep the subject meaningful.  People will have some idea from the 
subject line if they should read it or not.
2. Not doing this greatly increases the number of emails that match search 
queries, but that aren't actually informative.

Today's Topics:

1. Problem loading BAM into IGV browser - invalid GZIP header
   error message (Vosberg, Sebastian)
2. Re: Problem loading BAM into IGV browser - invalid GZIP
   header error message (Jim Robinson)


--

Message: 1
Date: Fri, 29 Nov 2013 11:04:48 +0100
From: "Vosberg, Sebastian" 
To: "galaxy-user@lists.bx.psu.edu" 
Subject: [galaxy-user] Problem loading BAM into IGV browser - invalid
GZIP header error message
Message-ID:
<20854588711e4a489a3ad70c9ba5548a01ae291c4...@xch11.scidom.de>
Content-Type: text/plain; charset="utf-8"

Dear all,


sometimes I encouter a problem trying to load BAM files directly from Galaxy into the IGV 
browser. First I am starting the IGV browser locally, then clicking on the appropriate 
BAM file and on "display with IGV _local_" in Galaxy. In most cases it works, 
but for some reasons not with specific files. The error message says

"Error loading http://_URL-to-file_/galaxy_example.bam: An error occured while 
accessing http://_URL-to-file_/galaxy_example.bam
Invalid GZIP header"

What does it mean? And why am I able to download the BAM file and load it from 
HDD into the IGV?
The problem comes with all BAM files of one sample cohort, but not with another 
(but same sample design and workflow used). Rerunning the workflow doesn't 
help...


I would be very thankful for every kind of help!


Best,
Sebastian

Helmholtz Zentrum M?nchen
Deutsches Forschungszentrum f?r Gesundheit und Umwelt (GmbH)
Ingolst?dter Landstr. 1
85764 Neuherberg
www.helmholtz-muenchen.de
Aufsichtsratsvorsitzende: MinDir?in B?rbel Brumme-Bothe
Gesch?ftsf?hrer: Prof. Dr. G?nther Wess, Dr. Nikolaus Blum, Dr. Alfons Enhsen
Registergericht: Amtsgericht M?nchen HRB 6466
USt-IdNr: DE 129521671



--

Message: 2
Date: Fri, 29 Nov 2013 09:42:42 -0500
From: Jim Robinson 
To: "Vosberg, Sebastian" ,
"galaxy-user@lists.bx.psu.edu" 
Subject: Re: [galaxy-user] Problem loading BAM into IGV browser -
invalid GZIP header error message
Message-ID: <5298a7e2.7000...@broadinstitute.org>
Content-Type: text/plain; charset=UTF-8; format=flowed

Hi Sebastian,

Is it possible to share an example bam that exhibits this problem on a
Galaxy server I can reach?   Also, which version of IGV are you using
(select Help > About... to see the version).

-- Jim


Dear all,


sometimes I encouter a problem trying to load BAM files directly from Galaxy into the IGV 
browser. First I am starting the IGV browser locally, then clicking on the appropriate 
BAM file and on "display with IGV _local_" in Galaxy. In most cases it works, 
but for some reasons not with specific files. The error message says

"Error loading http://_URL-to-file_/galaxy_example.bam: An error occured while 
accessing http://_URL-to-file_/galaxy_example.bam
Invalid GZIP header"

What does it mean? And why am I able to download the BAM file and load it from 
HDD into the IGV?
The problem comes with all BAM files of one sample cohort, but not with another 
(but same sample design and workflow used). Rerunning the workflow doesn't 
help...


I would be very thankful for every kind of help!


Best,
Sebastian

Helmholtz Zentrum M?nchen
Deutsches Forschungszentrum f?r Gesundheit und Umwelt (GmbH)
Ingolst?dter Landstr. 1
85764 Neuherberg
www.helmholtz-muenchen.de
Aufsichtsratsvorsitzende: MinDir?in B?rbel Brum

Re: [galaxy-user] Problem loading BAM into IGV browser - invalid GZIP header error message

2013-11-29 Thread Jim Robinson


Hi Sebastian,

Is it possible to share an example bam that exhibits this problem on a 
Galaxy server I can reach?   Also, which version of IGV are you using 
(select Help > About... to see the version).


-- Jim


Dear all,


sometimes I encouter a problem trying to load BAM files directly from Galaxy into the IGV 
browser. First I am starting the IGV browser locally, then clicking on the appropriate 
BAM file and on "display with IGV _local_" in Galaxy. In most cases it works, 
but for some reasons not with specific files. The error message says

"Error loading http://_URL-to-file_/galaxy_example.bam: An error occured while 
accessing http://_URL-to-file_/galaxy_example.bam
Invalid GZIP header"

What does it mean? And why am I able to download the BAM file and load it from 
HDD into the IGV?
The problem comes with all BAM files of one sample cohort, but not with another 
(but same sample design and workflow used). Rerunning the workflow doesn't 
help...


I would be very thankful for every kind of help!


Best,
Sebastian

Helmholtz Zentrum München
Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH)
Ingolstädter Landstr. 1
85764 Neuherberg
www.helmholtz-muenchen.de
Aufsichtsratsvorsitzende: MinDir´in Bärbel Brumme-Bothe
Geschäftsführer: Prof. Dr. Günther Wess, Dr. Nikolaus Blum, Dr. Alfons Enhsen
Registergericht: Amtsgericht München HRB 6466
USt-IdNr: DE 129521671

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem loading BAM into IGV browser - invalid GZIP header error message

2013-11-29 Thread Vosberg, Sebastian

Dear all,


sometimes I encouter a problem trying to load BAM files directly from Galaxy 
into the IGV browser. First I am starting the IGV browser locally, then 
clicking on the appropriate BAM file and on "display with IGV _local_" in 
Galaxy. In most cases it works, but for some reasons not with specific files. 
The error message says

"Error loading http://_URL-to-file_/galaxy_example.bam: An error occured while 
accessing http://_URL-to-file_/galaxy_example.bam
Invalid GZIP header"

What does it mean? And why am I able to download the BAM file and load it from 
HDD into the IGV?
The problem comes with all BAM files of one sample cohort, but not with another 
(but same sample design and workflow used). Rerunning the workflow doesn't 
help...


I would be very thankful for every kind of help!


Best,
Sebastian

Helmholtz Zentrum München
Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH)
Ingolstädter Landstr. 1
85764 Neuherberg
www.helmholtz-muenchen.de
Aufsichtsratsvorsitzende: MinDir´in Bärbel Brumme-Bothe
Geschäftsführer: Prof. Dr. Günther Wess, Dr. Nikolaus Blum, Dr. Alfons Enhsen
Registergericht: Amtsgericht München HRB 6466
USt-IdNr: DE 129521671

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem running Augustus

2013-10-16 Thread Björn Grüning

Hi Claudio,

did you installed Augustus with the ToolShed?
The env variable $AUGUSTUS_SCRIPT_PATH need to be set and point to the
augustus wrapper folder containing the extract_features.py script.

Hope that helps!
Bjoern

> Hello,
> 
> 
> I am trying to use the genome Annotation tool Augustus on my locally
> installed copy of Galaxy. After loading the data file, all analyses
> stop and deliver the following:
> 
> 
> error
> an error occurred with this dataset: /bin/sh:1:augustus: not found
> python: can't open file: '/extract_features.py': [Errno 2] No such
> file or directory
> 
> 
> Python is installed on my system (Ubuntu 12.04, Python 2.7.3)
> 
> 
> It must be something very basic I'm missing, but more basic are my
> linux skills…
> 
> 
> Thanks a lot
> 
> 
> Claudio
> 
> 
> 
> ~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^
> Claudio Slamovits,
> Canadian Institute for Advanced Research
> Department of Biochemistry and Molecular Biology
> Dalhousie University
> 5850 College Street, Halifax, Nova Scotia
> B3H 4R2, Canada
> 
> Lab Webpage: http://slamo.biochem.dal.ca
> Lab: (902) 494 7894
> Office: (902) 494 8825
> Fax: (902) 494 1355
> ^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~
> 
> 
> "Reality is what it is, not what you want it to be." 
> - Frank Zappa 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem running Augustus

2013-10-16 Thread Bjoern Gruening

Hi Claudio,

I will have a look at it, at latest tomorrow, promised.

Cheers,
Bjoern (Augustus wrapper developer)

> 
> 
> I am trying to use the genome Annotation tool Augustus on my locally
> installed copy of Galaxy. After loading the data file, all analyses
> stop and deliver the following:
> 
> 
> error
> an error occurred with this dataset: /bin/sh:1:augustus: not found
> python: can't open file: '/extract_features.py': [Errno 2] No such
> file or directory
> 
> 
> Python is installed on my system (Ubuntu 12.04, Python 2.7.3)
> 
> 
> It must be something very basic I'm missing, but more basic are my
> linux skills…
> 
> 
> Thanks a lot
> 
> 
> Claudio
> 
> 
> 
> ~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^
> Claudio Slamovits,
> Canadian Institute for Advanced Research
> Department of Biochemistry and Molecular Biology
> Dalhousie University
> 5850 College Street, Halifax, Nova Scotia
> B3H 4R2, Canada
> 
> Lab Webpage: http://slamo.biochem.dal.ca
> Lab: (902) 494 7894
> Office: (902) 494 8825
> Fax: (902) 494 1355
> ^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~
> 
> 
> "Reality is what it is, not what you want it to be." 
> - Frank Zappa 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem running Augustus

2013-10-16 Thread Claudio Slamovits

Hello,

I am trying to use the genome Annotation tool Augustus on my locally installed 
copy of Galaxy. After loading the data file, all analyses stop and deliver the 
following:

error
an error occurred with this dataset: /bin/sh:1:augustus: not found 
python: can't open file: '/extract_features.py': [Errno 2] No such file or 
directory

Python is installed on my system (Ubuntu 12.04, Python 2.7.3)

It must be something very basic I'm missing, but more basic are my linux skills…

Thanks a lot

Claudio



~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^
Claudio Slamovits,
Canadian Institute for Advanced Research
Department of Biochemistry and Molecular Biology
Dalhousie University
5850 College Street, Halifax, Nova Scotia
B3H 4R2, Canada

Lab Webpage: http://slamo.biochem.dal.ca
Lab: (902) 494 7894
Office: (902) 494 8825
Fax: (902) 494 1355
^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~


"Reality is what it is, not what you want it to be." 
- Frank Zappa 

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with logging in after resetting password

2013-10-01 Thread Siew-Lan Ang

Hello,

I am having problems accessing my galaxy account. I forgot my password and 
asked for it to be reset. When the new password was sent to me, it didn't work 
when I tried it. I've resetted 4x and each time the new password hasn't worked 
to log.  Hope you can solve the problem.

Regards,
Siew-Lan Ang


Siew-Lan Ang
NIMR
The Ridgeway
London, NW7 1AA
UK
Tel: 44 (0)2088162426
Fax: 44 (0)2088162523








smime.p7s
Description: S/MIME cryptographic signature
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with cuffdiff

2013-09-16 Thread Jennifer Jackson


Hello Giuseppe,

If you haven't resolved this yet, then I would suggested double checking 
that the chromosome identifiers in the reference annotation file are 
/exactly the same/ as in the reference genome. You can run Picard's 
tools to get summary stats on Tophat's BAM outout files to see the 
reference genome idenifiers, or use SAMTools' BAM->SAM to examine.


In general, it is simpler to change the reference annotation's 
identifiers to match those in reference genome. As the file is small, a 
simple find/replace in a text editor is a common solution.


Hope this helps,

Jen
Galaxy team

On 9/10/13 3:22 PM, Ianiri, Giuseppe wrote:

Hy guys,
I am performing some RNA sequencing. I am using a gtf file as a 
reference annotation for the cufflink - cuffmerge steps. Then when I 
do the cuffdiff I find something strange. Where there is the gene 
name, the corresponding values (all of them!) are 0, where there is no 
gene name there are values of expression, fold change etc.
Does anyone have an idea of what is going on? I haven't find any 
similar question in the Galaxy archive.
Also, I tried to visualize my outputs (TopHat Cufflink Cuffmerge) 
using Trackster but it gives me an error. Is anyone experiencing the 
same problem?

Thanks,

Giuseppe



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with cuffdiff

2013-09-10 Thread Ianiri, Giuseppe

Hy guys,
I am performing some RNA sequencing. I am using a gtf file as a reference 
annotation for the cufflink - cuffmerge steps. Then when I do the cuffdiff I 
find something strange. Where there is the gene name, the corresponding values 
(all of them!) are 0, where there is no gene name there are values of 
expression, fold change etc.
Does anyone have an idea of what is going on? I haven't find any similar 
question in the Galaxy archive.
Also, I tried to visualize my outputs (TopHat Cufflink Cuffmerge) using 
Trackster but it gives me an error. Is anyone experiencing the same problem?
Thanks,


Giuseppe
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with bowtie

2013-08-29 Thread Jennifer Jackson


Hi MIchael,

Glad Ido (thanks!) was able to help - the advise was totally correct, 
your data does appear to be in .fastqsanger format already and can just 
be assigned to be recognized by tools. When unsure going forward, run 
FastQC.


If you need more help about working with FASTQ data in Galaxy, see this 
wiki section and the next for some orientation:

http://wiki.galaxyproject.org/Support#Tool_doesn.27t_recognize_dataset

Best,

Jen
Galaxy team

On 8/26/13 8:17 AM, Law, Michael J. wrote:

Hello,
I am completely new to using galaxy. I have a quick question. I have 
uploaded my fastq files generated from my experiment for alignments 
using bowtie. I try to set up the alignment, only to receive the error 
message that I don't have any sequences with ASCII encoded quality 
scores. However, when I contact my sequencing facility, they say that 
the scores are present in the files and that it may be an issue with 
galaxy.

Any help you can provide would be appreciated!
Thanks,
Mike


Michael Law
la...@rowan.edu 





___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with bowtie

2013-08-27 Thread Ido Tamir

the file looks good to me (illumina 1.8 because of the ?). I might have 
misunderstood the error message.
If it comes from galaxy when you try to use this file, then you have not
specified the correct file format to galaxy.
You have to change its type to fastqsanger by clicking on the pencil.

HTH,
ido

On Aug 27, 2013, at 5:05 PM, "Law, Michael J."  wrote:

> Of courseHere is an example:
> @HWI-ST1160:394:C1J65ACXX:7:1101:1520:2235 1:N:0:TTAGGC
> CTGACATAGTCTGGTGCGGCAACAATCATTCTTGCCATGAGCCCACCTAG
> +
> @CCDFFFDHDHHGIFHIIJIGIJ9FIHIBHIIECE@EGGJGHJJBH
> @HWI-ST1160:394:C1J65ACXX:7:1101:1946:2192 1:N:0:TTAGGC
> GCGGATATTGGTACAATAGGAGCACCGTCAGCAATGGTACCTCTGATGAA
> +
> @CCFDDFFHJIJHIJGJGIJI?DGGIJJJGIIIJ
> @HWI-ST1160:394:C1J65ACXX:7:1101:1851:2248 1:N:0:TTAGGC
> CTTTGAGTGAACCTCGTCCGGTACTGCTATTGCCATGTATTATGTG
> +
> @CCFDEFDFHHGHJJJHCGHIJJJIJJI@FIJJJHIJDGGFF
> @HWI-ST1160:394:C1J65ACXX:7:1101:2249:2219 1:N:0:TTAGGC
> TCCTCAACCAGTCTTCCCATCATTTGACTCCAGTGCAGTGAAATCG
> +
> CCCFGHHFHJIJIIIJIEHHGIIFHHIIIJHGIJJIJJ
> Also, whenever I send an email, it says I am not a member, but I have a login 
> (clearly since I have used ftp for data upload). How do I fix this?
> Thanks so much,
> Mike
> 
> Michael Law
> la...@rowan.edu
> 
> 
> 
> On Aug 27, 2013, at 4:44 AM, Ido Tamir wrote:
> 
>> You should add 10 lines from one of your files.
>> Then its easier to understand the problem.
>> 
>> best,
>> ido
>> 
>> 
>> On Aug 26, 2013, at 5:17 PM, "Law, Michael J."  wrote:
>> 
>>> Hello,
>>> I am completely new to using galaxy. I have a quick question. I have 
>>> uploaded my fastq files generated from my experiment for alignments using 
>>> bowtie. I try to set up the alignment, only to receive the error message 
>>> that I don't have any sequences with ASCII encoded quality scores. However, 
>>> when I contact my sequencing facility, they say that the scores are present 
>>> in the files and that it may be an issue with galaxy.
>>> Any help you can provide would be appreciated!
>>> Thanks,
>>> Mike
>>> 
>>> 
>>> Michael Law
>>> la...@rowan.edu
>>> 
>>> 
>>> 
>>> ___
>>> The Galaxy User list should be used for the discussion of
>>> Galaxy analysis and other features on the public server
>>> at usegalaxy.org.  Please keep all replies on the list by
>>> using "reply all" in your mail client.  For discussion of
>>> local Galaxy instances and the Galaxy source code, please
>>> use the Galaxy Development list:
>>> 
>>> http://lists.bx.psu.edu/listinfo/galaxy-dev
>>> 
>>> To manage your subscriptions to this and other Galaxy lists,
>>> please use the interface at:
>>> 
>>> http://lists.bx.psu.edu/
>>> 
>>> To search Galaxy mailing lists use the unified search at:
>>> 
>>> http://galaxyproject.org/search/mailinglists/
>> 
> 
> 


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with bowtie

2013-08-27 Thread Ido Tamir

You should add 10 lines from one of your files.
Then its easier to understand the problem.

best,
ido


On Aug 26, 2013, at 5:17 PM, "Law, Michael J."  wrote:

> Hello,
> I am completely new to using galaxy. I have a quick question. I have uploaded 
> my fastq files generated from my experiment for alignments using bowtie. I 
> try to set up the alignment, only to receive the error message that I don't 
> have any sequences with ASCII encoded quality scores. However, when I contact 
> my sequencing facility, they say that the scores are present in the files and 
> that it may be an issue with galaxy.
> Any help you can provide would be appreciated!
> Thanks,
> Mike
> 
> 
> Michael Law
> la...@rowan.edu
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>  http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with bowtie

2013-08-26 Thread Law, Michael J.

Hello,
I am completely new to using galaxy. I have a quick question. I have uploaded 
my fastq files generated from my experiment for alignments using bowtie. I try 
to set up the alignment, only to receive the error message that I don't have 
any sequences with ASCII encoded quality scores. However, when I contact my 
sequencing facility, they say that the scores are present in the files and that 
it may be an issue with galaxy.
Any help you can provide would be appreciated!
Thanks,
Mike


Michael Law
la...@rowan.edu



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with ftp connexion to Galaxy

2013-08-06 Thread Jennifer Jackson


Hello Fabrice,

If you have not already done so, please reset your password and try again.

This is our notice about the issue with accounts created during a short 
time window last May:

http://wiki.galaxyproject.org/Main/Notices#May_29th_2013_FTP_login_resolution

Best,

Jen
Galaxy team

On 7/29/13 7:57 AM, Fabrice BESNARD wrote:

Hello,

I registered some time ago to Galaxy.
>From the very beginning, my ftp connexion is not working.
I am using Filezilla, on a windows operating system. More precisely, the
connexion can be established, but the process fail when it is asking for
the password.

Statut :Résolution de l'adresse de main.g2.bx.psu.edu
Statut :Connexion à 128.118.250.4:21...
Statut :Connexion établie, attente du message d'accueil...
Réponse :   220 ProFTPD 1.3.4b Server (Galaxy Main Server FTP)
[:::128.118.250.4]
Commande :  USER fbesn...@biologie.ens.fr
Réponse :   331 Password required for fbesn...@biologie.ens.fr
Commande :  PASS ***
Réponse :   530 Login incorrect.
Erreur :Erreur critique
Erreur :Impossible d'établir une connexion au serveur


I sent an email two month ago to report this problem. I was answered that
this was an issue happening with the new accounts created.
Obviously, this issue has not been fixed yet, has it? If yes, could you
indicate me to make my ftp connexion works now ?

Thank you for your help !!



--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with downloading

2013-08-06 Thread Jennifer Jackson


Hello Olivier,

From a shell/unix/terminal window on your side,  use "curl" to download
very large datasets.

The link can be obtained by right clicking the floppy disk icon inside a
history item and choosing "Copy Link Address" (for most datasets) or
"Download Dataset/Download bam_index" (for BAM datasets there are two
downloads). Once you have the link:

$ curl -O ''

Hopefully this helps!

Jen
Galaxy team


On 7/22/13 10:28 PM, GANDRILLON OLIVIER wrote:

Hi

I am trying to download the results of my analysis (.sam files) from 
Galaxy main. The download gets interrupted about halfway, with no 
error message, as if the full file had been downloaded (but has not).


Thank's for your help

Best

Olivier Gandrillon







___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with SAM-to-BAM conversion

2013-07-29 Thread Fabrice BESNARD

Hello,

Thank you Sam for your answer. Unfortunately, it still doesn't work.
I tried to create new histories with all the datasets having the same
reference database in their attributes/options, with no success. I even
tried the two reference genomes available as option of the BWA (cb3full &
cb3Canonical), but neither worked: the SAM-to-BM conversion always stopped
with the same error message.

So I would be very grateful to anyone having another idea to fix this issue !

One possibility I see would be to download the reference genome in my
history. Except the fact that it takes a lot of memory space, does anyone
think it is a bad idea ?
If not, from where can I get the reference genome of C. briggsae (last
assembly cb4)?
In wormbase, there are various files available, but I don't know which one
to pick:
ftp://ftp.wormbase.org/pub/wormbase/species/c_briggsae/sequence/genomic/

Thanks for help and advice,

Fabrice


> Oh sorry, you are using Cb datatase, so embarrassing.  Sorry!  But the
> same approach is good, use the same database for all steps, and try to
> find a way to put it in your history.
> Best,
> Sam
>
> -Original Message-
> From: galaxy-user-boun...@lists.bx.psu.edu
> [mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Politz, Samuel
> M.
> Sent: Monday, July 29, 2013 10:20 AM
> To: fbesn...@biologie.ens.fr; galaxy-user@lists.bx.psu.edu
> Subject: Re: [galaxy-user] Problem with SAM-to-BAM conversion
>
> Hi Fabrice,
> I work on C. elegans too, and I have found that you need to have the same
> ce genome database for all steps; otherwise, some tools won't work later
> in your workflow.  With some help from the Galaxy staff, I discovered that
> there is a version of ce10 in the CloudMap shared information on the
> Galaxy server.  You can find it under "CloudMap ot266 proof of principle
> dataset".  I found it works well to copy this file into your history.
> When I used GATK tools, it requests the location of your genome datafile:
> locally cached versus history.  If you choose history, it always finds the
> ce10 version that you put there.  Not sure this will help with SAM to BAM
> conversion, but ce10 is a more up to date version of the database anyway.
> And the CloudMap version is sorted in a way that is "GATK-friendly", which
> was necessary for my application.
> Hope this helps,
>
> Sam Politz
>
> -Original Message-
> From: galaxy-user-boun...@lists.bx.psu.edu
> [mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Fabrice BESNARD
> Sent: Monday, July 29, 2013 9:58 AM
> To: galaxy-user@lists.bx.psu.edu
> Subject: [galaxy-user] Problem with SAM-to-BAM conversion
>
> Hello,
>
> I am trying to map Illumina paired-ends reads from the nematode
> Caenorhabditis briggsae.
>
> Here are the steps of my history:
> 1)I uploaded and groomed two .fq files corresponding to paired-end reads.
> In the attributes, I choose the cb4 database.
> 2)I mapped them using BWA (BWA Version: 0.5.9-r16 BWA run on paired-end
> data). However, I used the cb3 database here, since the cb4 was not
> available.
> 3)I filtered the output SAM file for mapped reads (galaxy tool version
> 1.0.0). cb3 is still said to be the reference database in the filtered SAM
> I got as output.
> 4) Then I tried to convert the SAM into BAM. Here it failed.
> When I chose the parameters of this tool, what I had for the 1st option
> "Choose the source for the reference list" is either:
> -from the history
> -locally cached
> I chose locally cached.
>
> Then, when running the tool, and I had this message error:
> "20: SAM-to-BAM on data 16: converted BAM error An error occurred with
> this dataset: Samtools Version: 0.1.18 (r982:295) No sequences are
> available for build (cb3), request them by reporting this error."
>
> As recommended, I report you now this error !
>
> I found a similar problem in the Galaxy_user mailing list... But I did not
> get how the problem was solved !
> http://user.list.galaxyproject.org/SAM-to-BAM-conversion-problem-td4135498.html
> I tried to change the attributes of the SAM and filtered-SAM files to cb4,
> but it did not work.
>
> Note also that in the error report, the version is said to be 0.1.18.
> But when I click on the SAM-to-BAM tool, the header of the page says:
> SAM-to-BAM (version 1.1.2). I don't know if this matters or not.
>
> Could you please help me fixing this issue ?
> Many thanks !
> --
> Fabrice Besnard
> Institute of Biology of the Ecole Normale Supérieure (IBENS)
> 46 rue d'Ulm, 75230 Paris cedex 05, France 8th floor. Office: Room 802.
> Lab: Room 817.
> mail: fbesn...@biologie.ens.fr
> Tel: +33-1-44-32-39-44
>
> ___

Re: [galaxy-user] Problem with ftp connexion to Galaxy

2013-07-29 Thread Jennifer Jackson


Hello,

If you account was created during a specific time window, then resetting 
your password is necessary. Instructions are in our wiki here:

http://wiki.galaxyproject.org/Main/Notices#May_29th_2013_FTP_login_resolution

Also, double check that you are using FTP, and not SFTP, from the 
command line. If problems continue, it would be very good to try a 
client such as Filezilla or Cyberduck (both are supported on Windows) to 
see if one of those permits a connection, to isolate the issue to the 
method rather than a user/password problem.


Hopefully one of these helps to resolve the issue, but let us know. 
Please be sure to keep replies with the mailing list cc'd if more 
troubleshooting is required.


Best,

Jen
Galaxy team



On 7/29/13 7:57 AM, Fabrice BESNARD wrote:

Hello,

I registered some time ago to Galaxy.
>From the very beginning, my ftp connexion is not working.
I am using Filezilla, on a windows operating system. More precisely, the
connexion can be established, but the process fail when it is asking for
the password.

Statut :Résolution de l'adresse de main.g2.bx.psu.edu
Statut :Connexion à 128.118.250.4:21...
Statut :Connexion établie, attente du message d'accueil...
Réponse :   220 ProFTPD 1.3.4b Server (Galaxy Main Server FTP)
[:::128.118.250.4]
Commande :  USER fbesn...@biologie.ens.fr
Réponse :   331 Password required for fbesn...@biologie.ens.fr
Commande :  PASS ***
Réponse :   530 Login incorrect.
Erreur :Erreur critique
Erreur :Impossible d'établir une connexion au serveur


I sent an email two month ago to report this problem. I was answered that
this was an issue happening with the new accounts created.
Obviously, this issue has not been fixed yet, has it? If yes, could you
indicate me to make my ftp connexion works now ?

Thank you for your help !!



--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with ftp connexion to Galaxy

2013-07-29 Thread Fabrice BESNARD

Hello,

I registered some time ago to Galaxy.
>From the very beginning, my ftp connexion is not working.
I am using Filezilla, on a windows operating system. More precisely, the
connexion can be established, but the process fail when it is asking for
the password.

Statut :Résolution de l'adresse de main.g2.bx.psu.edu
Statut :Connexion à 128.118.250.4:21...
Statut :Connexion établie, attente du message d'accueil...
Réponse :   220 ProFTPD 1.3.4b Server (Galaxy Main Server FTP)
[:::128.118.250.4]
Commande :  USER fbesn...@biologie.ens.fr
Réponse :   331 Password required for fbesn...@biologie.ens.fr
Commande :  PASS ***
Réponse :   530 Login incorrect.
Erreur :Erreur critique
Erreur :Impossible d'établir une connexion au serveur


I sent an email two month ago to report this problem. I was answered that
this was an issue happening with the new accounts created.
Obviously, this issue has not been fixed yet, has it? If yes, could you
indicate me to make my ftp connexion works now ?

Thank you for your help !!

-- 
Fabrice Besnard
Institute of Biology of the Ecole Normale Supérieure (IBENS)
46 rue d'Ulm, 75230 Paris cedex 05, France
8th floor. Office: Room 802. Lab: Room 817.
mail: fbesn...@biologie.ens.fr
Tel: +33-1-44-32-39-44




___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with SAM-to-BAM conversion

2013-07-29 Thread Politz, Samuel M.

Oh sorry, you are using Cb datatase, so embarrassing.  Sorry!  But the same 
approach is good, use the same database for all steps, and try to find a way to 
put it in your history.
Best,
Sam

-Original Message-
From: galaxy-user-boun...@lists.bx.psu.edu 
[mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Politz, Samuel M.
Sent: Monday, July 29, 2013 10:20 AM
To: fbesn...@biologie.ens.fr; galaxy-user@lists.bx.psu.edu
Subject: Re: [galaxy-user] Problem with SAM-to-BAM conversion

Hi Fabrice,
I work on C. elegans too, and I have found that you need to have the same ce 
genome database for all steps; otherwise, some tools won't work later in your 
workflow.  With some help from the Galaxy staff, I discovered that there is a 
version of ce10 in the CloudMap shared information on the Galaxy server.  You 
can find it under "CloudMap ot266 proof of principle dataset".  I found it 
works well to copy this file into your history.   When I used GATK tools, it 
requests the location of your genome datafile:  locally cached versus history.  
If you choose history, it always finds the ce10 version that you put there.  
Not sure this will help with SAM to BAM conversion, but ce10 is a more up to 
date version of the database anyway.  And the CloudMap version is sorted in a 
way that is "GATK-friendly", which was necessary for my application.
Hope this helps,

Sam Politz

-Original Message-
From: galaxy-user-boun...@lists.bx.psu.edu 
[mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Fabrice BESNARD
Sent: Monday, July 29, 2013 9:58 AM
To: galaxy-user@lists.bx.psu.edu
Subject: [galaxy-user] Problem with SAM-to-BAM conversion

Hello,

I am trying to map Illumina paired-ends reads from the nematode Caenorhabditis 
briggsae.

Here are the steps of my history:
1)I uploaded and groomed two .fq files corresponding to paired-end reads.
In the attributes, I choose the cb4 database.
2)I mapped them using BWA (BWA Version: 0.5.9-r16 BWA run on paired-end data). 
However, I used the cb3 database here, since the cb4 was not available.
3)I filtered the output SAM file for mapped reads (galaxy tool version 1.0.0). 
cb3 is still said to be the reference database in the filtered SAM I got as 
output.
4) Then I tried to convert the SAM into BAM. Here it failed.
When I chose the parameters of this tool, what I had for the 1st option "Choose 
the source for the reference list" is either:
-from the history
-locally cached
I chose locally cached.

Then, when running the tool, and I had this message error:
"20: SAM-to-BAM on data 16: converted BAM error An error occurred with this 
dataset: Samtools Version: 0.1.18 (r982:295) No sequences are available for 
build (cb3), request them by reporting this error."

As recommended, I report you now this error !

I found a similar problem in the Galaxy_user mailing list... But I did not get 
how the problem was solved !
http://user.list.galaxyproject.org/SAM-to-BAM-conversion-problem-td4135498.html
I tried to change the attributes of the SAM and filtered-SAM files to cb4, but 
it did not work.

Note also that in the error report, the version is said to be 0.1.18.
But when I click on the SAM-to-BAM tool, the header of the page says:
SAM-to-BAM (version 1.1.2). I don't know if this matters or not.

Could you please help me fixing this issue ?
Many thanks !
--
Fabrice Besnard
Institute of Biology of the Ecole Normale Supérieure (IBENS)
46 rue d'Ulm, 75230 Paris cedex 05, France 8th floor. Office: Room 802. Lab: 
Room 817.
mail: fbesn...@biologie.ens.fr
Tel: +33-1-44-32-39-44

___
The Galaxy User list should be used for the discussion of Galaxy analysis and 
other features on the public server at usegalaxy.org.  Please keep all replies 
on the list by using "reply all" in your mail client.  For discussion of local 
Galaxy instances and the Galaxy source code, please use the Galaxy Development 
list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists, please use the 
interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

___
The Galaxy User list should be used for the discussion of Galaxy analysis and 
other features on the public server at usegalaxy.org.  Please keep all replies 
on the list by using "reply all" in your mail client.  For discussion of local 
Galaxy instances and the Galaxy source code, please use the Galaxy Development 
list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists, please use the 
interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with SAM-to-BAM conversion

2013-07-29 Thread Politz, Samuel M.

Hi Fabrice,
I work on C. elegans too, and I have found that you need to have the same ce 
genome database for all steps; otherwise, some tools won't work later in your 
workflow.  With some help from the Galaxy staff, I discovered that there is a 
version of ce10 in the CloudMap shared information on the Galaxy server.  You 
can find it under "CloudMap ot266 proof of principle dataset".  I found it 
works well to copy this file into your history.   When I used GATK tools, it 
requests the location of your genome datafile:  locally cached versus history.  
If you choose history, it always finds the ce10 version that you put there.  
Not sure this will help with SAM to BAM conversion, but ce10 is a more up to 
date version of the database anyway.  And the CloudMap version is sorted in a 
way that is "GATK-friendly", which was necessary for my application.
Hope this helps,

Sam Politz

-Original Message-
From: galaxy-user-boun...@lists.bx.psu.edu 
[mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Fabrice BESNARD
Sent: Monday, July 29, 2013 9:58 AM
To: galaxy-user@lists.bx.psu.edu
Subject: [galaxy-user] Problem with SAM-to-BAM conversion

Hello,

I am trying to map Illumina paired-ends reads from the nematode Caenorhabditis 
briggsae.

Here are the steps of my history:
1)I uploaded and groomed two .fq files corresponding to paired-end reads.
In the attributes, I choose the cb4 database.
2)I mapped them using BWA (BWA Version: 0.5.9-r16 BWA run on paired-end data). 
However, I used the cb3 database here, since the cb4 was not available.
3)I filtered the output SAM file for mapped reads (galaxy tool version 1.0.0). 
cb3 is still said to be the reference database in the filtered SAM I got as 
output.
4) Then I tried to convert the SAM into BAM. Here it failed.
When I chose the parameters of this tool, what I had for the 1st option "Choose 
the source for the reference list" is either:
-from the history
-locally cached
I chose locally cached.

Then, when running the tool, and I had this message error:
"20: SAM-to-BAM on data 16: converted BAM error An error occurred with this 
dataset: Samtools Version: 0.1.18 (r982:295) No sequences are available for 
build (cb3), request them by reporting this error."

As recommended, I report you now this error !

I found a similar problem in the Galaxy_user mailing list... But I did not get 
how the problem was solved !
http://user.list.galaxyproject.org/SAM-to-BAM-conversion-problem-td4135498.html
I tried to change the attributes of the SAM and filtered-SAM files to cb4, but 
it did not work.

Note also that in the error report, the version is said to be 0.1.18.
But when I click on the SAM-to-BAM tool, the header of the page says:
SAM-to-BAM (version 1.1.2). I don't know if this matters or not.

Could you please help me fixing this issue ?
Many thanks !
--
Fabrice Besnard
Institute of Biology of the Ecole Normale Supérieure (IBENS)
46 rue d'Ulm, 75230 Paris cedex 05, France 8th floor. Office: Room 802. Lab: 
Room 817.
mail: fbesn...@biologie.ens.fr
Tel: +33-1-44-32-39-44

___
The Galaxy User list should be used for the discussion of Galaxy analysis and 
other features on the public server at usegalaxy.org.  Please keep all replies 
on the list by using "reply all" in your mail client.  For discussion of local 
Galaxy instances and the Galaxy source code, please use the Galaxy Development 
list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists, please use the 
interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with SAM-to-BAM conversion

2013-07-29 Thread Fabrice BESNARD

Hello,

I am trying to map Illumina paired-ends reads from the nematode
Caenorhabditis briggsae.

Here are the steps of my history:
1)I uploaded and groomed two .fq files corresponding to paired-end reads.
In the attributes, I choose the cb4 database.
2)I mapped them using BWA (BWA Version: 0.5.9-r16 BWA run on paired-end
data). However, I used the cb3 database here, since the cb4 was not
available.
3)I filtered the output SAM file for mapped reads (galaxy tool version
1.0.0). cb3 is still said to be the reference database in the filtered SAM
I got as output.
4) Then I tried to convert the SAM into BAM. Here it failed.
When I chose the parameters of this tool, what I had for the 1st option
"Choose the source for the reference list" is either:
-from the history
-locally cached
I chose locally cached.

Then, when running the tool, and I had this message error:
"20: SAM-to-BAM on data 16: converted BAM error
An error occurred with this dataset: Samtools Version: 0.1.18 (r982:295)
No sequences are available for build (cb3), request them by reporting this
error."

As recommended, I report you now this error !

I found a similar problem in the Galaxy_user mailing list... But I did not
get how the problem was solved !
http://user.list.galaxyproject.org/SAM-to-BAM-conversion-problem-td4135498.html
I tried to change the attributes of the SAM and filtered-SAM files to cb4,
but it did not work.

Note also that in the error report, the version is said to be 0.1.18.
But when I click on the SAM-to-BAM tool, the header of the page says:
SAM-to-BAM (version 1.1.2). I don't know if this matters or not.

Could you please help me fixing this issue ?
Many thanks !
-- 
Fabrice Besnard
Institute of Biology of the Ecole Normale Supérieure (IBENS)
46 rue d'Ulm, 75230 Paris cedex 05, France
8th floor. Office: Room 802. Lab: Room 817.
mail: fbesn...@biologie.ens.fr
Tel: +33-1-44-32-39-44

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with downloading

2013-07-22 Thread GANDRILLON OLIVIER

Hi

I am trying to download the results of my analysis (.sam files) from Galaxy 
main. The download gets interrupted about halfway, with no error message, as if 
the full file had been downloaded (but has not). 

Thank's for your help

Best

Olivier Gandrillon







smime.p7s
Description: S/MIME cryptographic signature
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with FTP

2013-07-18 Thread Jennifer Jackson


Hi Olivier,

Thanks for letting us know about the issue. Please try again now.

Very sorry for the trouble,

Jen
Galaxy team

On 7/18/13 12:29 AM, GANDRILLON OLIVIER wrote:

Hi

I am trying to connect though FTP to transfer large files. Up to today 
everything went fine. But I tried many times to connect today and each 
time the ftp connection was instantly interrupted. Thank's for your help.


Best

Olivier






___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with FTP

2013-07-18 Thread GANDRILLON OLIVIER

Hi

I am trying to connect though FTP to transfer large files. Up to today 
everything went fine. But I tried many times to connect today and each time the 
ftp connection was instantly interrupted. Thank's for your help.

Best

Olivier






smime.p7s
Description: S/MIME cryptographic signature
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with repeated genes in Cuffdiff's output

2013-07-17 Thread Jennifer Jackson


Hello,

The whole output line is not included, so it is difficult to tell you 
exactly what is going on in the case you are looking at, but most likely 
there is a difference below the gene bound level. Look for an alternate 
transcript start site or coding region - this should be indicated on the 
line in one of the other columns. (When not doing gene discovery, these 
alternate TSS/CDS in your data were not utilized, this is the difference 
between restricting to only known vs including/discovering novel in the 
input samples).


Also, just in case you want to confirm some of these (or visualize them) 
the first column of each file generally has a test id/identifier that 
can be used to look up what is being testing in the tracking files. For 
the actual transcripts, going back to through the data in these files to 
map into the Cuffmerge/Cufflinks transcripts files, where you can review 
the details. Pulling up the input BAM with the Cufflinks transcripts 
files, along with the reference annotation, in trackster may help you 
confirm/decide if you agree with the results or not (you know the 
coordinates, so can zoom into the region(s)).


The Cuffdiff manual describes each file in detail - this is a great 
reference. The Galaxy wrapper doesn't alter the output.

http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff_output

Hopefully this helps,

Jen
Galaxy team

On 7/16/13 7:50 AM, Hoang, Thanh wrote:

Hi all,
I am working on RNA-seq using TopHat/Cufflink/Cuffdiff for 
differential gene expression and new gene discovery ( this is what I 
am interested in).  However, I found many genes that are repeated in 
the Cuffdiff's ouput. These are the same genes and at the exact the 
same locus. There should be only one gene for 1 line. Something like 
this:

/Genes/ /Locus/ 
/Status//q1//q2//Log2 Folg change/  /Significance/
/Lnp/ 	/2:74517521-74584544/ 	/OK/ 	/8.91501/ 	/85.2735/ 	/3.25779/ 
/   yes/
/Lnp/ 	/2:74517521-74584544/ 	/OK/ 	/12.0044/ 	/171.352/ 	/3.83533/ 
/   yes/



If I re-run the Cuffdiff for differential gene expression only ( No 
gene discovery), the problem is fixed. Anyone knows how o explain and 
fix this?

Thank you so much



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with repeated genes in Cuffdiff's output

2013-07-16 Thread Hoang, Thanh

Hi all,
I am working on RNA-seq using TopHat/Cufflink/Cuffdiff for differential
gene expression and new gene discovery ( this is what I am interested in).
 However, I found many genes that are repeated in the Cuffdiff's ouput.
These are the same genes and at the exact the same locus. There should be
only one gene for 1 line. Something like this:
   *Genes* *Locus* *Status* *q1* *q2* *Log2 Folg change* *Significance*  *
Lnp* *2:74517521-74584544* *OK* *8.91501* *85.2735* *3.25779* *   yes*  *Lnp
* *2:74517521-74584544* *OK* *12.0044* *171.352* *3.83533* *   yes*

If I re-run the Cuffdiff for differential gene expression only ( No gene
discovery), the problem is fixed. Anyone knows how o explain and fix this?
Thank you so much
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading bam and bai files

2013-07-09 Thread Jennifer Jackson


Hi Ann,

When loading a BAM dataset, there is no need to load the index, just the 
BAM file itself. Galaxy will generate the .bai and create a composite 
dataset.


For the problem with detection, my guess is that the file was not named 
with a ".bam" extension, making detection problematic. The other 
problems are likely derivatives of this, and the .bai problems are 
expected - distinct bai datasets are not supported. If it was named as 
.bam, or appears to be, this would be a very strange case. Maybe check 
that the file doesn't have a hidden extension on the server you are 
loading from?


If the extension .bam was not used, please try loading using it, just 
BAM file, and see if that works now - maybe switching to FTP if not 
already using that. An example of how to do this is in this screencast 
(the 4th example, FTP, loads a BAM file):


http://wiki.galaxyproject.org/Learn/Screencasts -> *Get Data: Upload File *
http://screencast.g2.bx.psu.edu/usinggalaxy_upload/flow.html

Hopefully this resolves the problem,

Jen
Galaxy team

On 7/3/13 11:04 PM, Ann Holtz-Morris, M.S. wrote:

Hi,
I've searched the archives and cannot find my situation.  I have an 
Illumina MiSeq dataset with ~8 million reads that was aligned to the 
reference genome on the MiSeq machine.  (The machine uses BWA to allow 
overlapping reads, unlike Casava.) The alignment generated dataset.bam 
and dataset.bam.bai files in the same directlry.


I used Get Data to upload both files. The problems, possibly related, 
are that Galaxy 1) would not recognize the .bam file as a bam file and 
2) would not recognize the dataset.bam.bai file as the bam file metadata.


After uploading the bam file, originally identified as a text file, I 
manually used the pen option to tell Galaxy that the data was a .bam 
file. I then uploaded the .bam.bai file. The data would not display 
the data at UCSC genome browser nor in Trackster, even though those 
options were displayed for the .bam file.  After uploading, I also 
used the pen editor to change from dataset.bam.bai to dataset.bai.


None of these options worked for Trackster, UCSC genome brower, nor 
IGV nor IGB. Interestingly, IGV would display it if the data was used 
directly form my hard drive but not through Galaxy.


Any advice would be greatly appreciated.
Ann
CONFIDENTIALITY NOTICE: This electronic message is intended to be for 
the use only of the named recipient, and may contain information that 
is confidential or privileged. If you are not the intended recipient, 
you are hereby notified that any disclosure, copying, distribution or 
use of the contents of this message is strictly prohibited. If you 
have received this message in error or are not the named recipient, 
please notify us immediately by contacting the sender at the 
electronic mail address noted above, and delete and destroy all copies 
of this message. Thank you.

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem uploading bam and bai files

2013-07-07 Thread Ann Holtz-Morris, M.S.


Hi,
I've searched the archives and cannot find my situation.  I have an Illumina 
MiSeq dataset with ~8 million reads that was aligned to the reference genome 
on the MiSeq machine.  (The machine uses BWA to allow overlapping reads, 
unlike Casava.) The alignment generated dataset.bam and dataset.bam.bai 
files in the same directlry.


I used Get Data to upload both files. The problems, possibly related, are 
that Galaxy 1) would not recognize the .bam file as a bam file and 2) would 
not recognize the dataset.bam.bai file as the bam file metadata.


After uploading the bam file, originally identified as a text file, I 
manually used the pen option to tell Galaxy that the data was a .bam file. I 
then uploaded the .bam.bai file. The data would not display the data at UCSC 
genome browser nor in Trackster, even though those options were displayed 
for the .bam file.  After uploading, I also used the pen editor to change 
from dataset.bam.bai to dataset.bai.


None of these options worked for Trackster, UCSC genome brower, nor IGV nor 
IGB. Interestingly, IGV would display it if the data was used directly form 
my hard drive but not through Galaxy.


Any advice would be greatly appreciated.
Ann
CONFIDENTIALITY NOTICE: This electronic message is intended to be for the use 
only of the named recipient, and may contain information that is confidential 
or privileged. If you are not the intended recipient, you are hereby notified 
that any disclosure, copying, distribution or use of the contents of this 
message is strictly prohibited. If you have received this message in error or 
are not the named recipient, please notify us immediately by contacting the 
sender at the electronic mail address noted above, and delete and destroy all 
copies of this message. Thank you.
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with ftp server?

2013-07-01 Thread Jennifer Jackson


Hello Katrien,

Our apologies - the FTP server has been restarted and should be 
functional as normal again. Please re-run and let us know if you 
continue to have issues.


Thanks for reporting the problem,

Jen
Galaxy team

On 6/28/13 2:33 AM, Katrien M. Devos wrote:
I successfully uploaded files to the main Galaxy server this morning 
using ftp.  However, any attempts to upload files since around noon 
have failed.  I get a 'Could not connect to server' error when trying 
to connect to main.g2.bx.psu.edu  uisng 
FileZilla.  Any suggestions?

Thank you.
Katrien

--
Katrien M. Devos
Dept. of Crop and Soil Sciences & Dept. of Plant Biology
University of Georgia
Athens, GA 30602
USA
Tel: (706) 542-0925
Fax: (706) 542-0914
E-mail: kde...@uga.edu 


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem with ftp server?

2013-06-27 Thread Katrien M. Devos

I successfully uploaded files to the main Galaxy server this morning using
ftp.  However, any attempts to upload files since around noon have failed.
I get a 'Could not connect to server' error when trying to connect to
main.g2.bx.psu.edu uisng FileZilla.  Any suggestions?
Thank you.
Katrien

-- 
Katrien M. Devos
Dept. of Crop and Soil Sciences & Dept. of Plant Biology
University of Georgia
Athens, GA 30602
USA
Tel: (706) 542-0925
Fax: (706) 542-0914
E-mail: kde...@uga.edu
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with GATK tools not accepting BAM file as input

2013-06-24 Thread Jennifer Jackson


Hello,

GATK requires that reference genomes are sorted in a specific way. For 
certain genomes, the chromosomes included in the build are also 
restricted. This is often different that how most are released in "full" 
format (with random, haplotype, and/or unmapped data) and sometimes 
required to be used by other tools or simply how they have been already 
used, making a change at this point an issue for 
backwards-compatibility. This is where using a genome from the history 
(on the public Main server, but only for small genomes) or a cloud or 
local Galaxy fits in with GATK.


This sort/build information can be found on the GATK web site and 
formatting the data can be done prior to upload into Galaxy, or 
converting to fasta->tabular and a combination of filters/sorting can be 
done to subset and order the data (each genome is a bit different, so 
there is no single method).


But, for ce10 this has already been done. You can import a GATK-friendly 
version of the genome from one of the Cloudmap publication's histories 
(Shared Data -> Published Pages -> CloudMap), as it also uses ce10. See 
this link for a history that you can import. Dataset #5 is the ce10 
reference genome.

https://main.g2.bx.psu.edu/u/gm2123/h/cloudmapot266proofofprinciple

The publication may also give you ideas about how to format inputs for 
these tools. The ce10 reference genome can also be a model for how to 
sort other genomes (sometimes it takes a few tries to get the right 
ordering).


If you are switching genomes, you may need to start over from mapping. 
Some help about how to determine if that is needed is in our wiki here:

http://wiki.galaxyproject.org/Support#Reference_genomes

Hopefully this helps,

Jen
Galaxy team

On 6/24/13 8:14 AM, Politz, Samuel M. wrote:


I am using GATK tools on the useGalaxy main server to detect variants 
in a mutant C. elegans whole genome sequence obtained with an Illumina 
instrument (my own data). The first GATK tool I tried to use, 
Realigner Target Creator, gave me an error message.  In the tool 
window, my input file (a BAM file previously run through Add or  
Replace Groups) did not generate an error, but the reference genome 
file (ce10) which I specified as found in History, produced the 
following reference list-specific error:  "History does not include a 
dataset of the required format/build".  I got the same error when I 
tried to use this input file to run the GATK Depth of Coverage tool.  
I have searched Galaxy mail archives for this error, and have found 
other examples, but none involving these tools.


The ce10 database was listed in the History attributes of the BAM file 
I used, and this database has worked with all of the Galaxy tools I 
used up to this point. Something about the ce10 format is unacceptable 
to GATK, or it is not even picking it up from the History. I don't 
know how to access ce10 to check its format.  I have only found the 
inbuilt reference genome files in Galaxy in drop-down menus for each tool.


Searching the GATK site for solutions has not been helpful, because 
they suggest GATK-specific functions to fix the format such as Create 
Sequence Dictionary.  I don't have access to these tools within the 
Galaxy main server.


Can someone suggest a workaround or a direct solution?



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with GATK tools not accepting BAM file as input

2013-06-24 Thread Politz, Samuel M.

I am using GATK tools on the useGalaxy main server to detect variants in a 
mutant C. elegans whole genome sequence obtained with an Illumina instrument 
(my own data).  The first GATK tool I tried to use, Realigner Target Creator, 
gave me an error message.  In the tool window, my input file (a BAM file 
previously run through Add or  Replace Groups) did not generate an error, but 
the reference genome file (ce10) which I specified as found in History, 
produced the following reference list-specific error:  "History does not 
include a dataset of the required format/build".  I got the same error when I 
tried to use this input file to run the GATK Depth of Coverage tool.  I have 
searched Galaxy mail archives for this error, and have found other examples, 
but none involving these tools.
The ce10 database was listed in the History attributes of the BAM file I used, 
and this database has worked with all of the Galaxy tools I used up to this 
point.  Something about the ce10 format is unacceptable to GATK, or it is not 
even picking it up from the History. I don't know how to access ce10 to check 
its format.  I have only found the inbuilt reference genome files in Galaxy in 
drop-down menus for each tool.
Searching the GATK site for solutions has not been helpful, because they 
suggest GATK-specific functions to fix the format such as Create Sequence 
Dictionary.  I don't have access to these tools within the Galaxy main server.
Can someone suggest a workaround or a direct solution?

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with custom database build

2013-06-11 Thread Sun, Jiajie - ARS

Hi Ann,
I think that you can change Browser, such as google.

jia

From: galaxy-user-boun...@lists.bx.psu.edu 
[mailto:galaxy-user-boun...@lists.bx.psu.edu] On Behalf Of Dannon Baker
Sent: Tuesday, June 11, 2013 11:11 AM
To: Ann Holtz-Morris, M.S.
Cc: galaxy-user@lists.bx.psu.edu
Subject: Re: [galaxy-user] problem with custom database build

Hi Ann,

My guess is that this is related to the issue you were having before.  I'm 
taking a look now.

-Dannon

On Mon, Jun 10, 2013 at 7:31 PM, Ann Holtz-Morris, M.S. 
mailto:aholtzmor...@chori.org>> wrote:
Hi,
I'm trying to create a new custom build . I keep getting GURU MEDITATION: 
#aa96a62c69784be49b7864f6ef42ddc6  I've been trying  1 or 2 times a day for the 
last 3 days. Thanks
Ann

CONFIDENTIALITY NOTICE: This electronic message is intended to be for the use 
only of the named recipient, and may contain information that is confidential 
or privileged. If you are not the intended recipient, you are hereby notified 
that any disclosure, copying, distribution or use of the contents of this 
message is strictly prohibited. If you have received this message in error or 
are not the named recipient, please notify us immediately by contacting the 
sender at the electronic mail address noted above, and delete and destroy all 
copies of this message. Thank you.

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org<http://usegalaxy.org>.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

This electronic message contains information generated by the USDA solely for 
the intended recipients. Any unauthorized interception of this message or the 
use or disclosure of the information it contains may violate the law and 
subject the violator to civil or criminal penalties. If you believe you have 
received this message in error, please notify the sender and delete the email 
immediately.
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with custom database build

2013-06-11 Thread Dannon Baker

Hi Ann,

My guess is that this is related to the issue you were having before.  I'm
taking a look now.

-Dannon


On Mon, Jun 10, 2013 at 7:31 PM, Ann Holtz-Morris, M.S. <
aholtzmor...@chori.org> wrote:

> Hi,
>
> I’m trying to create a new custom build . I keep getting *GURU
> MEDITATION: #aa96a62c69784be49b7864f6ef42ddc6  *I’ve been trying  1 or 2
> times a day for the last 3 days. Thanks
>
> Ann
>
> ** **
>
> ** **
>
> CONFIDENTIALITY NOTICE: This electronic message is intended to be for the use 
> only of the named recipient, and may contain information that is confidential 
> or privileged. If you are not the intended recipient, you are hereby notified 
> that any disclosure, copying, distribution or use of the contents of this 
> message is strictly prohibited. If you have received this message in error or 
> are not the named recipient, please notify us immediately by contacting the 
> sender at the electronic mail address noted above, and delete and destroy all 
> copies of this message. Thank you.
>
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>   http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>
>   http://galaxyproject.org/search/mailinglists/
>
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with custom database build

2013-06-11 Thread Ann Holtz-Morris, M.S.

Hi,

I'm trying to create a new custom build . I keep getting GURU MEDITATION: 
#aa96a62c69784be49b7864f6ef42ddc6  I've been trying  1 or 2 times a day for the 
last 3 days. Thanks

Ann





CONFIDENTIALITY NOTICE: This electronic message is intended to be for the use 
only of the named recipient, and may contain information that is confidential 
or privileged. If you are not the intended recipient, you are hereby notified 
that any disclosure, copying, distribution or use of the contents of this 
message is strictly prohibited. If you have received this message in error or 
are not the named recipient, please notify us immediately by contacting the 
sender at the electronic mail address noted above, and delete and destroy all 
copies of this message. Thank you.

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with registration

2013-05-29 Thread Nate Coraor

On May 28, 2013, at 5:40 AM, Patel, Bella wrote:

> Hi
> I have tried to register for Galaxy but apparantly a user with my email 
> address already exists! Very strange as I have never registered for this 
> software.
>  
> Can you advise?
>  
> Bella Patel

Hi Bella,

It's possible that your account creation request was accidentally submitted 
twice, which would have displayed the error message you received.  If you are 
unable to log in to the account using the password you specified, please use 
the password reset feature to gain access to your account.

--nate

> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>  http://galaxyproject.org/search/mailinglists/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with registration

2013-05-28 Thread Patel, Bella

Hi
I have tried to register for Galaxy but apparantly a user with my email address 
already exists! Very strange as I have never registered for this software.

Can you advise?

Bella Patel
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] Problem to download mercurial egg

2013-05-24 Thread Marc DELOGER


Hello,

I tried to download several times the several egg on these following 
mirrors but the download is always blocked near 50%...I asked several 
different people and they all have the same problem :


http://eggs.g2.bx.psu.edu/mercurial/mercurial-2.2.3-py2.7-linux-x86_64-ucs4.egg 



http://eggs.galaxyproject.org/mercurial/mercurial-2.2.3-py2.7-linux-x86_64-ucs4.egg 



Thank you in advance,

Marc DELOGER
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

2013-05-14 Thread Chunyu Liu

Thanks! for fixing the problem before I get time to provide more test data.

Chunyu


On Tue, May 14, 2013 at 12:17 PM, Daniel Blankenberg  wrote:

> Hi Chunyu,
>
> Thanks for reporting this issue, it has been resolved in our stable branch
> and will be available on our public server after the next update.
>
>
> Thanks for using Galaxy,
>
> Dan
>
>
> On May 12, 2013, at 10:52 AM, Chunyu Liu wrote:
>
> hi,
> I had an odd problem today, seems not a problem before:
> I am trying to upload a simple tab-delimited text file into galaxy,
> but it kept telling me:
> empty
> format: txt, database: hg19
> The uploaded binary file contains inappropriate content
>
> Also, showed filesize as 0 bytes.
>
> I tried Unix format, DOS format. It is a very small data, only 348 bytes.
> 4 rows, as attached.
>
> What is WRONG?
>
> Thanks!
>
> Chunyu
>  ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>  http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>
>  http://galaxyproject.org/search/mailinglists/
>
>
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>   http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>
>   http://galaxyproject.org/search/mailinglists/
>



-- 
Chunyu Liu, Ph.D.
Associate Professor
Department of Psychiatry
University of Illinois at Chicago
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

2013-05-14 Thread Daniel Blankenberg

Hi Chunyu,

Thanks for reporting this issue, it has been resolved in our stable branch and 
will be available on our public server after the next update.

Thanks for using Galaxy,

Dan

On May 12, 2013, at 10:52 AM, Chunyu Liu wrote:

> hi, 
> I had an odd problem today, seems not a problem before:
> I am trying to upload a simple tab-delimited text file into galaxy, 
> but it kept telling me:
> empty
> format: txt, database: hg19
> The uploaded binary file contains inappropriate content
> 
> Also, showed filesize as 0 bytes.
> 
> I tried Unix format, DOS format. It is a very small data, only 348 bytes.
> 4 rows, as attached. 
> 
> What is WRONG?
> 
> Thanks!
> 
> Chunyu
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>  http://galaxyproject.org/search/mailinglists/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

2013-05-13 Thread Björn Grüning

Hi Chunyu,

can you provide us with a small, reproducible example?

Thanks,
Björn

> Actually, the file is all tab-delimited, from beginning to end.
> It has no problem uploading larger data. Seems to be bug somewhere?
> Chunyu
> 
> 
> On Mon, May 13, 2013 at 12:45 PM, James Taylor 
> wrote:
> Are the first four lines of your file deliberately whitespace?
> This
> will definitely cause problems for file type detection (it is
> not a
> valid TSV file as is).
> 
> --
> James Taylor, Assistant Professor, Biology/CS, Emory
> University
> 
> 
> On Sun, May 12, 2013 at 10:52 AM, Chunyu Liu
>  wrote:
> > hi,
> > I had an odd problem today, seems not a problem before:
> > I am trying to upload a simple tab-delimited text file into
> galaxy,
> > but it kept telling me:
> > empty
> > format: txt, database: hg19
> > The uploaded binary file contains inappropriate content
> >
> > Also, showed filesize as 0 bytes.
> >
> > I tried Unix format, DOS format. It is a very small data,
> only 348 bytes.
> > 4 rows, as attached.
> >
> > What is WRONG?
> >
> > Thanks!
> >
> > Chunyu
> >
> > ___
> > The Galaxy User list should be used for the discussion of
> > Galaxy analysis and other features on the public server
> > at usegalaxy.org.  Please keep all replies on the list by
> > using "reply all" in your mail client.  For discussion of
> > local Galaxy instances and the Galaxy source code, please
> > use the Galaxy Development list:
> >
> >   http://lists.bx.psu.edu/listinfo/galaxy-dev
> >
> > To manage your subscriptions to this and other Galaxy lists,
> > please use the interface at:
> >
> >   http://lists.bx.psu.edu/
> >
> > To search Galaxy mailing lists use the unified search at:
> >
> >   http://galaxyproject.org/search/mailinglists/
> 
> 
> 
> 
> -- 
> Chunyu Liu, Ph.D.
> Associate Professor
> Department of Psychiatry
> University of Illinois at Chicago
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

2013-05-13 Thread Chunyu Liu

Actually, the file is all tab-delimited, from beginning to end.
It has no problem uploading larger data. Seems to be bug somewhere?
Chunyu


On Mon, May 13, 2013 at 12:45 PM, James Taylor wrote:

> Are the first four lines of your file deliberately whitespace? This
> will definitely cause problems for file type detection (it is not a
> valid TSV file as is).
>
> --
> James Taylor, Assistant Professor, Biology/CS, Emory University
>
>
> On Sun, May 12, 2013 at 10:52 AM, Chunyu Liu  wrote:
> > hi,
> > I had an odd problem today, seems not a problem before:
> > I am trying to upload a simple tab-delimited text file into galaxy,
> > but it kept telling me:
> > empty
> > format: txt, database: hg19
> > The uploaded binary file contains inappropriate content
> >
> > Also, showed filesize as 0 bytes.
> >
> > I tried Unix format, DOS format. It is a very small data, only 348 bytes.
> > 4 rows, as attached.
> >
> > What is WRONG?
> >
> > Thanks!
> >
> > Chunyu
> >
> > ___
> > The Galaxy User list should be used for the discussion of
> > Galaxy analysis and other features on the public server
> > at usegalaxy.org.  Please keep all replies on the list by
> > using "reply all" in your mail client.  For discussion of
> > local Galaxy instances and the Galaxy source code, please
> > use the Galaxy Development list:
> >
> >   http://lists.bx.psu.edu/listinfo/galaxy-dev
> >
> > To manage your subscriptions to this and other Galaxy lists,
> > please use the interface at:
> >
> >   http://lists.bx.psu.edu/
> >
> > To search Galaxy mailing lists use the unified search at:
> >
> >   http://galaxyproject.org/search/mailinglists/
>



-- 
Chunyu Liu, Ph.D.
Associate Professor
Department of Psychiatry
University of Illinois at Chicago
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

2013-05-13 Thread James Taylor

Are the first four lines of your file deliberately whitespace? This
will definitely cause problems for file type detection (it is not a
valid TSV file as is).

--
James Taylor, Assistant Professor, Biology/CS, Emory University


On Sun, May 12, 2013 at 10:52 AM, Chunyu Liu  wrote:
> hi,
> I had an odd problem today, seems not a problem before:
> I am trying to upload a simple tab-delimited text file into galaxy,
> but it kept telling me:
> empty
> format: txt, database: hg19
> The uploaded binary file contains inappropriate content
>
> Also, showed filesize as 0 bytes.
>
> I tried Unix format, DOS format. It is a very small data, only 348 bytes.
> 4 rows, as attached.
>
> What is WRONG?
>
> Thanks!
>
> Chunyu
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>   http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>
>   http://galaxyproject.org/search/mailinglists/
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem uploading txt data

2013-05-12 Thread Chunyu Liu

hi,
I had an odd problem today, seems not a problem before:
I am trying to upload a simple tab-delimited text file into galaxy,
but it kept telling me:
empty
format: txt, database: hg19
The uploaded binary file contains inappropriate content

Also, showed filesize as 0 bytes.

I tried Unix format, DOS format. It is a very small data, only 348 bytes.
4 rows, as attached.

What is WRONG?

Thanks!

Chunyu
chr start   end id
chr21   2832706028327210 id-1416354
chr21   2832710028327250 id-1416356
chr21   2832708028327230id-1416355
chr21   2832706028327210 id-1416354
chr21   2832710028327250 id-1416356
chr21   2832708028327230id-1416355
chr21   2832706028327210 id-1416354
chr21   2832710028327250 id-1416356
chr21   2832708028327230id-1416355
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with the public Main Galaxy server

2013-04-26 Thread Jennifer Jackson


Hello Giuseppe,

The public server was busier today than it was earlier in the week, but 
has been consistently processing jobs.


You may know this already, but the best way to ensure that jobs complete 
when the server is busy is to leave them alone to run. Do not 
stop/restart them or they will move back to the end of the queue. Jobs 
will run in the order submitted.


If you are having a specific problem, we can try to help if you provide 
more details.


Best,

Jen
Galaxy team

On 4/26/13 5:39 AM, Ianiri, Giuseppe wrote:

Hi,
is anybody else experiencing problems with the public Main Galaxy 
server at http://main.g2.bx.psu.edu? It just does not work anymore.

Any suggestion?

Giuseppe Ianiri



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with the public Main Galaxy server

2013-04-26 Thread Ianiri, Giuseppe

Hi,
is anybody else experiencing problems with the public Main Galaxy server at 
http://main.g2.bx.psu.edu? It just does not work anymore.
Any suggestion?


Giuseppe Ianiri
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem with the joining of two interval dataset

2013-04-23 Thread Jennifer Jackson


Hello Milad,

You have this query set up optimally for these tools - it is always best 
to put the largest dataset "second" in the form. As the data is 
processed, the second file goes into memory and the first is compared 
against it. This can complete for system resources when large files are 
processed, but the specifications you note for your computer are within 
the range we recommend for personal usage and these standard tools.


If the job does fail for a memory reason, then you have a few choices. 
The first is to break up the target (second file) into smaller datasets 
and run the query against those individually, then merge the results. 
The second is to consider a larger cloud instance:

htttp://getgalaxy.org/cloud

Best,

Jen
Galaxy team

On 4/20/13 5:44 AM, Milad Bastami wrote:

Hi every body
I tried to perform a joining task on two interval dataset. The 1st had 
1500 region and the second one about 2 million region. The job is 
still running (more than 4 hours) and it has affected system 
performance. I'm not sure it is normal or not. If not, I don't know 
it's the matter of galaxy limitations or my pc's hardware 
configurations. Any help would be appreciated.


I am running galaxy local on bio-linux7 (win8 / bio-linux7 dual boot 
system)

system configurations :
CPU : core i7 9610 (6M)
RAM : 8 G
linux swap : 8 G
linux root : >700 G
Milad Bastamis,
Department of Medical Genetics
Shahid Beheshti's university of Medical Science



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with the joining of two interval dataset

2013-04-20 Thread Milad Bastami

Hi every body

I tried to perform a joining task on two interval dataset. The 1st had 1500 
region and the second one about 2 million region.The job is still running (more 
than 4 hours) and it has affected system performance. I'm not sure it is normal 
or not. If not, I don't know it's the matter ofgalaxy limitations or my pc's 
hardware configurations. Any help would be appreciated. 


I am running galaxy local on bio-linux7 (win8 / bio-linux7 dual boot system)

system configurations :
CPU : core i7 9610 (6M) 

RAM : 8 G
linux swap : 8 G
linux root : >700 G

 
Milad Bastamis, 

Department of Medical Genetics
Shahid Beheshti's university of Medical Science  
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem with GenomeSpace Exporter

2013-04-12 Thread Gema Sanz Santos

Dear all,

I'm trying to send some data from Galaxy to GenomeSpace, so I can work with
this data in Cistrome but I always got this error:

GURU MEDITATION: #57662f6109d0460791fa7122116f80ce

Internal Server Error
Galaxy was unable to sucessfully complete your request
An error occurred.
This may be an intermittent problem due to load or other unpredictable
factors, reloading the page may address the problem.


Could you please indicate me what to do?

Thank you in advance

Regards,
Gema


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem using Depth of Coverage (GATK)

2013-04-09 Thread Jennifer Jackson


Hello Gema,

The tool group "GATK-Tools (beta)" is not indexed to function with the 
hg19 genome.


As an alternative on the public Main Galaxy server, please see the tool 
group " BEDTools". There are two tools here that calculate coverage 
using BAM data as input.


Another alternative is to set up either a local or cloud Galaxy, obtain 
the hg19 indexes from GATK, then run the analysis there. If you wish to 
try this please see:

http://getgalaxy.org
http://usegalaxy.org/cloud

Take care,

Jen
Galaxy team

On 4/7/13 11:41 PM, Gema Sanz wrote:


Hello, I´m trying to use depth of coverage to check the coverage of my 
reads. I already have the bam files (created with sam to bam) but they 
are still not recognized by depth of coverage and I got this error 
message:


"Sequences are not currently available for the specified build"

I used "human (homo sapiens) hg19 full" for mapping but I can´t select 
it, it only allows b37 version. I tried to change the build in edit 
parameters to b37 and then it is recognized but I got another error at 
the end of the analysis.


Any suggestions?

Thank you very much in advance

Gema



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] problem using Depth of Coverage (GATK)

2013-04-07 Thread Gema Sanz

Hello, I´m trying to use depth of coverage to check the coverage of my
reads. I already have the bam files (created with sam to bam) but they are
still not recognized by depth of coverage and I got this error message:

"Sequences are not currently available for the specified build"

I used "human (homo sapiens) hg19 full" for mapping but I can´t select it,
it only allows b37 version. I tried to change the build in edit parameters
to b37 and then it is recognized but I got another error at the end of the
analysis.

Any suggestions?

Thank you very much in advance

Gema

 

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Problem with workflow step ordering

2013-03-19 Thread Jennifer Jackson


Hi Ian,

There is a ticket in Trello to enable manual reordering. You can track 
the progress of future development by following it:


https://trello.com/c/zUXz72RQ

For now, if you click on the "i" info icon for any dataset, the input 
dataset will be shown at the bottom of the form (we realize this is 
tedious for larger workflows/histories).


Regarding the last part of your question, the creation summary vs the 
history order, I'll forward this to Dannon (our primary workflow 
developer) so that he can take a look. If a new ticket is created, or 
there is other advice/a change made, we'll send an update reply.


Thanks for the feedback!

Jen
Galaxy team

On 3/15/13 6:33 AM, Ian Donaldson wrote:


When i create a GALAXY workflow the order of the steps in the summary 
are fine until the main pipeline diverges into multiple branches. Then 
the steps from the different branches get shuffled in the summary and 
it is difficult to see what is going on.



*Q. Is it possible to manually reorder steps in a GALAXY workflow 
summary?*



There used to a problem where workflows with multiple inputs would 
randomise the order of the inputs each time the workflow was run. Now 
the proximity of the inputs to the top left-hand edge of the workflow 
dictates the precedence.



Also, if i manually run the steps one at a time in order in a history 
and create a workflow from that, in the creation summary (just before 
making the workflow) everything is in order, however when the workflow 
is run the order has been messed up.


Thanks,
Ian



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem with workflow step ordering

2013-03-15 Thread Ian Donaldson

When i create a GALAXY workflow the order of the steps in the summary are fine 
until the main pipeline diverges into multiple branches. Then the steps from 
the different branches get shuffled in the summary and it is difficult to see 
what is going on.


Q. Is it possible to manually reorder steps in a GALAXY workflow summary?


There used to a problem where workflows with multiple inputs would randomise 
the order of the inputs each time the workflow was run. Now the proximity of 
the inputs to the top left-hand edge of the workflow dictates the precedence.

Also, if i manually run the steps one at a time in order in a history and 
create a workflow from that, in the creation summary (just before making the 
workflow) everything is in order, however when the workflow is run the order 
has been messed up.

Thanks,
Ian

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem Loading History Pane

2013-02-20 Thread Jennifer Jackson

Hello Lizex,

The utility tools from Tophat are not included with Galaxy, so that is 
perhaps why you are having trouble creating junctions files, but I am 
wondering if you need them at all.

You mention that you have different sequence types from different 
samples. These represent different conditions? Or some do and others are 
replicates or complete replacements for the originals (the re-sequenced 
data)?

For data representing different samples/conditions, you would not want 
to map the data together with Tophat or run it together in Cufflinks. 
Even replicates are not mapped in the same Tophat job, although they are 
included in the same Cufflinks job. The tool authors have an opinion 
about the value of replicates - so be sure to read about that at the 
Cufflinks web site.

http://cufflinks.cbcb.umd.edu/howitworks.html#reps

The first time different conditions would be in the same job would be at 
the stage where Cuffmerge is run, to prepare for Cuffdiff - where the 
differential expression analysis would take place. This is past the 
stage where individual reads are involved.

Our RNA-seq tutorial is here:
https://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise

And several donated by the Galaxy community are here:
http://wiki.galaxyproject.org/Learn#Other_Tutorials

But the best resource is the paper from the tool authors ("Protocol"):
http://tophat.cbcb.umd.edu/manual.html
http://cufflinks.cbcb.umd.edu/manual.html

In the end, you may decide that some of the complexity of your data can 
be reduced by dropping some datasets, to simplify and achieve the same 
overall results, or perhaps even improved results. In general, I think 
it is probably safe to say that the less "done" to prep expression data, 
and certainly the more homogeneous it is, the better the result. But 
this is your decision.

Good luck with your project. Next time when asking a question, please 
open a brand new email message and start a new thread, not reply to an 
existing thread and just change the subject line. This helps us with 
tracking and is appreciated.

Thanks!

Jen
Galaxy team

On 2/16/13 5:23 AM, Lizex Husselmann wrote:

Dear all

I have in my project single end reads (50 bp) for some samples and
paired end reads (100 bp frw and rev) for  the other samples. I had to
re-sequence some of the samples of which I have paired-end reads.
However the re-sequence data I receives is single-end reads of 250 bp.
Tophat wont allow mapping single and paired-end reads together. It says
the result will look bad. They do mention that you can convert the
junctions.bed file (output of Tophat) with bed_to_juncs using the -j
option. I quote for TopHat manual "run TopHat on the 2nd set of reads
using the -j option to supply the junctions file produced by be_to_juncs
in the previous step". This is supposed to work but I didn't get it to
work. Any suggestion on how I should go about analyzing this data?

Kind regards

Lizex

 >>> Nate Coraor  02/15/13 5:48 PM >>>
On Feb 15, 2013, at 10:35 AM, Mike Dufault wrote:

 > To whom it may concern:
 >
 > The History panel on the right side of the Galaxy page is taking a
very very long time to load. Also, when it does load, I have tired to
save my .bam files and the transmissions gets truncated to ~7000kb -
8000kb of data. All of my .bam files are several GB.
 >
 > Some times, when I retry tor download the data, it succeeds and other
times it is again truncated. The size of the truncation may be different
for the same file on the retry attempt.
 >
 > Is there a problem with Galaxy?

Hi Mike,

There are some performance problems with the Main site that we are
currently investigating Thanks for the information and we apologize for
the problems.

--nate

 >
 > Thanks,
 > Mike
 > ___
 > The Galaxy User list should be used for the discussion of
 > Galaxy analysis and other features on the public server
 > at usegalaxy.org. Please keep all replies on the list by
 > using "reply all" in your mail client. For discussion of
 > local Galaxy instances and the Galaxy source code, please
 > use the Galaxy Development list:
 >
 > http://lists.bx.psu.edu/listinfo/galaxy-dev
 >
 > To manage your subscriptions to this and other Galaxy lists,
 > please use the interface at:
 >
 > http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/

This message is confidential and may be covered by legal professional
privilege. It must not be read, cop

Re: [galaxy-user] Problem Loading History Pane

2013-02-16 Thread Lizex Husselmann

Dear all

I have in my project single end reads (50 bp) for some samples and paired end 
reads (100 bp frw and rev) for  the other samples. I had to re-sequence some of 
the samples of which I have paired-end reads. However the re-sequence data I 
receives is single-end reads of 250 bp. Tophat wont allow mapping single and 
paired-end reads together. It says the result will look bad. They do mention 
that you can convert the junctions.bed file (output of Tophat) with 
bed_to_juncs using the -j option. I quote for TopHat manual "run TopHat on the 
2nd set of reads using the -j option to supply the junctions file produced by 
be_to_juncs in the previous step". This is supposed to work but I didn't get it 
to work. Any suggestion on how I should go about analyzing this data? 

Kind regards

Lizex

>>> Nate Coraor  02/15/13 5:48 PM >>>
On Feb 15, 2013, at 10:35 AM, Mike Dufault wrote:

> To whom it may concern:
>  
> The History panel on the right side of the Galaxy page is taking a very very 
> long time to load. Also, when it does load, I have tired to save my bam files 
> and the transmissions gets truncated to ~7000kb - 8000kb of data. All of my 
> .bam files are several GB.
>  
> Some times, when I retry tor download the data, it succeeds and other times 
> it is again truncated. The size of the truncation may be different for the 
> same file on the retry attempt.
>  
> Is there a problem with Galaxy?

Hi Mike,

There are some performance problems with the Main site that we are currently 
investigating.  Thanks for the information and we apologize for the problems.

--nate

>  
> Thanks,
> Mike
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

This message is confidential and may be covered by legal professional 
privilege. It must not be read, copied, disclosed or used in any other manner 
by any person other than the addressee(s). Unauthorised use, disclosure or 
copying is strictly prohibited and may be unlawful. The views expressed in this 
email are those of the sender, unless otherwise stated. If you have received 
this email in error, please contact ARC Service Desk immediately. 
(mailto:serviced...@arc.agric.za)

To report incidents of fraud and / or corruption in the ARC use our Ethics 
Hotline by:

Phone number  : 0800 000 604
Fax number  : 0800 00 7788
Email address   : a...@tip-offs.com
 Please Call me  : 32840
 Website: www.tip-offs.com

For more information on the ARC Ethics Hotline, please visit our website at 
www.arc.agric.za.
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem Loading History Pane

2013-02-15 Thread Nate Coraor

On Feb 15, 2013, at 10:35 AM, Mike Dufault wrote:

> To whom it may concern:
>  
> The History panel on the right side of the Galaxy page is taking a very very 
> long time to load. Also, when it does load, I have tired to save my .bam 
> files and the transmissions gets truncated to ~7000kb - 8000kb of data. All 
> of my .bam files are several GB.
>  
> Some times, when I retry tor download the data, it succeeds and other times 
> it is again truncated. The size of the truncation may be different for the 
> same file on the retry attempt.
>  
> Is there a problem with Galaxy?

Hi Mike,

There are some performance problems with the Main site that we are currently 
investigating.  Thanks for the information and we apologize for the problems.

--nate

>  
> Thanks,
> Mike
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem Loading History Pane

2013-02-15 Thread Mike Dufault

To whom it may concern:
 
The History panel on the right side of the Galaxy page is taking a very very 
long time to load. Also, when it does load, I have tired to save my .bam files 
and the transmissions gets truncated to ~7000kb - 8000kb of data. All of my 
.bam files are several GB.
 
Some times, when I retry tor download the data, it succeeds and other times it 
is again truncated. The size of the truncation may be different for the same 
file on the retry attempt.
 
Is there a problem with Galaxy?
 
Thanks,
Mike___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem

2013-02-13 Thread Jennifer Jackson


Hello Christopher,

The reference annotation will need to include the attribute gene_name in 
order for this to be in the final output. If not provided, gene_id from 
the GTF/GFF3 file will be in the output instead. In addition, if the 
reference annotation does not contain the attributes p_id and tss_id, 
then some functions of Cuffdiff will be skipped. If no reference 
annotation is used, then Cufflinks will assign gene_id/transcript_id, 
but it does not generate the other attributes and again full 
functionality of Cuffdiff will not be envoked.


When you mention "duplicate error" I am guessing that the reference 
annotation file that you are using has formatting problems? This is true 
for some sources, in particular with GFF3 files and duplicated "ID" 
attributes. Sometimes these can be corrected, but it is not always 
simple, and the best advice is to contact the source for a correction or 
to select a different source for annotation, ideally one that also 
contains the p_id and tss_id attributes, plus in your case, the 
gene_name attribute since that is important to you.


Or you can try to correct. This isn't recommended as a first choice 
solution as each of these duplicate ID problems tends to be a bit 
different and there isn't a single, simple solution. Also, changing the 
file at all could cause problems with the overall integrity and this 
could be very difficult problem to detect. But if this is something you 
decided to do, test carefully - the /*RNA-seq analysis*/ *tools *link 
below has links to formats and there are some command-line and online 
tools that will help to verify format.


Our wiki has some guidelines for where to find help and how to verify 
format. Once at the Cufflinks tool site, the Manual explains more about 
how attributes are used. Getting Started and Protocol can help with 
developing a pipeline that yields the desired results.

See Tools on the Main server: /Example/ ? /*RNA-seq analysis*/ *tools.*
http://wiki.galaxyproject.org/Support#Interpreting_scientific_results

I can also point you directly to the iGenomes reference annotation at 
the Cufflinks web site.

Perhaps your genome is here:
http://cufflinks.cbcb.umd.edu/igenomes.html

On the public Main Galaxy server (usegalaxy.org), the UCSC hg19 and mm9 
gtf files are available under "Shared Data -> Data Libraries -> 
iGenomes". These can be directly imported into a history as a dataset 
and used with the RNA Analysis tool set.


But, the iGenomes datasets do not cover all genomes and in fact all 
genomes will not even have an appropriate reference dataset available. 
If you think that you have found yourself here, then you might want to 
send an email to the tool support group *tophat.cuffli...@gmail.com* 
 and see if someone has advice. Be 
sure to mention the genome/build you are working with. There could be a 
resource someone else on the list may be able to suggest.


Hopefully some part of this leads you to a successful analysis run!

Jen
Galaxy team

On 2/13/13 3:03 PM, Christopher O'Toole wrote:

Hi,
Can you help me?
I'm using the main Galaxy server for RNA-Seq analysis and I'm having 
trouble.   I'm running top hat analysis, followed by cuff links, cuff 
compare and finally cuffdiff.   I'm unable to retrieve gene names from 
the final cuffdiff analysis.   I have tried using genome annotation 
with cuff links and cuff compare, but I either run into a duplicate 
error or the result does not include gene names.  I am new to this, I 
have only been using Galaxy for a week, so could any suggestions be 
simplistic please!

Thanks!
Christopher O'Toole.


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem

2013-02-13 Thread Christopher O'Toole

Hi,

Can you help me?
 
I'm using the main Galaxy server for RNA-Seq analysis and I'm having trouble.   
I'm running top hat analysis, followed by cuff links, cuff compare and finally 
cuffdiff.   I'm unable to retrieve gene names from the final cuffdiff analysis. 
  I have tried using genome annotation with cuff links and cuff compare, but I 
either run into a duplicate error or the result does not include gene names.  I 
am new to this, I have only been using Galaxy for a week, so could any 
suggestions be simplistic please!

Thanks!

Christopher O'Toole.___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem Joining Two Datasets

2013-01-25 Thread Jennifer Jackson


Hello Kim,

We can confirm that a few of the newest datasets in your most recent 
history have odd properties. The way around this is to copy the datasets 
into a new history (an option under "History" menu), convert the 
delimiters to tabs (a tool under "Text Manipulation"), then use the join 
tools.


Something likely went wrong during the upload. It isn't something we 
have seen before, but we do have your example now to help track down any 
reproducible problems, should it come up again.


The "Saved Histories -> View" issue I can also confirm in your account. 
We will get back you about that shortly.


Thanks!

Jen
Galaxy team

On 1/24/13 2:36 PM, Kim Spradling wrote:

Good Afternoon,

I have been having problems with my Galaxy account.  The upload issue I
was having has been fixed, but now I can't seem to join two datasets.  I
have checked both text files that I want to join to ensure they have
common columns, but there are no options available when I try the
drop-down menu to select a sheet to join.

I also get an error message stating "Either you are not allowed to view
this history or the owner of this history has not made it accessible"
when I first try to view one of my other saved histories, but then the
files eventually appear for that saved history.

Thanks,
Kim
*/
/*


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

[galaxy-user] Problem Joining Two Datasets

2013-01-24 Thread Kim Spradling

Good Afternoon,

I have been having problems with my Galaxy account.  The upload issue I was 
having has been fixed, but now I can't seem to join two datasets.  I have 
checked both text files that I want to join to ensure they have common columns, 
but there are no options available when I try the drop-down menu to select a 
sheet to join.  

I also get an error message stating "Either you are not allowed to view this 
history or the owner of this history has not made it accessible" when I first 
try to view one of my other saved histories, but then the files eventually 
appear for that saved history.  

Thanks,
Kim

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with BWA?

2013-01-22 Thread Jennifer Jackson


Hi Mike,

The public Main Galaxy instance has been very busy for the last week or 
so, and wait times for NGS jobs have been a bit longer than usual.


The important part is to leave jobs in the waiting-to-run "grey" state 
and not stop/restart or they will effectively be moved back to the end 
of the wait queue. In any case, by now your jobs should have run, but I 
wanted to post a reply, for others who may be currently waiting for jobs 
to run. Best advice -> leave jobs in queue.


As always, local or cloud instances are alternatives for those with time 
constraints:

http://getgalaxy.org
http://usegalaxy.org/cloud

Best,

Jen
Galaxy team

On 1/19/13 5:39 AM, Mike Dufault wrote:

To whom it may concern:
I have noticed that my workflow has been stuck on "align with BWA for
illumina" for ~24hrs. Is there a problem?
Thanks,
Mike



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Hillman-Jackson
Galaxy Support and Training
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

[galaxy-user] Problem with BWA?

2013-01-19 Thread Mike Dufault

To whom it may concern:
 
I have noticed that my workflow has been stuck on "align with BWA for illumina" 
for ~24hrs. Is there a problem?
 
Thanks,
Mike___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem in Manage data Library

2012-12-06 Thread Sachit Adhikari

We have found that, in Galaxy, when we add dataset to a library under
Manage data libraries, Galaxy sometimes detects the type of the file and
sometimes does not. What I have noticed is that it detects the type of the
file when we select "Copy file into Galaxy" under "Copy data into Galaxy?"
option and does not detect it when we select "Link to files ..." Is this a
known issue?

Regards,
Sachit
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] problem uploading via FTP server

2012-09-14 Thread Jennifer Jackson


Linda,

There was some maintenance performed this morning that may be related to 
job delays (a notice was on the Galaxy Main masthead most of the week). 
That is now complete.


Was the FTP this morning and did FileZilla report that both were 
successful? Are you still having a problem with the history dataset load?


Please let us know if you are still having problems,

Jen
Galaxy team

On 9/14/12 3:02 AM, L.M. Slot wrote:

Dear Galaxy,

I am using Galaxy on my work for analysing a whole genome sequencing
project.

On the server I wanted to upload two BAM files (ALL and FL). With
FileZilla I uploaded them on the FTP server because the files are around
20 GB.

When I tried to upload them in Galaxy I can see them in the list from
the FTP server and when I try to upload them they appear in the column
on the right, but they stay gray and the comment 'job is waiting to run'
stays present instead of 'job running' or 'completed'.

Hopefully you can help me with this problem.

With kind regards,

Linda Slot

Linda Slot, MSc

AMC Amsterdam

Department of Pathology, L2-115

Meibergdreef 9

1105 AZ Amsterdam

The Netherlands

tel.nr. 020-5665638

What to include in a question

1.Where you are using Galaxy: Main ,
other public, local, or cloud instance

2.End-user questions from Test  are
generally not sent/supported - /Test is for breaking/

3.If a local or cloud instance, the distribution or galaxy-central hg
pull #

4.If on Main , date/time the initial and
ru-run jobs were executed

5.If there is an example/issue, exact steps to reproduce

6.What troubleshooting steps (if a problem is being reported) you have
tested out

7.If on Main , you may be asked for a
shared history link. Use */Options /**/→/**/Share or Publish/*, generate
the link, and email it directly back off-list. Note the dataset #'s you
have questions about.

8.*IMPORTANT*: Get the /quickest answer/ for data questions by leaving
*all* of the input and output datasets in the analysis thread in your
shared history */undeleted/* until we have written you back. Use
*/Options /**/→/**/Show Deleted Datasets/*and click dataset links to
*/undelete/* to recover datasets if necessary

9.*Always */reply-all/*unless sharing a private link*



AMC Disclaimer : http://www.amc.nl/disclaimer





___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

[galaxy-user] problem uploading via FTP server

2012-09-14 Thread L.M. Slot

Dear Galaxy,

I am using Galaxy on my work for analysing a whole genome sequencing project.

On the server I wanted to upload two BAM files (ALL and FL). With FileZilla I 
uploaded them on the FTP server because the files are around 20 GB.
When I tried to upload them in Galaxy I can see them in the list from the FTP 
server and when I try to upload them they appear in the column on the right, 
but they stay gray and the comment 'job is waiting to run' stays present 
instead of 'job running' or 'completed'.

Hopefully you can help me with this problem.

With kind regards,

Linda Slot

Linda Slot, MSc
AMC Amsterdam
Department of Pathology, L2-115
Meibergdreef 9
1105 AZ Amsterdam
The Netherlands
tel.nr. 020-5665638

What to include in a question

1.Where you are using Galaxy: Main, other 
public, local, or cloud instance

2.End-user questions from Test are 
generally not sent/supported - Test is for breaking
3.If a local or cloud instance, the distribution or galaxy-central hg pull #

4.If on Main, date/time the initial and 
ru-run jobs were executed
5.If there is an example/issue, exact steps to reproduce
6.What troubleshooting steps (if a problem is being reported) you have 
tested out

7.If on Main, you may be asked for a shared 
history link. Use Options → Share or Publish, generate the link, and email it 
directly back off-list. Note the dataset #'s you have questions about.

8.IMPORTANT: Get the quickest answer for data questions by leaving all of 
the input and output datasets in the analysis thread in your shared history 
undeleted until we have written you back. Use Options → Show Deleted Datasets 
and click dataset links to undelete to recover datasets if necessary

9.Always reply-all unless sharing a private link




AMC Disclaimer : http://www.amc.nl/disclaimer


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] problem running MACS on Galaxy

2012-08-31 Thread Jennifer Jackson


Hello Amit,

Sorry to hear you are having problems. Are you using the public Main 
Galaxy instance (http://main.g2.bx.psu.edu) or a local install?


If using Main and the result is an actual error, please submit a bug 
report from one of the failed datasets.

http://wiki.g2.bx.psu.edu/Support#Reporting_tool_errors

If the result is not an error, please share a history link. "Options 
(gear icon) -> Share or Publish", generate link, email back to just me.


For both - be certain to leave the MACS datasets and all inputs 
undeleted in your history.


If you are working with a local install, please let us know and we can 
troubleshoot from there. More detail about the problem would be needed.


Best,

Jen
Galaxy team

http://wiki.g2.bx.psu.edu/Support#Error_from_tools
http://wiki.g2.bx.psu.edu/Support#Reporting_tool_errors


On 8/31/12 2:27 AM, Amit Pande wrote:

Dear galaxy,

I am trying to run BAM files for Peak calling using MACS and for the
larger files above 2GB I am continuously getting no results.
Can you please identify the source of this kind of error.

warm regards,
Amit


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

[galaxy-user] problem running MACS on Galaxy

2012-08-31 Thread Amit Pande

Dear galaxy,

I am trying to run BAM files for Peak calling using MACS and for the larger
files above 2GB I am continuously getting no results.
Can you please identify the source of this kind of error.

warm regards,
Amit
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with running Cufflinks

2012-08-10 Thread Jennifer Jackson


Hello Yan,

This workflow can be used to sort SAM input for Cufflinks:
http://main.g2.bx.psu.edu/u/jeremy/p/transcriptome-analysis-faq#faq2

Best,

Jen
Galaxy team

On 8/10/12 3:13 AM, Yan He wrote:


Hi everyone,

After mapping my RNA-seq data to the reference transcriptome using Bowtie, I 
tried to run Cufflinks, but got the following error message. It seems that I 
need to sort the SAM file got from Bowtie mapping. Dose anyone know how to 
solve this problem? Many thanks!


*Error running cufflinks.
return code = 1
cufflinks: /lib64/libz.so.1: no version information available (required by 
cufflinks)
Command line:
cufflinks -q --no-update-check -I 30 -F 0.10 -j 0.15 -p 8 
/galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat
[bam_header_read] EOF marker is absent.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
File /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat doesn't appear 
to be a valid BAM file, trying SAM...
[03:31:18] Inspecting reads and determining fragment length distribution.

Error: this SAM file doesn't appear to be correctly sorted!
current hit is at CGI_10025607:534, last one was at CGI_10021217:812
Cufflinks requires that if your file has SQ records in
the SAM header that they appear in the same order as the chromosomes names
in the alignments.
If there are no SQ records in the header, or if the header is missing,
the alignments must be sorted lexicographically by chromsome
name and by position.*



Yan



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/



--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

[galaxy-user] Problem with running Cufflinks

2012-08-10 Thread Yan He



Hi everyone,

After mapping my RNA-seq data to the reference transcriptome using Bowtie, I 
tried to run Cufflinks, but got the following error message. It seems that I 
need to sort the SAM file got from Bowtie mapping. Dose anyone know how to 
solve this problem? Many thanks!


Error running cufflinks.
return code = 1
cufflinks: /lib64/libz.so.1: no version information available (required by 
cufflinks)
Command line:
cufflinks -q --no-update-check -I 30 -F 0.10 -j 0.15 -p 8 
/galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat 
[bam_header_read] EOF marker is absent.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
File /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat doesn't appear 
to be a valid BAM file, trying SAM...
[03:31:18] Inspecting reads and determining fragment length distribution.

Error: this SAM file doesn't appear to be correctly sorted!
current hit is at CGI_10025607:534, last one was at CGI_10021217:812
Cufflinks requires that if your file has SQ records in
the SAM header that they appear in the same order as the chromosomes names 
in the alignments.
If there are no SQ records in the header, or if the header is missing,
the alignments must be sorted lexicographically by chromsome
name and by position.
 
  

Yan
  ___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem setting up admin in Galaxy local instance!

2012-07-20 Thread Daniel Blankenberg

Hi Di,

You need to remove the starting comment/hash from the admin_users line:
admin_users = dkngu...@uw.edu


Thanks for using Galaxy,

Dan


On Jul 20, 2012, at 5:13 PM, Di Nguyen wrote:

> Dear all,
> 
> Please help me figure out what went wrong to set up ADMIN in my local 
> instance using the new retinaMBP! This is what I did
> 
> 1. I changed universe_wsgi.ini.sample file into universe_wsgi.ini (using Mac 
> TextEdit)
> 
> 2. Then, I edited universe_wsgi.ini as followed:
> 
> # Administrative users - set this to a comma-separated list of valid Galaxy
> # users (email addresses).  These users will have access to the Admin section
> # of the server, and will have access to create users, groups, roles,
> # libraries, and more.  For more information, see:
> # http://wiki.g2.bx.psu.edu/Admin/Interface
> #admin_users = dkngu...@uw.edu
> 
> 3. I shutdown Galaxy, rerun sh run.sh, log back in Galaxy but still no Admin 
> function.
> 
> 4. The reason that I wanted to ad Admin function is to import my NGS files 
> (bigger than 2Gb fer sure) into Galaxy database. Please give me some tips on 
> this as well.
> 
> Thank you very much,
> 
> Di Nguyen, postdoc
> U of Washington, Seattle, WA
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem setting up admin in Galaxy local instance!

2012-07-20 Thread Di Nguyen


Dear all,

Please help me figure out what went wrong to set up ADMIN in my local 
instance using the new retinaMBP! This is what I did


1. I changed universe_wsgi.ini.sample file into universe_wsgi.ini (using 
Mac TextEdit)


2. Then, I edited universe_wsgi.ini as followed:

# Administrative users - set this to a comma-separated list of valid Galaxy
# users (email addresses).  These users will have access to the Admin 
section

# of the server, and will have access to create users, groups, roles,
# libraries, and more.  For more information, see:
# http://wiki.g2.bx.psu.edu/Admin/Interface
#admin_users = *dkngu...@uw.edu*

3. I shutdown Galaxy, rerun sh run.sh, log back in Galaxy but still no 
Admin function.


4. The reason that I wanted to ad Admin function is to import my NGS 
files (bigger than 2Gb fer sure) into Galaxy database. Please give me 
some tips on this as well.


Thank you very much,

Di Nguyen, postdoc
U of Washington, Seattle, WA


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with ftp transfer of large bam files

2012-07-06 Thread Hans Matsson

Hi again,

The problem with ftp transferred files not showing up under my account in 
Galaxy (main) is actually solved now. I could be an issue of being logged in 
from many clients at the same time - when I logout from Galaxy and then start 
ftp transfer - upon logging in to Galaxy again I can indeed see the files 
listed under "Upload File".
All your items 1-4 below checked out as ok by the way and I was below the quota.

Cheers

/Hans

From: Jennifer Jackson [mailto:j...@bx.psu.edu]
Sent: den 4 juli 2012 22:39
To: Hans Matsson
Cc: galaxy-u...@bx.psu.edu
Subject: Re: [galaxy-user] Problem with ftp transfer of large bam files

Helllo Hans,

Some items to double check:

1 - The ftp server is: "main.g2.bx.psu.edu"
2 - Files are 50G or smaller. This is a hard limit - if your data is larger, a 
local or cloud instance will be needed: http://getgalaxy.org
3 - FileZilla reports that FTP is successful (there is a tab at the bottom of 
the UI, click on this and it will list the actual status of transfer, so that 
there is no ambiguity)
4 - The user/pass credentials used in Filezilla are the same as those being 
used for your Galaxy account. If you have multiple accounts (you shouldn't...), 
the data may be in another account.
*note:* If you are using multiple accounts, please copy all data to a single 
account and permanently delete from the others. The public instance supports 
one account per user only.

If you are over quota (have more than 250G of data), this will prevent moving a 
data file from the FTP transfer area into a history, but it will not block the 
FTP transfer itself.

It does sound as if you have already seen the FTP wiki/screencast, but I'll 
post the wiki just in case:
http://wiki.g2.bx.psu.edu/FTPUpload

Hopefully one of these helps to work out the issue,

Jen
Galaxy team
On 7/4/12 7:24 AM, Hans Matsson wrote:
Hi,
I´m using Galaxy (main) browser on a Win 7 PC to get statistics from my 
sequencing runs. Now I have bam files which are too big for upload from my 
local hard drive so I tried to ftp upload to main.g2.bx.psu.edu via a client 
(FileZilla). The transfer of files seems to be complete but the files do not 
appear under Get Data/Upload File and I have the message "Your FTP upload 
directory contains no files". I have tried to upload txt, zip, and bam files by 
ftp but nothing worked.


Any suggestions?

Many thanks
/Hans

Hans Matsson, PhD
Karolinska Institutet
Department of Biosciences and Nutrition
Novum
Hälsovägen 7-9
SE-141 83 Huddinge, Sweden

Email: hans.mats...@ki.se<mailto:hans.mats...@ki.se>
Phone (office): +46-8-524 81143
¤¤





___

The Galaxy User list should be used for the discussion of

Galaxy analysis and other features on the public server

at usegalaxy.org.  Please keep all replies on the list by

using "reply all" in your mail client.  For discussion of

local Galaxy instances and the Galaxy source code, please

use the Galaxy Development list:



  http://lists.bx.psu.edu/listinfo/galaxy-dev



To manage your subscriptions to this and other Galaxy lists,

please use the interface at:



  http://lists.bx.psu.edu/



--

Jennifer Jackson

http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with ftp transfer of large bam files

2012-07-04 Thread Jennifer Jackson


Helllo Hans,

Some items to double check:

1 - The ftp server is: "main.g2.bx.psu.edu"
2 - Files are 50G or smaller. This is a hard limit - if your data is 
larger, a local or cloud instance will be needed: http://getgalaxy.org
3 - FileZilla reports that FTP is successful (there is a tab at the 
bottom of the UI, click on this and it will list the actual status of 
transfer, so that there is no ambiguity)
4 - The user/pass credentials used in Filezilla are the same as those 
being used for your Galaxy account. If you have multiple accounts (you 
shouldn't...), the data may be in another account.
*note:* If you are using multiple accounts, please copy all data to a 
single account and permanently delete from the others. The public 
instance supports one account per user only.


If you are over quota (have more than 250G of data), this will prevent 
moving a data file from the FTP transfer area into a history, but it 
will not block the FTP transfer itself.


It does sound as if you have already seen the FTP wiki/screencast, but 
I'll post the wiki just in case:

http://wiki.g2.bx.psu.edu/FTPUpload

Hopefully one of these helps to work out the issue,

Jen
Galaxy team

On 7/4/12 7:24 AM, Hans Matsson wrote:


Hi,

I´m using Galaxy (main) browser on a Win 7 PC to get statistics from 
my sequencing runs. Now I have bam files which are too big for upload 
from my local hard drive so I tried to ftp upload to 
*main.g2.bx.psu.edu***via a client (FileZilla). The transfer of files 
seems to be complete but the files do not appear under Get Data/Upload 
File and I have the message "/Your FTP upload directory contains no 
files". //I have tried to upload txt, zip, and bam files by ftp but 
nothing worked./


//

//

/Any suggestions?/

//

Many thanks

/Hans

Hans Matsson, PhD

Karolinska Institutet

Department of Biosciences and Nutrition

Novum

Hälsovägen 7-9

SE-141 83 Huddinge, Sweden

Email: hans.mats...@ki.se

Phone (office): +46-8-524 81143

¤¤



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://galaxyproject.org



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem with ftp transfer of large bam files

2012-07-04 Thread Hans Matsson

Hi,
I´m using Galaxy (main) browser on a Win 7 PC to get statistics from my 
sequencing runs. Now I have bam files which are too big for upload from my 
local hard drive so I tried to ftp upload to main.g2.bx.psu.edu via a client 
(FileZilla). The transfer of files seems to be complete but the files do not 
appear under Get Data/Upload File and I have the message "Your FTP upload 
directory contains no files". I have tried to upload txt, zip, and bam files by 
ftp but nothing worked.


Any suggestions?

Many thanks
/Hans

Hans Matsson, PhD
Karolinska Institutet
Department of Biosciences and Nutrition
Novum
Hälsovägen 7-9
SE-141 83 Huddinge, Sweden

Email: hans.mats...@ki.se
Phone (office): +46-8-524 81143
¤¤

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-27 Thread Jennifer Jackson


Hi Lilach,

Regarding the cloud instance, you can load data from the public main 
instance of Galaxy just like any other URL.  On the "Get Data -> Upload 
Data" form on your cloud instance , paste in the URLs of the datasets 
from main. The URL can be captured by right-clicking on a dataset's disk 
icon and then "Copy link location" (on a Mac; do the equivalent if using 
a PC).


It is generally better to transfer one URL per job, if the data is 
large, since jobs have a certain amount of time to complete. If you lump 
together several large file URLs into one job, there could be a chance 
that it could time out. It is fine to execute several jobs concurrently.


Best,

Jen
Galaxy team

On 6/27/12 6:51 AM, Lilach Friedman wrote:

Hi Jennifer,
Is there a way to directly upload my files from the public Galaxy to 
my cloud Galaxy instance (in AWS)? Or should I download them first to 
my computer, and then to upload them? (It takes a lot of time because 
of the low  uploading speed).


Thanks,
   Lilach

2012/6/26 Jennifer Jackson mailto:j...@bx.psu.edu>>

Hello Lilach,

Currently, the human reference genome indexed for the GATK-beta
tools is 'hg_g1k_v37'. The GATK-beta tools are under active
revision by our team, so we expect there to be little to no change
to the beta version on the main public instance until this is
completed.

Attempting to convert data between different builds is not
recommended. These tools are very sensitive to exact inputs, which
extends to naming conventions, etc. The best practice path is to
start and continue an analysis project with the same exact genome
build throughout.

If you want to use the hg19 indexes provided by the GATK project,
a cloud instance is the current option (using a hg19 genome as a
'custom genome' will exceed the processing limits available on the
public Galaxy instance). Following the links on the GATK tools can
provide more information about sources, including links on the
GATK web site which will note the exact contents of the both of
these genome versions, downloads, and other resources.

Hopefully this helps to clear up any confusion,

Best,

Jen
Galaxy team


On 6/21/12 7:50 AM, Lilach Friedman wrote:

Hi Jennifer,
Thank you for this reply.

I made a new BWA file, this time using the hg19(full) genome.
However, when I am trying to use DepthOfCoverage, the reference
genomr is stucked on the hg_g1k_v37 (this is the only option to
select), and I cannot change it to hg19(full). Most probably,
because I selected hg_g1k_v37 in the previous time I tried to use
DepthOfCoverage.
It seems as a bug? How can I change it?

Thanks,
  Lilach


2012/6/18 Jennifer Jackson mailto:j...@bx.psu.edu>>

Hi Lilach,

The problem with this analysis probably has to do with a
mismatch between the genomes: the intervals obtained from
UCSC (hg19) and the BAM from your BWA (hg_g1k_v37) run.

UCSC does not contain the genome 'hg_g1k_v37' - the genome
available from UCSC is 'hg19'.

Even though these are technically the same human release, on
a practical level, they have a different arrangement for some
of the chromosomes. You can compare NBCI GRCh37
with UCSC
hg19 for an explanation. Reference
genomes must be /exact/ in order to be used with tools - base
for base. When they are exact, the identifier will be exact
between Galaxy and the source (UCSC, Ensembl) or the full
Build name will provide enough information to make a
connection to NCBI or other.

Sometimes genomes are similar enough that a dataset sourced
from one can be used with another, if the database attribute
is changed and the data from the regions that differ is
removed. This may be possible in your case, only trying will
let you know how difficult it actually is with your analysis.
The GATK pipeline is very sensitive to exact inputs. You will
need to be careful with genome database assignments, etc.
Following the links on the tool forms to the GATK help pages
can provide some more detail about expected inputs, if this
is something that you are going to try.

Good luck with the re-run!

Jen
Galaxy team


On 6/18/12 4:42 AM, Lilach Friedman wrote:

Hi,
I am trying to used Depth of Coverage to see the coverages
is specific intervals.
The intervals were taken from UCSC (exons of 2 genes),
loaded to Galaxy and the file type was changed to intervals.

I gave to Depth of Coverage two BAM files (resulted from
BWA, selection of only raws with the Matching pattern:
XT:A:U, and then SAM-to-BAM)
and the intervals file

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-27 Thread Jennifer Jackson


Hello Lilach,

The genome build 'hg_g1k_v37' is build "b37" in the GATK documentation. 
Hg19 is also included (as a distinct build). I encourage you to examine 
these if you are interested in crossing over between genomes or 
identifying other projects that have data based on the same genome build.


http://www.broadinstitute.org/gsa/wiki/index.php/Introduction_to_the_GATK ->
http://www.broadinstitute.org/gsa/wiki/index.php/GATK_resource_bundle

" GATK resource bundle: A collection of standard files for working with 
human resequencing data with the GATK.


The standard reference sequence we use in the GATK is the the b37 
edition from the Human Genome Reference Consortium. All of the key GATK 
data files are available against this reference sequence. Additionally, 
we used to use UCSC-style (chr1, not 1) for build hg18, and provide 
lifted-over files from b37 to hg18 for those still using those files.


b37 resources: the standard data set
* Reference sequence (standard 1000 Genomes fasta) along with fai and 
dict files



hg19 resources: lifted over from b37
* Includes the UCSC-style hg19 reference along with all lifted over VCF 
files."


Hopefully this helps,

Jen
Galaxy team

On 6/27/12 7:09 AM, Lilach Friedman wrote:
May I join to the question of Carlos? what is exactly hg_g1k_v37? and 
how can I get the intervals of specific genes in this format?


Thanks,
  Lilach


2012/6/27 Lilach Friedman mailto:lilac...@gmail.com>>

Hi Jennifer,
Is there a way to directly upload my files from the public Galaxy
to my cloud Galaxy instance (in AWS)? Or should I download them
first to my computer, and then to upload them? (It takes a lot of
time because of the low  uploading speed).

Thanks,
   Lilach


2012/6/26 Jennifer Jackson mailto:j...@bx.psu.edu>>

Hello Lilach,

Currently, the human reference genome indexed for the
GATK-beta tools is 'hg_g1k_v37'. The GATK-beta tools are under
active revision by our team, so we expect there to be little
to no change to the beta version on the main public instance
until this is completed.

Attempting to convert data between different builds is not
recommended. These tools are very sensitive to exact inputs,
which extends to naming conventions, etc. The best practice
path is to start and continue an analysis project with the
same exact genome build throughout.

If you want to use the hg19 indexes provided by the GATK
project, a cloud instance is the current option (using a hg19
genome as a 'custom genome' will exceed the processing limits
available on the public Galaxy instance). Following the links
on the GATK tools can provide more information about sources,
including links on the GATK web site which will note the exact
contents of the both of these genome versions, downloads, and
other resources.

Hopefully this helps to clear up any confusion,

Best,

Jen
Galaxy team


On 6/21/12 7:50 AM, Lilach Friedman wrote:

Hi Jennifer,
Thank you for this reply.

I made a new BWA file, this time using the hg19(full) genome.
However, when I am trying to use DepthOfCoverage, the
reference genomr is stucked on the hg_g1k_v37 (this is the
only option to select), and I cannot change it to hg19(full).
Most probably, because I selected hg_g1k_v37 in the previous
time I tried to use DepthOfCoverage.
It seems as a bug? How can I change it?

Thanks,
  Lilach


2012/6/18 Jennifer Jackson mailto:j...@bx.psu.edu>>

Hi Lilach,

The problem with this analysis probably has to do with a
mismatch between the genomes: the intervals obtained from
UCSC (hg19) and the BAM from your BWA (hg_g1k_v37) run.

UCSC does not contain the genome 'hg_g1k_v37' - the
genome available from UCSC is 'hg19'.

Even though these are technically the same human release,
on a practical level, they have a different arrangement
for some of the chromosomes. You can compare NBCI GRCh37
  with
UCSC hg19 for an explanation.
Reference genomes must be /exact/ in order to be used
with tools - base for base. When they are exact, the
identifier will be exact between Galaxy and the source
(UCSC, Ensembl) or the full Build name will provide
enough information to make a connection to NCBI or other.

Sometimes genomes are similar enough that a dataset
sourced from one can be used with another, if the
database attribute is changed and the data from the
regions that differ is removed. This may be possible in

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-27 Thread Lilach Friedman

May I join to the question of Carlos? what is exactly hg_g1k_v37? and how
can I get the intervals of specific genes in this format?

Thanks,
  Lilach


2012/6/27 Lilach Friedman 

> Hi Jennifer,
> Is there a way to directly upload my files from the public Galaxy to my
> cloud Galaxy instance (in AWS)? Or should I download them first to my
> computer, and then to upload them? (It takes a lot of time because of the
> low  uploading speed).
>
> Thanks,
>Lilach
>
>
> 2012/6/26 Jennifer Jackson 
>
>>  Hello Lilach,
>>
>> Currently, the human reference genome indexed for the GATK-beta tools is
>> 'hg_g1k_v37'. The GATK-beta tools are under active revision by our team, so
>> we expect there to be little to no change to the beta version on the main
>> public instance until this is completed.
>>
>> Attempting to convert data between different builds is not recommended.
>> These tools are very sensitive to exact inputs, which extends to naming
>> conventions, etc. The best practice path is to start and continue an
>> analysis project with the same exact genome build throughout.
>>
>> If you want to use the hg19 indexes provided by the GATK project, a cloud
>> instance is the current option (using a hg19 genome as a 'custom genome'
>> will exceed the processing limits available on the public Galaxy instance).
>> Following the links on the GATK tools can provide more information about
>> sources, including links on the GATK web site which will note the exact
>> contents of the both of these genome versions, downloads, and other
>> resources.
>>
>> Hopefully this helps to clear up any confusion,
>>
>> Best,
>>
>> Jen
>> Galaxy team
>>
>>
>> On 6/21/12 7:50 AM, Lilach Friedman wrote:
>>
>> Hi Jennifer,
>> Thank you for this reply.
>>
>> I made a new BWA file, this time using the hg19(full) genome.
>> However, when I am trying to use DepthOfCoverage, the reference genomr is
>> stucked on the hg_g1k_v37 (this is the only option to select), and I cannot
>> change it to hg19(full). Most probably, because I selected hg_g1k_v37 in
>> the previous time I tried to use DepthOfCoverage.
>> It seems as a bug? How can I change it?
>>
>> Thanks,
>>   Lilach
>>
>>
>> 2012/6/18 Jennifer Jackson 
>>
>>>  Hi Lilach,
>>>
>>> The problem with this analysis probably has to do with a mismatch
>>> between the genomes: the intervals obtained from UCSC (hg19) and the BAM
>>> from your BWA (hg_g1k_v37) run.
>>>
>>> UCSC does not contain the genome 'hg_g1k_v37' - the genome available
>>> from UCSC is 'hg19'.
>>>
>>> Even though these are technically the same human release, on a practical
>>> level, they have a different arrangement for some of the chromosomes. You
>>> can compare NBCI GRCh37
>>> with UCSC hg19  for an explanation. Reference
>>> genomes must be *exact* in order to be used with tools - base for base.
>>> When they are exact, the identifier will be exact between Galaxy and the
>>> source (UCSC, Ensembl) or the full Build name will provide enough
>>> information to make a connection to NCBI or other.
>>>
>>> Sometimes genomes are similar enough that a dataset sourced from one can
>>> be used with another, if the database attribute is changed and the data
>>> from the regions that differ is removed. This may be possible in your case,
>>> only trying will let you know how difficult it actually is with your
>>> analysis. The GATK pipeline is very sensitive to exact inputs. You will
>>> need to be careful with genome database assignments, etc. Following the
>>> links on the tool forms to the GATK help pages can provide some more detail
>>> about expected inputs, if this is something that you are going to try.
>>>
>>> Good luck with the re-run!
>>>
>>> Jen
>>> Galaxy team
>>>
>>>
>>> On 6/18/12 4:42 AM, Lilach Friedman wrote:
>>>
>>>   Hi,
>>> I am trying to used Depth of Coverage to see the coverages is specific
>>> intervals.
>>> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
>>> and the file type was changed to intervals.
>>>
>>> I gave to Depth of Coverage two BAM files (resulted from BWA, selection
>>> of only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
>>> and the intervals file (in advanced GATK options).
>>> The consensus genome is hg_g1k_v37.
>>>
>>> I got the following error message:
>>>
>>>  An error occurred running this job: *Picked up _JAVA_OPTIONS:
>>> -Djava.io.tmpdir=/space/g2main
>>> # ERROR
>>> --
>>> # ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
>>> # ERROR The invalid argume
>>>
>>>
>>> *Is it a bug, or did I do anything wrong?
>>>
>>> I will be grateful for any help.
>>>
>>> Thanks!
>>>Lilach*
>>> *
>>>
>>>
>>>  ___
>>> The Galaxy User list should be used for the discussion of
>>> Galaxy analysis and other features on the pub

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-27 Thread Lilach Friedman

Hi Jennifer,
Is there a way to directly upload my files from the public Galaxy to my
cloud Galaxy instance (in AWS)? Or should I download them first to my
computer, and then to upload them? (It takes a lot of time because of the
low  uploading speed).

Thanks,
   Lilach

2012/6/26 Jennifer Jackson 

>  Hello Lilach,
>
> Currently, the human reference genome indexed for the GATK-beta tools is
> 'hg_g1k_v37'. The GATK-beta tools are under active revision by our team, so
> we expect there to be little to no change to the beta version on the main
> public instance until this is completed.
>
> Attempting to convert data between different builds is not recommended.
> These tools are very sensitive to exact inputs, which extends to naming
> conventions, etc. The best practice path is to start and continue an
> analysis project with the same exact genome build throughout.
>
> If you want to use the hg19 indexes provided by the GATK project, a cloud
> instance is the current option (using a hg19 genome as a 'custom genome'
> will exceed the processing limits available on the public Galaxy instance).
> Following the links on the GATK tools can provide more information about
> sources, including links on the GATK web site which will note the exact
> contents of the both of these genome versions, downloads, and other
> resources.
>
> Hopefully this helps to clear up any confusion,
>
> Best,
>
> Jen
> Galaxy team
>
>
> On 6/21/12 7:50 AM, Lilach Friedman wrote:
>
> Hi Jennifer,
> Thank you for this reply.
>
> I made a new BWA file, this time using the hg19(full) genome.
> However, when I am trying to use DepthOfCoverage, the reference genomr is
> stucked on the hg_g1k_v37 (this is the only option to select), and I cannot
> change it to hg19(full). Most probably, because I selected hg_g1k_v37 in
> the previous time I tried to use DepthOfCoverage.
> It seems as a bug? How can I change it?
>
> Thanks,
>   Lilach
>
>
> 2012/6/18 Jennifer Jackson 
>
>>  Hi Lilach,
>>
>> The problem with this analysis probably has to do with a mismatch between
>> the genomes: the intervals obtained from UCSC (hg19) and the BAM from your
>> BWA (hg_g1k_v37) run.
>>
>> UCSC does not contain the genome 'hg_g1k_v37' - the genome available from
>> UCSC is 'hg19'.
>>
>> Even though these are technically the same human release, on a practical
>> level, they have a different arrangement for some of the chromosomes. You
>> can compare NBCI GRCh37
>> with UCSC hg19  for an explanation. Reference
>> genomes must be *exact* in order to be used with tools - base for base.
>> When they are exact, the identifier will be exact between Galaxy and the
>> source (UCSC, Ensembl) or the full Build name will provide enough
>> information to make a connection to NCBI or other.
>>
>> Sometimes genomes are similar enough that a dataset sourced from one can
>> be used with another, if the database attribute is changed and the data
>> from the regions that differ is removed. This may be possible in your case,
>> only trying will let you know how difficult it actually is with your
>> analysis. The GATK pipeline is very sensitive to exact inputs. You will
>> need to be careful with genome database assignments, etc. Following the
>> links on the tool forms to the GATK help pages can provide some more detail
>> about expected inputs, if this is something that you are going to try.
>>
>> Good luck with the re-run!
>>
>> Jen
>> Galaxy team
>>
>>
>> On 6/18/12 4:42 AM, Lilach Friedman wrote:
>>
>>   Hi,
>> I am trying to used Depth of Coverage to see the coverages is specific
>> intervals.
>> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
>> and the file type was changed to intervals.
>>
>> I gave to Depth of Coverage two BAM files (resulted from BWA, selection
>> of only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
>> and the intervals file (in advanced GATK options).
>> The consensus genome is hg_g1k_v37.
>>
>> I got the following error message:
>>
>>  An error occurred running this job: *Picked up _JAVA_OPTIONS:
>> -Djava.io.tmpdir=/space/g2main
>> # ERROR
>> --
>> # ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
>> # ERROR The invalid argume
>>
>>
>> *Is it a bug, or did I do anything wrong?
>>
>> I will be grateful for any help.
>>
>> Thanks!
>>Lilach*
>> *
>>
>>
>>  ___
>> The Galaxy User list should be used for the discussion of
>> Galaxy analysis and other features on the public server
>> at usegalaxy.org.  Please keep all replies on the list by
>> using "reply all" in your mail client.  For discussion of
>> local Galaxy instances and the Galaxy source code, please
>> use the Galaxy Development list:
>>
>>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>>
>> To manage your subscription

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-26 Thread Carlos Borroto

Hi Lilach,

Sorry for the late response. Jen just confirmed the disadvantages of
my approach. I don't know how difficult could be for you to double
check the coordinates you have in your interval file are correct for
hg_g1k_v37. If you feel confident they will work and want to proceed,
you could do something like this outside of galaxy, you could also I'm
sure find a way to do it inside galaxy:

sed 's/^chr//' interval_file.csv > interval_file_g1k.csv

If you have coordinates for the mitochondrial chromosome you might
have to do also:
sed 's/^MT/M/' interval_file.csv > interval_file_g1k.csv

As if I remember correctly UCSC uses chrMT and GATK expects just M.
Please double check this as I'm not sure.

It would be also nice is there were a confirmation on what exactly
hg_g1k_v37 is, and where you could find annotations for it.
Annotations from Ensembl would do?

Regards,
Carlos

On Mon, Jun 25, 2012 at 5:22 PM, Jennifer Jackson  wrote:
> Hello Lilach,
>
> Currently, the human reference genome indexed for the GATK-beta tools is
> 'hg_g1k_v37'. The GATK-beta tools are under active revision by our team, so
> we expect there to be little to no change to the beta version on the main
> public instance until this is completed.
>
> Attempting to convert data between different builds is not recommended.
> These tools are very sensitive to exact inputs, which extends to naming
> conventions, etc. The best practice path is to start and continue an
> analysis project with the same exact genome build throughout.
>
> If you want to use the hg19 indexes provided by the GATK project, a cloud
> instance is the current option (using a hg19 genome as a 'custom genome'
> will exceed the processing limits available on the public Galaxy instance).
> Following the links on the GATK tools can provide more information about
> sources, including links on the GATK web site which will note the exact
> contents of the both of these genome versions, downloads, and other
> resources.
>
> Hopefully this helps to clear up any confusion,
>
> Best,
>
> Jen
> Galaxy team
>
>
> On 6/21/12 7:50 AM, Lilach Friedman wrote:
>
> Hi Jennifer,
> Thank you for this reply.
>
> I made a new BWA file, this time using the hg19(full) genome.
> However, when I am trying to use DepthOfCoverage, the reference genomr is
> stucked on the hg_g1k_v37 (this is the only option to select), and I cannot
> change it to hg19(full). Most probably, because I selected hg_g1k_v37 in the
> previous time I tried to use DepthOfCoverage.
> It seems as a bug? How can I change it?
>
> Thanks,
>   Lilach
>
>
> 2012/6/18 Jennifer Jackson 
>>
>> Hi Lilach,
>>
>> The problem with this analysis probably has to do with a mismatch between
>> the genomes: the intervals obtained from UCSC (hg19) and the BAM from your
>> BWA (hg_g1k_v37) run.
>>
>> UCSC does not contain the genome 'hg_g1k_v37' - the genome available from
>> UCSC is 'hg19'.
>>
>> Even though these are technically the same human release, on a practical
>> level, they have a different arrangement for some of the chromosomes. You
>> can compare NBCI GRCh37  with UCSC hg19 for an explanation. Reference
>> genomes must be exact in order to be used with tools - base for base. When
>> they are exact, the identifier will be exact between Galaxy and the source
>> (UCSC, Ensembl) or the full Build name will provide enough information to
>> make a connection to NCBI or other.
>>
>> Sometimes genomes are similar enough that a dataset sourced from one can
>> be used with another, if the database attribute is changed and the data from
>> the regions that differ is removed. This may be possible in your case, only
>> trying will let you know how difficult it actually is with your analysis.
>> The GATK pipeline is very sensitive to exact inputs. You will need to be
>> careful with genome database assignments, etc. Following the links on the
>> tool forms to the GATK help pages can provide some more detail about
>> expected inputs, if this is something that you are going to try.
>>
>> Good luck with the re-run!
>>
>> Jen
>> Galaxy team
>>
>>
>> On 6/18/12 4:42 AM, Lilach Friedman wrote:
>>
>> Hi,
>> I am trying to used Depth of Coverage to see the coverages is specific
>> intervals.
>> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
>> and the file type was changed to intervals.
>>
>> I gave to Depth of Coverage two BAM files (resulted from BWA, selection of
>> only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
>> and the intervals file (in advanced GATK options).
>> The consensus genome is hg_g1k_v37.
>>
>> I got the following error message:
>>
>> An error occurred running this job: Picked up _JAVA_OPTIONS:
>> -Djava.io.tmpdir=/space/g2main
>> # ERROR
>> --
>> # ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
>> # ERROR The invalid argume
>>
>>
>> Is it a bug, or did I do anything wrong?
>>
>>

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-25 Thread Jennifer Jackson


Hello Lilach,

Currently, the human reference genome indexed for the GATK-beta tools is 
'hg_g1k_v37'. The GATK-beta tools are under active revision by our team, 
so we expect there to be little to no change to the beta version on the 
main public instance until this is completed.


Attempting to convert data between different builds is not recommended. 
These tools are very sensitive to exact inputs, which extends to naming 
conventions, etc. The best practice path is to start and continue an 
analysis project with the same exact genome build throughout.


If you want to use the hg19 indexes provided by the GATK project, a 
cloud instance is the current option (using a hg19 genome as a 'custom 
genome' will exceed the processing limits available on the public Galaxy 
instance). Following the links on the GATK tools can provide more 
information about sources, including links on the GATK web site which 
will note the exact contents of the both of these genome versions, 
downloads, and other resources.


Hopefully this helps to clear up any confusion,

Best,

Jen
Galaxy team

On 6/21/12 7:50 AM, Lilach Friedman wrote:

Hi Jennifer,
Thank you for this reply.

I made a new BWA file, this time using the hg19(full) genome.
However, when I am trying to use DepthOfCoverage, the reference genomr 
is stucked on the hg_g1k_v37 (this is the only option to select), and 
I cannot change it to hg19(full). Most probably, because I selected 
hg_g1k_v37 in the previous time I tried to use DepthOfCoverage.

It seems as a bug? How can I change it?

Thanks,
  Lilach


2012/6/18 Jennifer Jackson mailto:j...@bx.psu.edu>>

Hi Lilach,

The problem with this analysis probably has to do with a mismatch
between the genomes: the intervals obtained from UCSC (hg19) and
the BAM from your BWA (hg_g1k_v37) run.

UCSC does not contain the genome 'hg_g1k_v37' - the genome
available from UCSC is 'hg19'.

Even though these are technically the same human release, on a
practical level, they have a different arrangement for some of the
chromosomes. You can compare NBCI GRCh37
  with UCSC
hg19  for an explanation. Reference
genomes must be /exact/ in order to be used with tools - base for
base. When they are exact, the identifier will be exact between
Galaxy and the source (UCSC, Ensembl) or the full Build name will
provide enough information to make a connection to NCBI or other.

Sometimes genomes are similar enough that a dataset sourced from
one can be used with another, if the database attribute is changed
and the data from the regions that differ is removed. This may be
possible in your case, only trying will let you know how difficult
it actually is with your analysis. The GATK pipeline is very
sensitive to exact inputs. You will need to be careful with genome
database assignments, etc. Following the links on the tool forms
to the GATK help pages can provide some more detail about expected
inputs, if this is something that you are going to try.

Good luck with the re-run!

Jen
Galaxy team


On 6/18/12 4:42 AM, Lilach Friedman wrote:

Hi,
I am trying to used Depth of Coverage to see the coverages is
specific intervals.
The intervals were taken from UCSC (exons of 2 genes), loaded to
Galaxy and the file type was changed to intervals.

I gave to Depth of Coverage two BAM files (resulted from BWA,
selection of only raws with the Matching pattern: XT:A:U, and
then SAM-to-BAM)
and the intervals file (in advanced GATK options).
The consensus genome is hg_g1k_v37.

I got the following error message:

An error occurred running this job: /Picked up _JAVA_OPTIONS:
-Djava.io.tmpdir=/space/g2main
# ERROR

--
# ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
# ERROR The invalid argume


/Is it a bug, or did I do anything wrong?

I will be grateful for any help.

Thanks!
   Lilach/
/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
atusegalaxy.org  .  Please keep all replies on the 
list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


-- 
Jennifer Jackson

http://galaxyproject.org



--
Jennifer Jackson
http://galaxyproject.org



___
The Galaxy Use

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-24 Thread Lilach Friedman

Hi Carlos,
Thank you very much for this explanation.

The format of my intervals file is:

chr133289059732890664NM_59_cds_1_0_chr13_32890598_f0+chr1332893213
32893462NM_59_cds_2_0_chr13_32893214_f0+chr133289921232899321
NM_59_cds_3_0_chr13_32899213_f0+chr133290023732900287
NM_59_cds_4_0_chr13_32900238_f0+etc...

Can you please explain me how to change this format so I will be able to
give it as an input to DepthOfCoverage

Thanks,
   Lilach

2012/6/21 Carlos Borroto 

> On Thu, Jun 21, 2012 at 10:50 AM, Lilach Friedman 
> wrote:
> > Hi Jennifer,
> > Thank you for this reply.
> >
> > I made a new BWA file, this time using the hg19(full) genome.
> > However, when I am trying to use DepthOfCoverage, the reference genomr is
> > stucked on the hg_g1k_v37 (this is the only option to select), and I
> cannot
> > change it to hg19(full). Most probably, because I selected hg_g1k_v37 in
> the
> > previous time I tried to use DepthOfCoverage.
> > It seems as a bug? How can I change it?
> >
>
> Hi Lilach,
>
> I have been dealing with these issues for some time now.
>
> The only genome you can use with Picard and GATK tools in Galaxy is
> hg_g1k_v37. I think this is why.
>
> From GATK Wiki[1]:
> "If you are using human data, your reads must be aligned to one of the
> official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The
> contig ordering in the reference you used must exactly match that of
> one of the official references canonical orderings. These are defined
> by historical karotyping of largest to smallest chromosomes, followed
> by the X, Y, and MT. The order is thus 1, 2, 3, ..., 10, 11, 12, ...
> 20, 21, 22, X, Y, MT. The GATK will detect misordered contigs (for
> example, lexicographically sorted) and throw an error. This draconian
> approach, though unnecessary technically, ensures that all
> supplementary data provided with the GATK works correctly. You can use
> ReorderSam to fix a BAM file aligned to a missorted reference
> sequence."
>
> [1]
> http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK
>
> So far what I have done when presented with a BAM file produced with
> reference with lexicographical chromosomes ordering, is to use
> Picard's ReorderSam tool, also in Galaxy, selecting hg_g1k_v37 as
> reference. You might not be able to this, as if a recall correctly
> hg19 also use chr1, chr2... instead of 1, 2, ... In that case more
> work needs to be done and at that point is almost easier to just remap
> with the correct reference for use with GATK. In your case it seems
> you already have it. What you might need to do is resort your
> intervals file and probably change the chromosomes identifiers, this I
> think can be done inside Galaxy.
>
> I would love to hear comments about this approach, as sometime I do
> worry like Hiram's comment hints to, that hg19 and hg_g1k_v37 might
> not be completely identical beside the chromosome ordering. In that
> case my resorted BAM or intervals files might be incorrect.
>
> Hope it helps,
> Carlos
>
> > Thanks,
> >   Lilach
> >
> >
> >
> > 2012/6/18 Jennifer Jackson 
> >>
> >> Hi Lilach,
> >>
> >> The problem with this analysis probably has to do with a mismatch
> between
> >> the genomes: the intervals obtained from UCSC (hg19) and the BAM from
> your
> >> BWA (hg_g1k_v37) run.
> >>
> >> UCSC does not contain the genome 'hg_g1k_v37' - the genome available
> from
> >> UCSC is 'hg19'.
> >>
> >> Even though these are technically the same human release, on a practical
> >> level, they have a different arrangement for some of the chromosomes.
> You
> >> can compare NBCI GRCh37  with UCSC hg19 for an explanation. Reference
> >> genomes must be exact in order to be used with tools - base for base.
> When
> >> they are exact, the identifier will be exact between Galaxy and the
> source
> >> (UCSC, Ensembl) or the full Build name will provide enough information
> to
> >> make a connection to NCBI or other.
> >>
> >> Sometimes genomes are similar enough that a dataset sourced from one can
> >> be used with another, if the database attribute is changed and the data
> from
> >> the regions that differ is removed. This may be possible in your case,
> only
> >> trying will let you know how difficult it actually is with your
> analysis.
> >> The GATK pipeline is very sensitive to exact inputs. You will need to be
> >> careful with genome database assignments, etc. Following the links on
> the
> >> tool forms to the GATK help pages can provide some more detail about
> >> expected inputs, if this is something that you are going to try.
> >>
> >> Good luck with the re-run!
> >>
> >> Jen
> >> Galaxy team
> >>
> >>
> >> On 6/18/12 4:42 AM, Lilach Friedman wrote:
> >>
> >> Hi,
> >> I am trying to used Depth of Coverage to see the coverages is specific
> >> intervals.
> >> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
> >> and the file type was changed to intervals.
> >>
> >> I gave to Depth of Coverage two BA

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-21 Thread Carlos Borroto

On Thu, Jun 21, 2012 at 10:50 AM, Lilach Friedman  wrote:
> Hi Jennifer,
> Thank you for this reply.
>
> I made a new BWA file, this time using the hg19(full) genome.
> However, when I am trying to use DepthOfCoverage, the reference genomr is
> stucked on the hg_g1k_v37 (this is the only option to select), and I cannot
> change it to hg19(full). Most probably, because I selected hg_g1k_v37 in the
> previous time I tried to use DepthOfCoverage.
> It seems as a bug? How can I change it?
>

Hi Lilach,

I have been dealing with these issues for some time now.

The only genome you can use with Picard and GATK tools in Galaxy is
hg_g1k_v37. I think this is why.

From GATK Wiki[1]:
"If you are using human data, your reads must be aligned to one of the
official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The
contig ordering in the reference you used must exactly match that of
one of the official references canonical orderings. These are defined
by historical karotyping of largest to smallest chromosomes, followed
by the X, Y, and MT. The order is thus 1, 2, 3, ..., 10, 11, 12, ...
20, 21, 22, X, Y, MT. The GATK will detect misordered contigs (for
example, lexicographically sorted) and throw an error. This draconian
approach, though unnecessary technically, ensures that all
supplementary data provided with the GATK works correctly. You can use
ReorderSam to fix a BAM file aligned to a missorted reference
sequence."

[1]http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK

So far what I have done when presented with a BAM file produced with
reference with lexicographical chromosomes ordering, is to use
Picard's ReorderSam tool, also in Galaxy, selecting hg_g1k_v37 as
reference. You might not be able to this, as if a recall correctly
hg19 also use chr1, chr2... instead of 1, 2, ... In that case more
work needs to be done and at that point is almost easier to just remap
with the correct reference for use with GATK. In your case it seems
you already have it. What you might need to do is resort your
intervals file and probably change the chromosomes identifiers, this I
think can be done inside Galaxy.

I would love to hear comments about this approach, as sometime I do
worry like Hiram's comment hints to, that hg19 and hg_g1k_v37 might
not be completely identical beside the chromosome ordering. In that
case my resorted BAM or intervals files might be incorrect.

Hope it helps,
Carlos

> Thanks,
>   Lilach
>
>
>
> 2012/6/18 Jennifer Jackson 
>>
>> Hi Lilach,
>>
>> The problem with this analysis probably has to do with a mismatch between
>> the genomes: the intervals obtained from UCSC (hg19) and the BAM from your
>> BWA (hg_g1k_v37) run.
>>
>> UCSC does not contain the genome 'hg_g1k_v37' - the genome available from
>> UCSC is 'hg19'.
>>
>> Even though these are technically the same human release, on a practical
>> level, they have a different arrangement for some of the chromosomes. You
>> can compare NBCI GRCh37  with UCSC hg19 for an explanation. Reference
>> genomes must be exact in order to be used with tools - base for base. When
>> they are exact, the identifier will be exact between Galaxy and the source
>> (UCSC, Ensembl) or the full Build name will provide enough information to
>> make a connection to NCBI or other.
>>
>> Sometimes genomes are similar enough that a dataset sourced from one can
>> be used with another, if the database attribute is changed and the data from
>> the regions that differ is removed. This may be possible in your case, only
>> trying will let you know how difficult it actually is with your analysis.
>> The GATK pipeline is very sensitive to exact inputs. You will need to be
>> careful with genome database assignments, etc. Following the links on the
>> tool forms to the GATK help pages can provide some more detail about
>> expected inputs, if this is something that you are going to try.
>>
>> Good luck with the re-run!
>>
>> Jen
>> Galaxy team
>>
>>
>> On 6/18/12 4:42 AM, Lilach Friedman wrote:
>>
>> Hi,
>> I am trying to used Depth of Coverage to see the coverages is specific
>> intervals.
>> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
>> and the file type was changed to intervals.
>>
>> I gave to Depth of Coverage two BAM files (resulted from BWA, selection of
>> only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
>> and the intervals file (in advanced GATK options).
>> The consensus genome is hg_g1k_v37.
>>
>> I got the following error message:
>>
>> An error occurred running this job: Picked up _JAVA_OPTIONS:
>> -Djava.io.tmpdir=/space/g2main
>> # ERROR
>> --
>> # ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
>> # ERROR The invalid argume
>>
>>
>> Is it a bug, or did I do anything wrong?
>>
>> I will be grateful for any help.
>>
>> Thanks!
>>    Lilach
>>
>>
>> __

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-21 Thread Lilach Friedman

Hi Jennifer,
Thank you for this reply.

I made a new BWA file, this time using the hg19(full) genome.
However, when I am trying to use DepthOfCoverage, the reference genomr is
stucked on the hg_g1k_v37 (this is the only option to select), and I cannot
change it to hg19(full). Most probably, because I selected hg_g1k_v37 in
the previous time I tried to use DepthOfCoverage.
It seems as a bug? How can I change it?

Thanks,
  Lilach


2012/6/18 Jennifer Jackson 

>  Hi Lilach,
>
> The problem with this analysis probably has to do with a mismatch between
> the genomes: the intervals obtained from UCSC (hg19) and the BAM from your
> BWA (hg_g1k_v37) run.
>
> UCSC does not contain the genome 'hg_g1k_v37' - the genome available from
> UCSC is 'hg19'.
>
> Even though these are technically the same human release, on a practical
> level, they have a different arrangement for some of the chromosomes. You
> can compare NBCI GRCh37
> with UCSC hg19  for an explanation. Reference
> genomes must be *exact* in order to be used with tools - base for base.
> When they are exact, the identifier will be exact between Galaxy and the
> source (UCSC, Ensembl) or the full Build name will provide enough
> information to make a connection to NCBI or other.
>
> Sometimes genomes are similar enough that a dataset sourced from one can
> be used with another, if the database attribute is changed and the data
> from the regions that differ is removed. This may be possible in your case,
> only trying will let you know how difficult it actually is with your
> analysis. The GATK pipeline is very sensitive to exact inputs. You will
> need to be careful with genome database assignments, etc. Following the
> links on the tool forms to the GATK help pages can provide some more detail
> about expected inputs, if this is something that you are going to try.
>
> Good luck with the re-run!
>
> Jen
> Galaxy team
>
>
> On 6/18/12 4:42 AM, Lilach Friedman wrote:
>
>  Hi,
> I am trying to used Depth of Coverage to see the coverages is specific
> intervals.
> The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy
> and the file type was changed to intervals.
>
> I gave to Depth of Coverage two BAM files (resulted from BWA, selection of
> only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
> and the intervals file (in advanced GATK options).
> The consensus genome is hg_g1k_v37.
>
> I got the following error message:
>
>  An error occurred running this job: *Picked up _JAVA_OPTIONS:
> -Djava.io.tmpdir=/space/g2main
> # ERROR
> --
> # ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
> # ERROR The invalid argume
>
>
> *Is it a bug, or did I do anything wrong?
>
> I will be grateful for any help.
>
> Thanks!
>Lilach*
> *
>
>
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
>   http://lists.bx.psu.edu/
>
>
> --
> Jennifer Jacksonhttp://galaxyproject.org
>
>
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-18 Thread Church, Deanna (NIH/NLM/NCBI) [E]

If hg_g1K_v37 == "1000 Genomes version of GRCh37" then it is the GRCh37
Primary assembly + a decoy sequence to try to soak up off target reads.
The chromosome coordinates are the same but the sequences included in the
packages are different.
Here is the description from the 1000 Genomes site:
http://www.1000genomes.org/category/assembly

Deanna

On 6/18/12 3:30 PM, "Hiram Clawson"  wrote:

>I'm curious what is this genome called 'hg_g1k_v37'
>and how does it correspond to NCBI GRCh37 which is
>identical to UCSC hg19 ?
>
>--Hiram
>
>
>Jennifer Jackson wrote:
>> UCSC does not contain the genome 'hg_g1k_v37' - the genome available
>> from UCSC is 'hg19'.
>> 
>> Even though these are technically the same human release, on a
>>practical 
>> level, they have a different arrangement for some of the chromosomes.
>> You can compare NBCI GRCh37
>>   with UCSC hg19
>>  for an explanation. Reference genomes must be
>> /exact/ in order to be used with tools - base for base. When they are
>> exact, the identifier will be exact between Galaxy and the source
>>(UCSC, 
>> Ensembl) or the full Build name will provide enough information to make
>> a connection to NCBI or other.
>> 
>> Sometimes genomes are similar enough that a dataset sourced from one
>>can 
>> be used with another, if the database attribute is changed and the data
>> from the regions that differ is removed. This may be possible in your
>> case, only trying will let you know how difficult it actually is with
>> your analysis. The GATK pipeline is very sensitive to exact inputs. You
>> will need to be careful with genome database assignments, etc.
>>Following 
>> the links on the tool forms to the GATK help pages can provide some
>>more 
>> detail about expected inputs, if this is something that you are going
>>to 
>> try.
>___
>The Galaxy User list should be used for the discussion of
>Galaxy analysis and other features on the public server
>at usegalaxy.org.  Please keep all replies on the list by
>using "reply all" in your mail client.  For discussion of
>local Galaxy instances and the Galaxy source code, please
>use the Galaxy Development list:
>
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
>
>To manage your subscriptions to this and other Galaxy lists,
>please use the interface at:
>
>  http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-18 Thread Hiram Clawson


I'm curious what is this genome called 'hg_g1k_v37'
and how does it correspond to NCBI GRCh37 which is
identical to UCSC hg19 ?

--Hiram


Jennifer Jackson wrote:
UCSC does not contain the genome 'hg_g1k_v37' - the genome available 
from UCSC is 'hg19'.


Even though these are technically the same human release, on a practical 
level, they have a different arrangement for some of the chromosomes. 
You can compare NBCI GRCh37 
  with UCSC hg19 
 for an explanation. Reference genomes must be 
/exact/ in order to be used with tools - base for base. When they are 
exact, the identifier will be exact between Galaxy and the source (UCSC, 
Ensembl) or the full Build name will provide enough information to make 
a connection to NCBI or other.


Sometimes genomes are similar enough that a dataset sourced from one can 
be used with another, if the database attribute is changed and the data 
from the regions that differ is removed. This may be possible in your 
case, only trying will let you know how difficult it actually is with 
your analysis. The GATK pipeline is very sensitive to exact inputs. You 
will need to be careful with genome database assignments, etc. Following 
the links on the tool forms to the GATK help pages can provide some more 
detail about expected inputs, if this is something that you are going to 
try.

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-18 Thread Jennifer Jackson


Hi Lilach,

The problem with this analysis probably has to do with a mismatch 
between the genomes: the intervals obtained from UCSC (hg19) and the BAM 
from your BWA (hg_g1k_v37) run.


UCSC does not contain the genome 'hg_g1k_v37' - the genome available 
from UCSC is 'hg19'.


Even though these are technically the same human release, on a practical 
level, they have a different arrangement for some of the chromosomes. 
You can compare NBCI GRCh37 
  with UCSC hg19 
 for an explanation. Reference genomes must be 
/exact/ in order to be used with tools - base for base. When they are 
exact, the identifier will be exact between Galaxy and the source (UCSC, 
Ensembl) or the full Build name will provide enough information to make 
a connection to NCBI or other.


Sometimes genomes are similar enough that a dataset sourced from one can 
be used with another, if the database attribute is changed and the data 
from the regions that differ is removed. This may be possible in your 
case, only trying will let you know how difficult it actually is with 
your analysis. The GATK pipeline is very sensitive to exact inputs. You 
will need to be careful with genome database assignments, etc. Following 
the links on the tool forms to the GATK help pages can provide some more 
detail about expected inputs, if this is something that you are going to 
try.


Good luck with the re-run!

Jen
Galaxy team

On 6/18/12 4:42 AM, Lilach Friedman wrote:

Hi,
I am trying to used Depth of Coverage to see the coverages is specific 
intervals.
The intervals were taken from UCSC (exons of 2 genes), loaded to 
Galaxy and the file type was changed to intervals.


I gave to Depth of Coverage two BAM files (resulted from BWA, 
selection of only raws with the Matching pattern: XT:A:U, and then 
SAM-to-BAM)

and the intervals file (in advanced GATK options).
The consensus genome is hg_g1k_v37.

I got the following error message:

An error occurred running this job: /Picked up _JAVA_OPTIONS: 
-Djava.io.tmpdir=/space/g2main
# ERROR 
--

# ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
# ERROR The invalid argume


/Is it a bug, or did I do anything wrong?

I will be grateful for any help.

Thanks!
   Lilach/
/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://galaxyproject.org

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] Problem with Depth of Coverage on BAM files (GATK tools)

2012-06-18 Thread Lilach Friedman

Hi,
I am trying to used Depth of Coverage to see the coverages is specific
intervals.
The intervals were taken from UCSC (exons of 2 genes), loaded to Galaxy and
the file type was changed to intervals.

I gave to Depth of Coverage two BAM files (resulted from BWA, selection of
only raws with the Matching pattern: XT:A:U, and then SAM-to-BAM)
and the intervals file (in advanced GATK options).
The consensus genome is hg_g1k_v37.

I got the following error message:

 An error occurred running this job: *Picked up _JAVA_OPTIONS:
-Djava.io.tmpdir=/space/g2main
# ERROR
--
# ERROR A USER ERROR has occurred (version 1.4-18-g80a4ce0):
# ERROR The invalid argume


*Is it a bug, or did I do anything wrong?

I will be grateful for any help.

Thanks!
   Lilach*
*
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem using Galaxy

2012-05-23 Thread Nate Coraor

Hi,

Please try starting with:

$ LC_ALL=C ./run.sh

--nate

On May 18, 2012, at 11:22 AM, Seyed Mehdi Jazayeri wrote:

> 
> Dear Sir/Madam,
> 
> I am a PhD student working on RNA-Seq as my dissertation. As a matter of fact 
> I want to do analyses of gene expressions for the sequences that I have and 
> for that I have tried to use Galaxy tools as it is one of the best platforms 
> in order to do analysis for RNA-Seq as well as others. I did all about 
> installation of Galaxy on my Mac OS 10.7 Lion but when I run the commands I 
> do not get any result from running any type of commands. And when I do run.sh 
> I will have nothing done. As a sample I send you the command I ran on my 
> system as follow
> 
> iMac-de-Biologia:galaxy-dist LabBioMol$ ./run.sh
> Traceback (most recent call last):
>   File "./scripts/paster.py", line 34, in 
> command.run()
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteScript-1.7.3-py2.7.egg/paste/script/command.py",
>  line 84, in run
> invoke(command, command_name, options, args[1:])
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteScript-1.7.3-py2.7.egg/paste/script/command.py",
>  line 123, in invoke
> exit_code = runner.run(args)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteScript-1.7.3-py2.7.egg/paste/script/command.py",
>  line 218, in run
> result = self.command()
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteScript-1.7.3-py2.7.egg/paste/script/serve.py",
>  line 276, in command
> relative_to=base, global_conf=vars)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteScript-1.7.3-py2.7.egg/paste/script/serve.py",
>  line 313, in loadapp
> **kw)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 204, in loadapp
> return loadobj(APP, uri, name=name, **kw)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 224, in loadobj
> global_conf=global_conf)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 248, in loadcontext
> global_conf=global_conf)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 278, in _loadconfig
> return loader.get_context(object_type, name, global_conf)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 413, in get_context
> section)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 458, in _context_from_explicit
> value = import_string(found_expr)
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/PasteDeploy-1.3.3-py2.7.egg/paste/deploy/loadwsgi.py",
>  line 18, in import_string
> return pkg_resources.EntryPoint.parse("x="+s).load(False)
>   File "/Users/LabBioMol/galaxy-python/galaxy-dist/lib/pkg_resources.py", 
> line 1954, in load
> entry = __import__(self.module_name, globals(),globals(), ['__name__'])
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/lib/galaxy/web/__init__.py", line 
> 5, in 
> from framework import expose, json, json_pretty, require_login, 
> require_admin, url_for, error, form, FormBuilder, expose_api
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/lib/galaxy/web/framework/__init__.py",
>  line 31, in 
> from babel.support import Translations
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/Babel-0.9.4-py2.7.egg/babel/support.py",
>  line 29, in 
> from babel.dates import format_date, format_datetime, format_time, LC_TIME
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/Babel-0.9.4-py2.7.egg/babel/dates.py",
>  line 34, in 
> LC_TIME = default_locale('LC_TIME')
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/Babel-0.9.4-py2.7.egg/babel/core.py",
>  line 642, in default_locale
> return '_'.join(filter(None, parse_locale(locale)))
>   File 
> "/Users/LabBioMol/galaxy-python/galaxy-dist/eggs/Babel-0.9.4-py2.7.egg/babel/core.py",
>  line 763, in parse_locale
> raise ValueError('expected only letters, got %r' % lang)
> ValueError: expected only letters, got 'utf-8'
> iMac-de-Biologia:galaxy-dist LabBioMol$ 
> 
> 
> Now I would appreciate if you could advise me what is the problem and how to 
> solve it.
> 
> Thanks for your attention in advance.
> 
> Best regards
> 
> SMJ
> -- 
> SMJ
> 
> Seyed Mehdi Jazayeri
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> u

1 2 >

1 - 100 of 165 matches

Mail list logo